[Seite 26↓]

3  Material und Methoden

3.1 Geräte und Chemikalien

3.1.1 Geräte

Tischzentrifuge, Centrifuge 5415C

Eppendorf, Hamburg

Zenrifuge, groß, Megafuge 1,0

Heraeus, Berlin

T3 Thermocycler

Biometra, Göttingen

Agarosegelkammern

Micro Bio Tec Brand, Gießen

UV-Lampe und Fotodokumentation

Cybertech, Berlin

TGGE Maxi System

Biometra, Göttingen

Inkubator für Klonierung

 

Thermoblock

Stuart Scientific, Großbritannien

LightCycler®

Roche Diagnostics GmbH, Mannheim

ABI Prism 310 Genetic Analyser

Applied Biosystems, Hilden

FACS Vantage SE

BD Biosciences, San Jose, CA, USA

FACS Calibur

BD Biosciences, San Jose, CA, USA

3.1.2 Chemikalien


[Seite innerhalb Tabelle 27↓]

PBS

1,7mM NaCl; 0,064mM KCl; 0,375% Tris-Base; 0,002% Phenolrot; pH 7,4

TBE

89mM Tris-Base; 89mM Borsäure; 2mM EDTA; pH 8,0

Agarose

UltraPure®, Life Technologies, Paisley, Scotland

Agarosegel

2% Agarose in 1x TBE-Puffer

Extraktionspuffer

50mM KCl; 10mM Tris/HCl; 0,45% nonidet-P40; 0,45% Tween20; pH 8,3

Ladepuffer

0,25% Bromphenolblau; 0,25% Xylenxyanol; 15% Ficoll

Ethidiumbromid

 

AmpliTaq DNA Polymerase

N808-0153, Roche, Branchburg, NJ, USA

AmpliTaq Gold

4311806, Roche, Branchburg, NJ, USA

10x PCR-Puffer

Applied Biosystems, AmpliTaq DNA Polymerase with Gene Amp, Cat.No. N808-0153, Foster City, CA, USA

MgCl2

DTNP

100bp DNA Ladder

Cat.No. 15628-019, Invitrogen

BSA (bovine serum albumine)

 

BSA-Lösung 100ml PBS + 10g BSA

 

FACS-Puffer

96ml PBS, 400µl EDTA, 4ml BSA-Lösung

QIAquick PCR Purification Kit,

Cat. No. 28104, Qiagen Hilden

QIAquick Gel Extraction Kit,

Cat. No. 28704, Qiagen, Hilden

ABI Prism Big Dye Terminator Cycle Sequenzing Ready Reaction Kit

Part No. 4303152, Applied Biosystems, Foster City, CA, USA

MediaTM AmpBlue

Invitrogen

TOPOTA Clononing Kit

Invitrogen

Filter

Cat.No. 352340, Falcon, Franklin Lakes, NJ, USA

Antikörper:

CD3-PE

Clone SK7

Cat.No. 345764, BD Biosciences, San Jose, CA, USA

CD3-FITC

Clone SK7

Cat.No. 345765, BD Biosciences, San Jose, CA, USA

CD7-FITC

Clone M-T701

Cat.No. 555360, BD Biosciences, San Jose, CA, USA

CD26-PE

Clone M-A261

Cat.No. 555437, BD Biosciences, San Jose, CA, USA

3.2 Patienten/ Proben

Untersucht wurden Blutproben von Patienten mit Sézary Syndrom der dermatologischen Klinik der Charité Berlin. Die Diagnose des Sézary Syndroms wurde in der Sprechstunde für kutane Lymphome der Klinik entsprechend den EORTC-Kriterien gestellt. Die Entnahme der Blutproben erfolgte vor und während der Therapie. Darüber hinaus wurde im Blut die Zahl der Leukozyten, der CD3 positiven, CD4 positiven, CD8 positiven Zellen und die LDH bestimmt. Desweiteren wurde ein klinischer körperlicher Status erhoben und die Therapie protokolliert. Für die mitgeführten Kontrollen wurde das Blut freiwilliger, gesunder Probanden genutzt. Die Bezeichnung der Proben wird aus Tabelle 4 ersichtlich.


[Seite innerhalb Tabelle 28↓]

Tab. 4: Auflistung der Patientenproben

Patient

Datum der Probe

Bezeichnung

DK

15.11.00

DK1

DK

20.11.01

DK2

DK

14.01.02

DK3a

DK

15.01.02

DK3b

FN

29.03.99

FN1

FN

07.03.01

FN2

FN

15.01.02

FN3

FN

26.03.02

FN4

OS

04.08.00

OS1

OS

01.11.00

OS2

RM

22.11.99

RM1

RM

05.05.00

RM2

RM

27.09.00

RM3

SH

29.12.98

SH1

SH

11.02.99

SH2

3.3 Präparation und Lagerung der PBMC

3.3.1 Gewinnung der PBMC

Die untersuchten mononukleären Zellen stammten aus Leukapheresen, die in der Hautklinik der Charité stattfanden bzw. aus Blutproben, die den Sézary Syndrom Patienten in der Poliklinik abgenommen wurden. Zur Gewinnung der PBMC aus dem Vollblut, wurden 20ml einer heparinisierten Probe mit PBS 1:1 verdünnt und über einem Ficollgradienten 20 min bei 2400U/min zentrifugiert. Die PBMC wurden mittels einer Pipette entnommen und anschließend zweimal gewaschen. Dazu nahm man sie in PBS auf, zentrifugierte 10min bei 1800U/min und verwarf den Überstand.

3.3.2 Lagerung der PBMC

Die gewonnen PBMC, die nicht der DNA-Gewinnung zugeführt wurden, sind zu 5x106Zellen aliquotiert und in 10% DSMO + PBS aufgenommen worden. Danach wurden sie in einem Gefäß mit Propanol langsam bis auf –70 bzw. –130°C in einem Gefrierschrank abgekühlt und eingefroren.

Die für die Untersuchung benötigten Zellen wurden dem Gefrierschrank entnommen und aufgetaut. Das Auftauen geschah in einem Wasserbad mit einer Temperatur von 37°C für die Zeit von 2min. Anschließend wurden die Zellen sofort in PBS bzw. FACS-Puffer [Seite 29↓]aufgenommen und zweimal gewaschen, d.h. zentrifugiert mit 1100U/min für 10min und nach verwerfen des Überstands wieder in Puffer aufgenommen. Vor der Zellfärbung wurden die Zellen mit Hilfe eines Filters mit einer Netzgröße von 70µm von Zelltrümmern und Zellkonglomeraten befreit.

3.3.3 Mikroskopische Zellzahlbestimmung

Zur Bestimmung der Zellzahl und Einstellen der Proben auf eine bestimmte Menge an Zellen pro Volumeneinheit, wurde zu 10µl der zu bestimmenden Zellsuspension 80µl PBS und 10µl Tryptanblau dazugegeben. Die Zugabe von Tryptanblau diente dem Ausschluss toter Zellen. Der Ansatz wurde einige Minuten bei Zimmertemperatur inkubiert und anschließend 10µl dieses Ansatzes auf eine Neubauer-Zählkammer gegeben. Unter dem Mikroskop wurde die Zellzahl in den einzelnen Quadranten bestimmt, der Wert mit der größten Abweichung verworfen und der Mittelwert (m) aus den Zählergebnissen gebildet. Mit Hilfe der Formel, die die Verdünnung der Zellsuspension (Faktor 10) und den Kammerfaktor (Faktor 104) berücksichtigt erhielt man die Zellzahl pro ml Zellsuspension (z).

 

z= m x 10 x 104

Anschließend konnte unter Zugabe von PBS die gewünschte Zellzahl pro Volumeneinheit hergestellt werden (x-Vielfache von einer Million Zellen/ml).

3.4 Zellfärbung, FACS und Zellsortierung

3.4.1 Zellfärbung

Für die Immunofluoreszenzanalyse und die Zellsortierung wurden die Zellen mit monoklonalen Antikörpern markiert. Zur Charakterisierung der Zellen wurden zwei, gegen verschiedene T-Zell Epitope gerichtete, Antikörper verwendet. Die Antikörper waren Fluoreszeinisothiocyanat (FITC) bzw. Phycoerythrin (PE) markiert. Da diese Farbstoffe überlappende Absorptionsspektren durch einen Argonlaser bei 488nm Wellenlänge zeigen, jedoch unterschiedliche Emissionsmaxima, können sie gleichzeitig zur Markierung von Zellen eingesetzt werden.

Die folgenden Angaben beziehen sich auf eine Zellzahl von 1x106 Zellen, bei mehr verfügbaren Zellen wurden die Volumina entsprechend angepasst. Zu Beginn wurde das Volumen auf 60µl Zellsuspension eingestellt und jeweils 20µl der benötigten Antikörperlösungen hinzugegeben. Die folgende Inkubation dauerte 20min bei 4°C, danach wurde der Ansatz bei 2000U/min für 7min zentrifugiert. Das zurückgebliebene Pellet mit den zu untersuchenden Zellen wurde in ca. 500-1000µl FACS-Puffer aufgenommen. Es folgte eine erneute Zentrifugation und Resuspension in FACS-Puffer. Anschließend wurden die [Seite 30↓]gefärbten Zellen der Analyse zugeführt. Die verwendeten Antikörperkombinationen sind in der Tabelle 5 dargestellt.

Tab. 5: Kombination der Antikörper für die Zellanalyse

 

1.Antikörper

2.Antikörper

1.)

CD3-FITC

CD26-PE

2.)

CD3-PE

CD7-FITC

3.)

CD7-FITC

CD26PE

3.4.2 Fluoreszenzmessung am Durchflußzytometer

Die fluoreszenzmarkierten Zellen wurden mit einen Durchflußzytometer analysiert und sortiert. Um eine konstante Qualität der Messergebnisse zu sichern, wurden dieselben Geräteeinstellungen und gespeicherten Softwareparameter verwendet, die während der Vorversuche auf die Antikörpermarkierungen abgestimmt worden waren.

Die Zellpopulationen ließen sich aufgrund ihrer Größe, Granulation und Färbeverhalten unterscheiden. Von den Streueigenschaften der Zelle wurde das Vorwärtsstreulicht (forward scatter-FSC), das ein Maß für die Größe der Zellen darstellt, und das 90°-Streulicht (side scatter-SSC), ein Maß für die Granularität, gemessen. Allein mit diesen Parametern war bereits eine Unterscheidung von Lymphozyten, Monozyten und Zelltrümmern in einer Probe von PBMC möglich.

Avitale Zellen nehmen unspezifisch Antikörper in das durch die Membranschranke normalerweise unzugängliche Zytoplasma auf. Um diese avitalen Zellpopulationen darzustellen und von der Analyse auszuschließen, wurde eine Färbung der Zellen mit Propidiumjodid durchgeführt.

Die Signale der Fluoreszenz- und Streulichtemissionen jeder einzelnen Zelle wurden gespeichert, die Daten anschließend mit Hilfe des Computerprogramms CellQuest® ausgewertet und in einem Punktdiagramm (DotPlot) dargestellt. Bei der Auswertung wurde zunächst die interessierende Population der Lymphozyten mit Hilfe der Parameterkombination Vorwärtsstreulicht für die Größe und Seitwärtsstreulicht für die Granularität eingegrenzt. Diesen Vorgang des Eingrenzens nennt man gaten, das Fenster heißt Gate. Die Zellen dieses Lymphozytengates wurden dann auf die Aufnahme von Propidiumjodid untersucht (Darstellung der avitalen Zellen) und nur die vitalen Zellen erneut gegatet. Durch dieses elektronische Gaten konnten die vitalen Lymphozyten phänotypisiert werden.


[Seite 31↓]

3.4.3  Zellsortierung mittels CellSorter

Die Zellsortierung erfolgte an dem System FACSVantage® der Firma Beckton-Dickison. Dieser CellSorter ist ein Durchflußzytometer, der neben dem Zählen und Phänotypisieren einzelner Zellpopulationen eine gleichzeitige Trennung der Zellen ermöglicht. Hierzu wurden mit Hilfe der Software für den CellSorter die gewünschten Gates für die zu trennenden Zellpopulationen festgelegt.

Die Geschwindigkeit der Sortierung wurde auf 2000 Zellen/sec festgelegt. Die Abbruchrate wurde auf weniger als 10Zellen/ 2000 sortierte Zellen festgelegt. Die Abbruchrate gibt an, wie viele Zellen pro 2000 sortierter Zellen aufgrund von Ungenauigkeiten verworfen wurden.

Es konnten gleichzeitig zwei verschiedene Zellpopulationen präpariert werden.

Eingesetzt wurden die beschriebenen mit PE- und FITC-Antikörpern markierten Zellen. Die Zellen wurden in CD3+CD7+ und CD3+CD7- bzw. in CD3+CD26+ und CD3+CD26- Zellpopulationen aufgetrennt. Auch hier wurde eine Gegenfärbung mit Propidiumjodid zum Ausschluss avitaler Zellen durchgeführt.

3.5 DNA-Extraktion/ Konsensus PCR/ TCR-β-PCR/ Agarosegelelektrophorese/ TGGE

3.5.1 DNA-Extraktion

Die DNA-Extraktion erfolgte mit Hilfe eines Proteinase K Aufschlusses und einem DNA-Extraktion-Kit (Roche-Kit für DNA-Extraktion).

Für die Extraktion mit Hilfe eines Proteinase K Aufschlusses wurden zu der gewonnen Zellsuspension 200µl Extraktionspuffer und 20µl Proteinase K hinzugegeben und anschließend bei 55°C mindestens 4h inkubiert. Anschließend erhitzte man die Probe für 15min auf 95°C, wobei die Proteinase K thermisch inaktiviert wurde und zentrifugierte 10min bei 13000U/min. Der Überstand wurde für die weiteren Untersuchungen eingesetzt.

Die Extraktion der DNA der sortierten Zellen mit dem Roche-Kit war für die Weiterverwendung im LightCycler® nötig. Die Gewinnung der DNA erfolgte wie im Protokoll zu diesem Kit beschrieben. Abweichend wurde im letzten Schritt die DNA in 50µl aufgenommen um eine höhere DNA Konzentration zu erreichen.

3.5.2 TCR-γ-PCR

Bei der TCR-γ-PCR kamen die Primer Vγcons und Jγcons (Volkenandt et al. 1991) zum Einsatz. Die Sequenz der Primer ist in der Tabelle 6 dargestellt.

Diese Primer amplifizieren die Rearrangements der TCR-VγI (Vγ1-8)- mit TCR-Jγ1/2- [Seite 32↓]Gensegmente, die in 70% der Fälle von kutanen Lymphomen rearrangieren (Breit at al. 1992).

Der Reaktionsansatz zu 50µl enthielt 5µl 10xPCR Puffer, 4mM MgCl2, 70µM je dNTP, je 1µM Primer, 1,75µM TaqPolymerase und 5µl der extrahierten DNA der zu untersuchenden Proben. Nach dem Fertigstellen des Ansatzes, durchliefen die Proben das Programm 1 im Thermocycler (s. Tabelle 7)

3.5.3 TCR-β-PCR

Die Durchführung der TCR-β-PCR erfolgte im Reaktionsansatz von 50µl. Dieser enthielt 10xPCR-Puffer, MgCl2 entsprechend den verwendeten Primern, dargestellt in Tabelle 7, dNTP, TaqPolymerase und 5µl zu untersuchende DNA. Die Primer wurden zu 1µM in folgender Kombination dazugegeben:

Vβ-Primer + JβI-1 + JβII-1

Vβ-Primer + JβI-2 + JβII-2,

nähere Angaben zu den Primern sind in Tabelle 6 aufgeführt.

Die notwendigen Programme richteten sich nach den geforderten Bedingungen der einzelnen Vβ-Primer (dargestellt in Tabelle 7).

Tab. 6: verwendete Primer

Name des Primers

Sequenz

Vγcons (1)

5’CTACATCCACTGGTACCT

Jγcons (1)

5’CAACAAGTGTTGTTCCAC

Vg18 (2)

5`ggTCATCWgCTgWAATCAC

Vβ5 (3)

5’CTGATCAAAACGAGAGGACAGCA

Vβ16 (3)

5’TgTgACCCAATTTCTggACATgATAAT

Vβ17 (3)

5’GAACAGAATTTGAACCACGATGCC

JβI-1 (3)

5’CTCGGATCC(T/A)GAG(C/T)CI(G/A)GT(C/T)CCIIIICCAAA

JβII-1 (3)

5’CTCGGATCCT(G/C)AGCC(T/G)IGTGCCIG(G/C)ICCGAA

JβI-2 (3)

5’CTCGGATCCACIG(T/A)GAG(C/T)CI(G/A)GT(C/T)CC

JβII-2 (3)

5’CTCGGATCCACIGT(G/C)AGCC(T/G)IGTGCC

(1) Volkenandt et al. 1991, (2) Muche 1995, (3) Moss et al. 1997

3.5.4 PCR-Programme

Die für die molekularbiologischen Untersuchungen verwendeten PCR-Programme sind in Tabelle 7 aufgeführt.


[Seite innerhalb Tabelle 33↓]

Tab. 7: verwendete PCR-Programme

Nummer

Ansatz

PCR-Programm

V-Primer

J- bzw. N-Primer

[MgCl2] (in mM)

Annealing-temperatur (in °C)

Zyklenzahl

Hotstart

Produktgröße

(bp)

1

Vgcons

Jgcons

4

55

40

nein

260

2

Vb5

jeweils

JI/II-1 bzw.

JI/II-2

2,5

58

40

nein

295

3

Vb16

2,5

62

40

nein

263

4

Vb17

2,5

62

40

nein

257

5

Vg18

Jgcons

2,5

55

40

nein

260

6

Vb16

HeiB1

4

66

35

ja

239

7

Vg18

Kant1

4

60

35

ja

262

8

Vb17

MurB1

4

68

35

ja

210

9

Vb17

Neb3

2,5

66

30

ja

241

10

Vb5

SelbB1

2,5

66

30

ja

262

Hotstart: anstelle der AmpliTaq wurde die AmpliTaq-Gold verwendet

Diese Programme sind für eine PCR im Thermocycler entwickelt worden.

3.5.5 Agarosegelelektrophorese

Für die Überprüfung der PCR wurde ein 2%iges Agarosegel mit 0,01% Ethidiumbromid hergestellt. Es wurden 8µl des PCR-Produkts nach Zusatz von 2µl Ladepuffer aufgetragen. Zur Kontrolle der Größe der Amplifikate wurde mit jeder Elektrophorese ein Marker (100bp Ladder, In Vitrogen) mitgeführt. Die Gele wurden in 1x TBE-Puffer bei 60V eine Stunde aufgetrennt und bei UV-Durchleuchtung dokumentiert.

3.5.6 Temperaturgradientengelelektrophorese (HD-TGGE-PAGE)

Zur Gewinnung der Heteroduplexe wurden 5µl Amplifikat mit 0,5µl Ladepuffer auf 95°C für 3min denaturiert und anschließend über 10min auf 55°C abgekühlt und 20min inkubiert. Die so gewonnen Heteroduplices wurden zu 7µl je Probe auf einem 1 mm dicken Polyacrylamidgel entsprechend dem Protokoll mit einem Temperaturgradienten von 20°C bis 55°C bei 300V-350V und 2h 40 min Laufzeit unter Nutzung des Diagen HD-TGGE-Systems® (Diagen, Hilden, Germany) aufgetrennt. Die Gele wurden einer Silberfärbung entsprechend dem Protokoll Qiagen Silver Staining Protocol für TGGE-Gele zugeführt, fotografiert und in Folie eingeschweißt und aufbewahrt.


[Seite 34↓]

3.6  PCR-Produktaufreinigung/ Re-PCR/ Klonierung/ Sequenzierung/ klonspezifische Primer

3.6.1 PCR-Produktaufreinigung

PCR-Produkte enthalten überschüssige dNTPs, Primer und Primerdimere, die vor einer weiteren Verwendung entfernt werden müssen. Um das spezifische PCR-Produkt zu gewinnen, wurde nach der HD-TGGE die Bande gesuchter Größe aus dem Gel ausgeschnitten und in einem 2ml Eppendorfgefäß mit 1x PCR-Puffer ca.8h geschüttelt. Auf diese Weise wurde die ausgeschnittene DNA aus dem Gel herausgelöst und konnte reamplifiziert werden.(s.u.)

Für die Herstellung Patienten-spezifischer Standardverdünnungen waren ebenfalls aufgereinigte PCR-Produkte nötig. Hierzu wurden die Proben in einem Agarosegel aufgetrennt. Die Anzahl der Basenpaare der gesuchten DNA war bekannt. Die DNA stellte sich im Agarosegel als Bande dar. Die Bande gesuchter Größe wurde mit einem Skalpell ausgeschnitten und zur DNA Extraktion mit dem QIAquick Gel Extraction Kit® behandelt. Zur Kontrolle, wurde anschließend ein Aliqot des gewonnen Produkts nochmals im Agarosegel begutachtet.

Zur Vorbereitung des PCR-Produktes für die Sequenzierung sind die entsprechenden Proben mit dem QIAquick PCR Purification Kit analog dem Protokoll aufgereinigt worden.

3.6.2 Re-PCR

Um die DNA aus den PCR-Produkten sequenzieren zu können, wurde wie schon beschrieben eine HD-TGGE durchgeführt und das gesuchte Produkt wie in 3.6.1 beschrieben gewonnen. Die Konzentration des PCR-Produktes musste mit Hilfe einer erneuten PCR (s.g. Re-PCR) erhöht werden. Dabei ist das Produkt wie eine DNA-Probe mit dem entsprechenden PCR-Protokoll behandelt worden. Nach der schon beschriebenen Aufreinigung ist anhand der Agarosegelelektrophorese festgelegt worden, wieviel DNA der Sequenzierung zugeführt wurde.

3.6.3 Klonierung

In Vorbereitung der Klonierung wurden die Bakterienkulturplatten mit Hilfe des Media Amp Blue Kit® hergestellt. Die Klonierung erfolgte analog der Vorgabe des TOPO-TA Cloning Kit®. Die Bakterienkolonien, die die gesuchte DNA in ihr Plasmid einbauten, stellten sich auf den Gel-Platten als blaue Kolonien dar. Um diese DNA sequenzieren zu können, war ein Einsatz dieser DNA in einer PCR nötig. Hierzu wurde ein entsprechender PCR-Ansatz vorbereitet, bei dem nur noch die DNA fehlte. Die betreffenden Kolonien wurden einzeln von [Seite 35↓]der Platte gewonnen und sofort in den PCR-Ansatz eingebracht. Die DNA wurde amplifiziert und sequenziert.

3.6.4 Sequenzierung

Zur Gewinnung von Einzelstrang DNA kamen 5-10ng DNA in einer Sequenzier-PCR zum Einsatz. Diese wurde mit dem ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit® entsprechend dem Protokoll des Herstellers durchgeführt. Dieses Kit enthielt, zusätzlich zu den dNTP einer einfachen PCR, DidesoxyTrinukleotide, die mit vier verschiedenen Farbstoffen, entsprechend der Basen, markiert waren.

Die Sequenzierung, eine so genannte Zyklussequenzierung, wurde auf dem ABI Prism 310® (Automatischer DNA Sequenzierer), einem Kapillar-Sequenziergerät durchgeführt. Dieses Gerät erkannte mit Hilfe eines Lasers die markierten Sequenzen und ordnete jeder Länge eine Base zu. Entsprechend der Häufigkeit der Sequenz konnte am Ende der Analyse aus dem sich ergebenen Bild auf die Originalsequenz gefolgert werden.

Mittels Vergleichs der gewonnenen Sequenzen der TCR-γ- und TCR-β-Gene mit aus der EMBO- und NCBI-Datenbank entnommenen einzelnen TCR-Gensequenzen wurden die patientenspezifischen N-Sequenzen bestimmt (Forster et al. 1987, Lefranc et al. 1989, NCBI-Database).

3.6.5 klonspezifische Primer

Um einen T-Zell-Klon eindeutig zu identifizieren, ist eine Sequenzierung eines rearrangierten TCR-Gens unumgänglich. Mit einer Sequenzierung erhält man einen molekularen Fingerabdruck des T-Zell-Klon (Lessin et al. 1991). Um die Sequenz von einem polyklonalen Hintergrund identifizieren zu können, ist in einigen Fällen eine Klonierung der Sequenzen erforderlich (Kneba et al. 1994). Der entscheidende, eine T-Zelle identifizierende Abschnitt einer Sequenz eines T-Zell-Rezeptors ist die so genannte N-Region. Diese entsteht durch zufällig eingefügte Nukleotide in der Verbindungsregion von V- und J-Gensegment während des Rearrangements des TCR. Die Entwicklung von Primern, die spezifisch diese N-Region erkennen, führt zu einer eindeutigen Identifizierung der klonal expandierten Zellen. Darüber hinaus wird eine hohe Spezifität erreicht, da nur DNA der klonalen Zellen amplifiziert wird. Gleichzeitig wird die Sensitivität der PCR durch klonspezifische Primer gesteigert (Volkenandt et al. 1991, Kneba et al. 1994, Mielke et al. 1994).

Mit Hilfe der gewonnenen Sequenzen der TCR-γ- und TCR-β-Gene und der entsprechenden N-Region wurden patientenspezifischen Primer entwickelt. Die Herstellung der Primer erfolgte mit Hilfe des ProgrammsOLIGO® 5.0 Primer Analysis Software for Windows ®, National Biosciences, Inc., USA. Der Primer wurde so entworfen, dass das 5`-Ende des [Seite 36↓]Primers über der klonalen Sequenz der Patienten-DNA lag. Die für die einzelnen Analysen notwendigen Parameter wurden gemäss den in der OLIGO®-Software 5.0 für eine hochstringente Primersuche festgelegten Parameter gewählt:

3’Dimere:

statthaft, wenn dG > -3,5kcal/mol

weitere Dimere:

statthaft, wenn dG > -7,5kcal/mol und Duplexlänge < 4 Nukleotide

Haarnadelstruktur

statthaft, wenn dG > 0kcal/mol

Priming Efficiency

falsche Bindungsstellen nicht berücksichtigt, wenn Priming Efficiency < 160

interne Stabilität

maximaler Wert für dG im 3’Bereich = 7,7 kcal/mol.

Des weiteren wurde die Schmelztemperatur der einzelnen Oligonukleotiden, analog den Verfahren nach Breslauer (2(A+T)°+4(G+C)°) (Breslauer et al. 1986) und Wetmur Nearest-Neighbor-Method (Wetmur et al. 1991), berechnet und verglichen. Als maximale Differenz der Schmelztemperaturen wurden 10°C festgelegt. Bei Unterschieden der mit den beiden Verfahren berechneten Differenzen wurde für dieBewertung das Ergebnis nach der Nearest-Neighbor-Method zugrunde gelegt.

3.7 quantitative PCR

Das Verfahren der quantitativen PCR dient zur Bestimmung der Menge einer Ziel-DNA aus einer Probe mit DNA. Dazu wurde hier das System LightCycler® der Firma Roche verwendet.

Ein externer Standard wurde als Bezugsgröße zur Quantifizierung der Ergebnisse eingesetzt.

3.7.1 Herstellung eines klonspezifischen Standards

Der klonspezifische Standard wurde aus dem PCR-Produkt einer diagnostischen Blutprobe eines jeden Patienten gewonnen. Hierzu wurden 5µl DNA einer Blutprobe in einer klonspezifischen PCR eingesetzt und das PCR-Produkt in einem Agarosegel aufgetrennt. Die monoklonale Bande wurde extrahiert und mittels des s.g. High Pure PCR Product Purification Kit® aufgereinigt. Anschließend wurde die Lichtabsorption bei 260 und 280nm gemessen. Die Messung bei 260nm ergab einen Wert für die DNA-Konzentration in µg/ml, die Messung bei 280nm für die vorhandene Proteinkonzentration. Das Verhältnis der Werte von 260nm zu den Werten bei 280nm lässt Rückschlüsse auf die Reinheit des PCR-Produktes zu und soll über dem Wert 1,8 liegen. Für die Standardverdünnung wurde die Konzentration in Kopien/µl benötigt. Sie wurde mit Hilfe der folgenden Formeln berechnet:


[Seite 37↓]

Legende:

MW = Molekulargewicht des PCR-Produktes

 

P = PCR-Produktlänge in Anzahl der Basenpaare

 

S = Standardkonzentration

 

DNA = im Spektrometer gemessene DNA-Konzentration

 

660g/mol = Durchschnittliche Mol-Gewicht der Basen

Die Standardlösungen wurden anschließend auf eine Konzentration von 5x106 Kopien/µl eingestellt.

3.7.2 Die quantitative PCR im LightCycler®

Zu Beginn wurde nach Protokoll ein Reaktionsansatz mit LightCycler® DNA Master SYBRGreen I®, Aqua bidest, Mg2Cl und den Primern hergestellt. Das LightCycler® DNA Master SYBRGreen I® ist ein Gemisch, das die benötigten Bestandteile, dNTP, Taq-Polymerase und das SYBRGreen I®, für die PCR enthält. PCR-Bedingungen und MgCl2-Konzentration sind in der Tabelle 16 aufgeführt. Bei jeder Reaktion wurde die DNA von 5x103 Zellen eingesetzt und Doppelbestimmungen durchgeführt.

Die Auswertung der Daten erfolgte mittels der Methode des Second-Derivate-Maximum. Bei dieser Methode wird zur Bestimmung der Crossingpoints das Maximum der zweiten Ableitung der Amplifikationskurve genutzt.

Der externe Standard bestand aus fünf Verdünnungsstufen einer Verdünnungsreihe von jeweils 102 bis 106. Die Schmelztemperatur der entstandenen PCR Produkte wurde mit Hilfe einer Schmelzkurvenanalyse ausgewertet. Dieser liegt eine Bewertung der Fluoreszenzintensität in bezug zur Temperatur zugrunde. Mit steigender Temperatur sinkt die Intensität des Fluoreszenzfarbstoffes aufgrund abnehmender Doppelstrang-DNA. Überschreitet die Temperatur die Schmelztemperatur der PCR-Produkte, so kommt es zu einem starken Abfall der Intensität. Damit ergibt sich aus der negativen ersten Ableitung der Schmelzkurve bei TM ein Maximum. Diese Maxima sind abhängig von der Sequenz der PCR-Produkte. Damit können gewünschte von ungewünschten PCR-Produkten, wie z.B. Primer-Dimere, unterschieden werden.


[Seite 38↓]

Für die Analyse der Daten wurden die Parameter gemäss der LightCycler®-Software „für eine akkurate Analyse mit externem Standard“ wie folgt festgelegt:

  1. eine Abweichung der Verdünnungsreihe ist statthaft, wenn kleiner als 0,10
  2. Effizienzunterschiede in der PCR zwischen Standard und Ziel-DNA sind statthaft bis maximal 0,05
  3. Unterschiede in der Schmelztemperatur sind nicht statthaft.
    entsprechend Roche Molecular Biochemicals(a) 2000

Diese Parameter wurden von der Software ermittelt. Für die Auswertung der Daten war die Einhaltung der Parameter Vorraussetzung.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
22.10.2004