[Seite 39↓]

4  Ergebnisse

4.1 FACS-Analysen an mononukleären Zellen des peripheren Blutes von Patienten mit Sézary Syndrom

Es wurden 15 Blutproben der Patienten mit Sézary Syndrom und vier Kontrollblutproben mittels FACS-Analyse untersucht und die Zellen mit Hilfe eines Cell-Sorters sortiert. Die Zellen wurden hierfür mit Fluoreszenz-Farbstoff markierten monoklonalen Antikörpern gegen die T-Zell Antigene CD3, CD7 und CD26 in folgender Kombination gefärbt: CD3 mit CD7, CD3 mit CD26 und für die FACS-Analyse auch CD7 mit CD26. Avitale Zellen wurden von der Analyse ausgeschlossen.

4.1.1 CD7-Expression peripherer CD3+ Lymphozyten

Die Ergebnisse der Untersuchung der CD7+ und CD7- Fraktion sind in Tabelle 8 als prozentuale Anteile der CD3 positiven Fraktion dargestellt.

Tab. 8: CD7 Expression der CD3+ PBMC

Blutprobe

Zellzahl

CD3+ /µl

FACSCD7+

(in % der CD3 + )

FACSCD7 -

(in % der CD3+)

Ratio der CD7+/CD7- der CD3+

CD7 Expressionsmuster

DK1

7,43

0,9

99,1

0,01

-

DK2

6,29

1,1

98,9

0,01

-

DK3a

5,98

1,1

98,9

0,01

-

DK3b

k.W.

1,3

98,7

0,01

-

FN1

1,57

86,2

13,8

6,25

+

FN2

0,71

60,0

40,0

1,5

+/-

FN3

1,03

86,0

14,0

6,14

+

FN4

0,91

76,6

23,4

3,27

+

OS1

1,05

60,2

39,8

1,51

+/-

OS2

1,13

65,7

34,3

1,92

+/-

RM1

7,32

53,5

46,5

1,15

+/-

RM2

k.W.

10,4

89,6

0,12

+/-

RM3

k.W.

26,9

73,1

0,37

+/-

SH1

4,3

54,9

45,1

1,22

+/-

SH2

2,5

46,4

53,6

0,87

+/-

Kontrolle

k.W.

90,0

10,0

9,0

+

Kontrolle

k.W.

91,4

8,6

10,63

+

Kontrolle

k.W.

87,7

12,2

7,19

+

Kontrolle

k.W.

90,8

9,2

9,87

+

+ → überwiegend CD7+ Expressionsmuster CD7+ >70%, +/- → intermediäres Expressionsmuster CD7+ zwischen 10% und 70%, - → überwiegend CD7- Expressionsmuster CD7+ < 10%. FACSCD7+→ Anteil der CD3+ CD7+ in %, FACSCD7-→ Anteil der CD3+ CD7- in %, k.W. → kein Laborwert bestimmt worden


[Seite 40↓]

Die FACS-Analyse ergab für die Kontrollen einen Anteil der CD3+CD7+ Population von 87,7% - 91,4%, die Lymphozyten zeigten somit ein CD7+ Expressionsmuster. Die CD7+/CD7- Ratio lag zwischen 7,19 und 10,63.

In den PBMC der Patienten mit Sézary Syndrom schwankte der Anteil der CD3+CD7+ von 0,9% - 86,2%. Zwischen den einzelnen Patienten war eine große Variabilität der Verteilung zu beobachten, jedoch war der Anteil der CD7+ Population bei den Proben der Patienten signifikant geringer als bei den gesunden Kontrollen.

Bei Betrachtung der Daten deuten sich drei Expressionsmuster des CD7 Antigens an, denen die PBMC-Analysen zugeordnet werden können. So zeigte sich ein CD7 positives , ein CD7 negatives und ein CD7+/CD7- intermediäres Expressionsmuster. Die Grenzen für die Zuordnung zu einer der drei Gruppen ließen sich wie folgt festgelegen: >70%CD3+CD7+ entsprach dem überwiegend positiven Expressionsmuster (s. Abb. 1a), bei unter 10% CD3+CD7+ erfolgte die Zuordnung zum überwiegend negativen Expressionsmuster (s. Abb. 1c). Alle Proben mit einem CD3+CD7+ Anteil zwischen 10 und 70% gehörten zum intermediären Expressionsmuster (s. Abb. 1b). Die Festlegung der Grenzen erfolgte in Anlehnung an Wood et al., Jakob et al. und Vonderheid et al. (Wood et al. 1990, Jakob et al. 1996, Vonderheid et al. 2001).

Abb. 1: CD7 Expression der CD3+ Zellen

a: Bsp. für positives Expressions­muster für CD7 (Kontroll-PBMC)

b: Bsp. für intermediäres Expressions­muster für CD7 (RM1)

c: Bsp. für negatives Expressionsmuster für CD7(DK2)

Zum CD7 positiven Expressionsmuster zählten die Kontrollen, die PBMC von FN1, FN3 und FN4. Ein CD7 negatives Expressionsmuster zeigten alle Proben von DK. Für die Proben von OS, RM, SH und FN2 ließ sich ein intermediäres Expressionsmuster nachweisen.

Im einzelnen stellten sich die Ergebnisse wie folgt dar: Die Proben FN1, FN3 und FN4 enthielten Lymphozyten mit überwiegend CD3+CD7+ Phänotyp, deren Anteil zwischen 76,6 und 86% lag. Die Probe FN2 enthielt hingegen nur 60% CD3+CD7+ Zellen. Insgesamt zeigten im Vergleich zu den übrigen Patienten die Proben von FN, mit Ausnahme von FN2, den [Seite 41↓]höchsten Anteil CD3+CD7+ Zellen.

Im Gegensatz dazu war bei DK der konstant geringe Anteil von 0,9 bis 1,3% CD3+CD7+ Zellen im Blut auffällig.

Die PBMC des Patienten RM zeigten einen Abfall der CD7 positiven Zellen von 53,5% in RM1, auf 10,4% in RM2 und anschließend einen Anstieg auf 26,9% in der Probe RM3. Die Patienten OS und SH wiesen in ihren PBMC nur geringe Schwankungen in der CD7+/ CD7- Verteilung auf.

Das Verhältnis von CD7+/ CD7- unterlag im Verlauf zum Teil erheblichen Schwankungen. Diese Schwankungen zeigten sich in einem Fall in einer Zunahme, in einem Fall in einer Abnahme und in zwei Fällen in einer Kombination aus beidem. Einzig die CD7 Populationen in den PBMC von DK blieben konstant. Einen Wechsel des Expressionsmusters innerhalb eines Patienten zeigte nur FN. Im Verlauf wechselte das Muster von überwiegend positiv zu intermediär und wieder zu einem positiven Expressionsmuster. Eine Ursache könnte die starke Abnahme der absoluten CD3+ Zellzahl im peripheren Blut aufgrund der Therapie sein.

Im Anschluss an die FACS-Analyse wurden auf Grundlage dieser Daten die CD3+CD7+ und die CD3+CD7- Zellen jeder Probe mit Hilfe des Cell-Sorters präpariert. Die Zellen wurden der DNA Gewinnung zugeführt. Die Reinheit der Sortierung wurde durch nochmalige Analyse der sortierten Zellen im FACS überprüft. Sie überschritt in allen untersuchten Fällen 99% Reinheit (s.Abb 2).

Abb. 2: Kontrolle der Reinheit der sortierten, CD3+/CD7- Zellen


[Seite 42↓]

4.1.2  CD26 Expression peripherer CD3+ Lymphozyten

Die Ergebnisse der Analyse der CD26 Fraktionen in den PBMC sind in Tabelle aufgeführt. Sie sind als prozentuale Anteile an der CD3 positiven Fraktion dargestellt.

Tab. 9: CD26 Expression der CD3+ PBMC

Blutprobe

Zellzahl CD3+ /µl

FACSCD26+

(in % der CD3 + )

FACSCD26-

(in % der CD3 + )

Ratio der CD26+/CD26- der CD3+

CD26 Expressionsmuster

DK1

7,43

0,9

99,1

0,01

-

DK2

6,29

0,9

99,1

0,01

-

DK3a

5,98

0,9

99,1

0,01

-

DK3b

k.W.

0,9

99,1

0,01

-

FN1

1,57

16,7

83,3

0,2

+/-

FN2

0,71

25,1

74,9

0,34

+/-

FN3

1,03

34,7

65,3

0,53

+/-

FN4

0,91

57,7

42,3

1,36

+/-

OS1

1,05

5,6

94,4

0,06

-

OS2

1,13

7,2

92,8

0,78

-

RM1

7,32

4,3

95,7

0,04

-

RM2

k.W.

0,6

99,4

0,01

-

RM3

k.W.

0,8

99,2

0,01

-

SH1

4,3

1,8

98,2

0,02

-

SH2

2,5

3,2

96,8

0,03

-

Kontrolle

k.W.

71,0

29,0

2,45

+

Kontrolle

k.W.

76,4

23,6

2,90

+

Kontrolle

k.W.

80,6

19,4

4,15

+

Kontrolle

k.W.

74,6

25,4

2,94

+

+ → überwiegend CD26+ Expressionsmuster (CD26+ >70%), +/- → intermediäres Expressionsmuster (CD26+ zwischen 10% und 70%), - → überwiegend CD26- Expressionsmuster (CD26+ <10%), FACSCD26+→ Anteil der CD3+CD26+ an CD26+ in %, FACSCD26-→ Anteil der CD3+CD26- an den CD26- in %, k.W. → kein Laborwert bestimmt worden

Der Anteil der CD3+CD26+ Zellen in den PBMC der Kontrollen lag im Bereich von 71,0% - 80,6%. Entsprechend nahm die CD26+CD26- Ratio Werte zwischen 2,45 und 4,15 an.

In Analogie zur CD7 Expression konnten auch für die CD26 Expression drei Typen von Expressionsmustern festgelegt werden. Auch hier wurden die Grenzen für Positivität bei mehr als 70% positiven Zellen (s. Abb.3a), für Negativität bei weniger als 10% positiver Zellen (s. Abb.3c) und intermediär bei allen Werten zwischen 10 und 70% CD3+CD26+ Zellen (s. Abb.3b) festgelegt. Die Grenzen für die Betrachtungen wurden in Anlehnung an Untersuchungen von Bernengo et al. und Rappl et al. festgelegt (Bernengo et al. 2001, Rappl et al. 2001).


[Seite 43↓]

Abb. 3: CD26 Expression der CD3+ Zellen

a) Bsp. für ein positives Expressionsmuster von CD26 (Kontroll-PBMC)

b) Bsp. für ein intermediäres Expressionsmuster von CD26 (FN3)

c) Bsp. für ein negatives Expressionsmuster von CD26 (RM2)

Bei FN kam es im Verlauf zu einer stetigen Zunahme der CD3+CD26+ Zellen, so betrug der Wert bei FN1 16,7%, bei FN2 25,1%, bei FN3 34,7% und bei FN4 57,7%. Die Verteilung der Populationen entsprach einem intermediären Expressionsmuster.

Die PBMC der weiteren Patienten zeigten einen sehr geringen Anteil an CD3+CD26+ Zellen. Dieser Anteil lag zwischen 0,6% - 7,2% und zeigte auch im Verlauf nur minimale Schwankungen. Somit entsprachen die Proben der Patienten DK, OS, RM und SH einem überwiegend negativem Expressionsmuster. Bei allen Patienten blieb der Typ des Expressionsmusters im Verlauf konstant.

Im Anschluss an die FACS-Analyse der CD3 und CD26 gefärbten Zellen wurden die CD3+CD26+ und die CD3+CD26- Zellen mit Hilfe des Cell-Sorters präpariert. Die Zellen wurden der DNA Gewinnung zugeführt. (siehe 3.2) Die Reinheit der Sortierung, überprüft durch nochmalige Analyse der sortierten Zellen im FACS, überschritt bei den Proben 99% (s. Abb. 4).

Abb. 4: Kontrolle der Reinheit der sortierten, CD3+/CD26+ Zellen

4.1.3 Korrelation der CD7 und CD26 Expressionsmuster

Um die Populationen der CD3+CD7+ und CD3+CD26+ Zellen zu vergleichen, wurden die Ergebnisse in Tabelle 10 gegenübergestellt. Zur Veranschaulichung wurden die Ergebnisse


[Seite 44↓]

einem der drei Expressionsmuster (überwiegend positiv, überwiegend negativ, intermediär) zugeordnet.

Tab. 10: Korrelation von CD7 und CD26 Expressionsmustern

Blutprobe

FACSCD7

FACSCD26

DK1

-

-

DK2

-

-

DK3a

-

-

DK3b

-

-

FN1

+

+/-

FN2

+/-

+/-

FN3

+

+/-

FN4

+

+/-

OS1

+/-

-

OS2

+/-

-

RM1

+/-

-

RM2

+/-

-

RM3

+/-

-

SH1

+/-

-

SH2

+/-

-

Kontrolle

+

+

Kontrolle

+

+

Kontrolle

+

+

Kontrolle

+

+

+/- = intermediäre, + = positive, - = negative Expression des CD-Markers

Die Kontrollen zeigten sich sowohl für CD7 als auch für CD26 überwiegend positiv.

Im Blut der Sézary Syndrom Patienten konnte beobachtet werden, dass bei CD7 Negativität auch CD26 nicht exprimiert wurde (alle Proben von DK). Bei einem intermediären Expressionsmuster für CD7 konnte die CD26 Population entweder ebenfalls dem intermediären oder dem überwiegend negativen Typus zugeordnet werden. Dieses Verhalten zeigten die Proben FN2, alle Proben von OS, SH und RM. Bei überwiegend positivem Expressionsmuster von CD7 ließ sich ein intermediärer Typ von CD26 beobachten (FN1, FN3, FN4).

Ein CD26 negatives Expressionsmuster zeigte in vier Fällen ein negatives Expressionsmuster für CD7 (alle Proben von DK), in sieben Fällen ein intermediäres Muster für CD7 ( alle OS, SH und RM) jedoch nie ein CD7 positives Muster.

Die Expression eines überwiegend intermediären CD26 Musters bedeutete auch die Expression eines intermediären bzw. positiven CD7 Expressionsmusters. In den untersuchten Proben fand sich nie die Konstellation einer intermediären CD26 Expression und gleichzeitig einer CD7 Negativität

Für die hier untersuchten Proben bedeuten die Ergebnisse, dass bei einem Abweichen der [Seite 45↓]CD7+ Zellverteilung in 12 Proben auch die CD26+ Zellzahl gegenüber den Kontrollen verändert war. Ist die CD26+ Zellverteilung verändert, lässt sich feststellen, dass in diesen 11 Proben die CD7+ Zellverteilung ein intermediäres oder negatives Muster aufwies.

4.2 Qualitative PCR-Analysen an PBMC von Sézary Syndrom Patienten

4.2.1 TCR-γ-PCR

Um das Vorhandensein eines T-Zell-Klons im peripheren Blut der fünf Patienten zu erfassen, wurden Aliqots von DNA mit Hilfe einer TCR-γ-PCR untersucht. Hierbei konnte in allen Proben eine T-Zell Klonalität festgestellt werden. Um dieses Ergebnis zu verifizieren, wurde der expandierte T-Zell-Klon sequenziert.(s. Tabelle 11)

Tab. 11: Darstellung der Ergebnisse der TCR-γ Sequenzierung

Patient

TCR

V-Segment

N-Region

J-Segment

Basenanzahl

N-Region

Verhältnis

GC : AT

Klonspezifischer Primer generiert

SH

vg 8 - TGGGA

TGAAACTC

GAATT – jg1/2

8

0,6:1

Nein

DK

vg 3 - GACAG

AACGGGGGG

ACCAC – jg1/2

9

3,5:1

Ja

RM

vg 8 - TGGGA

AGGA

AATTA – jg1/2

4

1:1

Nein

FN

vg 9 - ACTAC

CG

TATATA – jg1/2

2

2:0

Nein

OS

vg 3 - GACAG

CACCCTTTTA

TTATT – jg1/2

10

0,66:1

Nein

Es ließ sich im Blut aller Patienten ein dominanter T-Zell-Klon sequenzieren. Die in den T-Zell-Klonen rearrangierten V-Segmente waren zweimal Vg8, zweimal Vg3 und einmal Vg 9. Die Länge der N-Region variierte erheblich. So waren bei FN nur zwei Nukleotide und bei RM nur vier Nukleotide während der Rekombination eingefügt worden. Hingegen war die Anzahl bei SH (8 Nukleotide), DK (9 Nukleotide) und OS (10 Nukleotide) wesentlich höher. Das Verhältnis von GC : AT lag im Durchschnitt bei 1,21 : 1. Aufgrund der verwendeten TCR-Jγ Primer, war eine Unterscheidung von jg1 und jg2 nicht möglich.

4.2.2 TCR-β-PCR

Die Untersuchung auf das Vorhandensein eines dominanten TCR-Vβ Rearrangement fand mit Hilfe von monoklonalen Antikörpern und einer FACS-Analyse statt. Von den Patienten, bei denen mit den verfügbaren Vβ-Antikörpern ein dominantes Vβ nachgewiesen werden konnte, wurde die DNA aus Blutproben dieser Patienten mit Hilfe einer TCR-β-PCR auf Klonalität untersucht. Ziel war es mit Hilfe der TCR-β-PCR die Sequenz des dominanten T-Zell-Klons zu ermitteln. Hierzu wurde die DNA in einer TCR-β-PCR eingesetzt, das dominante Vβ-Rearrangement mit Vβ-Primern und Jβ-Primern (Moss et al. 1997) amplifiziert und anschließend sequenziert. In der Tabelle sind die Ergebnisse dieser Untersuchung dargestellt.


[Seite 46↓]

Tab. 12: Darstellung der Ergebnisse der Vβ Sequenzierung

Patient

Sequenz

V - Segment

N - Region

J-Segment

Basenzahl

N-Region

Verhältnis

GC : AT

Klonspezifischer Primer generiert

SH

16

vb 16s1 – CAAGA

TCTAGGGCCCC

AGATA - tbj 2-3

11

2,66 : 1

Ja

RM

17

vb 17s1 – GTAGT

GGAGGGCTTGGGGG

AAAAC - tbj 1-4

14

3,66 : 1

Ja

FN

17

vb17s1 – GTAGT

CTCCGGACAGGGAG

CTCCT - tbj1-6

14

2,5 : 1

Ja

OS

5

tbv5-1b – GCCAG

sCGCGACAG

CTCCT - tbj2-7

9

3,5 : 1

Ja

DK

k.R.

-

-

-

-

-

-

k.R. → durchgeführt, kein Resultat

Die Untersuchung auf eine dominante Vβ Familie ergab, dass Vβ17 zweimal, Vβ5 und Vβ16 je einmal vorkamen. Der T-Zell-Klon von DK exprimierte ein Vβ, das mit keinem derzeit verfügbaren Antikörper angezeigt werden konnte. Deshalb konnte die Vβ-Sequenz des expandierten T-Zell-Klons bei DK nicht ermittelt werden.

Die N-Region der β-Sequenz der einzelnen T-Zell-Klone hatte eine Größe zwischen 9 und 14 Basen. Auffällig war ein hoher GC-Gehalt der Sequenz, das Verhältnis von GC : AT lag in allen Fällen über 2,5 : 1. Die J-Segmente zeigten die erwartete Diversität. So waren jeweils einmal Jβ1-4, Jβ1-6, Jβ2-3 und Jβ2-7 rearrangiert.

4.2.3 Patientenspezifische PCR

Nachdem die Sequenz des dominanten T-Zell-Klon bestimmt war, wurde mit Hilfe der Oligo®-Software für jede TCR-Sequenz ein Primer-Set, d.h. ein TCR-V-Primer und ein für die N-Region spezifischer Primer, entwickelt. Die Sequenz der N-Region spezifischen Primer, der dazugehörige V-Primer, die Annealingtemperatur, die Schmelztemperatur des PCR-Produkts und die Größe des PCR-Produkts sind in Tabelle 13 aufgeführt.

Tab. 13: Übersicht über die klonspezifischen Primer

Patient

V-Primer

N-Primer

Schmelz-temperatur des N-Primer (in °C)

Größe des PCR-Produkt (Anzahl Basenpaare)

Schmelz-temperatur des PCR-Produktes (in °C)

DK

Vγ 18 (Muche 1995)

CTACATCCACTGGTACCT

Kant1

GGTCCCCCCCGTTTG

74,1

219

88,8

SH

Vβ 16 (Moss et al. 1997)

TGTGACCCAATTTCTGGACATGATAAT

HeiB1

TCTGGGGGCCCTAGAT

72,0

239

86,1

RM

Vβ 17 (Moss et al. 1997)

GAACAGAATTTGAACCACGATGCC

MurB1

CAGTTTTCCCCCAAGCCCTCC

72,0

234

88,4

FN

Vβ 17 (Moss et al. 1997)

GAACAGAATTTGAACCACGATGCC

Neb3

GTGAATTATAGGAGCTCCCTG

71,4

241

88,2

OS

Vβ 5 (Moss et al. 1997)

CTGATCAAAACGAGAGGACAGCA

SelbB1

AGGAGCTGTCGCGSCT

71,1

262

90,2


[Seite 47↓]

Die Länge der V-Primer lag zwischen 18 und 27 Basen, die der N-Primer zwischen 16 und 21 Basen.

Bei der Entwicklung einer klonspezifischen PCR hatte die Größe der N-Region und das Verhältnis von GC : AT entscheidenden Einfluss auf die Spezifität der PCR. So war die Entwicklung eines klonspezifischen Primers für die TCR-γ-Sequenz nur bei DK möglich, hier N-Region eine ausreichende Länge und einen hohen GC-Gehalt zeigte. Die N-Regionen der übrigen Patienten zeigten eine zu geringe Größe (FN: 2bp, RM: 4bp) bzw. einen geringeren GC-Gehalt (SH 0,6 : 1, OS 0,66 : 1). Demgegenüber zeigte die N-Region der β-Sequenz eine ausreichende Größe und GC-Gehalt. Hier wurde mit allen entwickelten Primern die angestrebte Spezifität erreicht.

Charakteristisch für die Primer zur Amplifizierung des klonspezifischen TCR-β-Rearrangements ist eine hohe Schmelztemperatur (71,1° - 74,1°C) und eine hohe Schmelztemperatur der PCR-Produkte (86,1° - 90,2°C). Die Länge der PCR-Produkte lag zwischen 239 und 262 Basenpaaren.

Für jedes Primerpaar wurden spezifische PCR-Bedingungen entwickelt. Die PCR-Bedingungen wurden an der DNA aus PBMC des jeweiligen Patienten getestet und, wenn nötig, variiert um eine hohe Spezifität zu erreichen. Dazu wurde die Annealingtemperatur der PCR so hoch wie möglich gewählt. Darüber hinaus wurde die PCR auch hinsichtlich der Zyklenzahl, der verwendeten Taq-Polymerase und der Magnesiumkonzentration optimiert. Ziel war eine spezifische Amplifizierung des Zielgenes ohne Entstehung unspezifischer PCR-Produkte und Primerdimere. Die PCR-Bedingungen für die einzelnen Patienten sind in Tabelle 14 dargestellt.

Tab. 14: PCR-Programme

Patient

[MgCl2]

(in mM)

Annealingtemperatur

(in °C)

Zyklenzahl

SH

4

66

35

DK

4

60

35

RM

4

68

35

FN

2,5

66

30

OS

2,5

66

30

Mit Hilfe dieser PCR-Bedingungen konnte bei allen Patienten ein Amplifikat der erwarteten Größe erzielt werden. In den Kontrollen mit polyklonaler DNA aus PBMC von Spendern bzw. mit H20 ließen sich keine PCR-Amplifikate nachweisen (s. Abb. 5).


[Seite 48↓]

Abb. 5: Bsp. für ein Ergebnis einer klonspezifischen PCR (für SH), Auftrennung im Agarosegel

Spurlegende

    

1. 100bp Marker

2. PBMC von SH

3. Kontroll-PBMC

4. Kontroll-PBMC

5. Negativkontrolle (H2O)

Nach der Analyse der PBMC der Patienten im FACS und der Präparation der einzelnen Subpopulationen mittels FACS-Sorting, wurde die DNA dieser Zellen in einer klonspezifischen PCR eingesetzt. Das Vorhandensein von T-Zellen wurde zusätzlich in einer TCR-γ-PCR überprüft. Die Ergebnisse sind für alle Zellpopulationen in Tabelle 15 dargestellt.

Tab. 15: Ergebnisse der klonspezifischen PCR

Blutprobe

CD3+CD7+

CD3+CD7-

CD3+CD26+

CD3+/ CD26-

DK1

-*

+

-*

+

DK2

-*

+

-*

+

DK3a

-*

+

-*

+

DK3b

-*

+

-*

+

FN1

+

+

+

+

FN2

+

+

+

+

FN3

+

+

+

+

FN4

+

+

+

+

OS1

+

+

+

+

OS2

+

+

+

+

RM1

+

+

-

+

RM2

+

+

-*

+

RM3

+

+

-*

+

SH1

+

+

+

+

SH2

+

+

+

+

+ → positives PCR-Ergebnis, - → negatives PCR-Ergebnis, -*→ negatives PCR-Ergebnis mit Hilfe der LightCycler® PCR gezeigt (s.Text)

Mit Hilfe des klonspezifischen Primers konnte der initiale T-Zell-Klon auch in allen folgenden Proben nachgewiesen werden. Gleiches gilt für die Subpopulationen, in denen der initiale Klon auch im Verlauf nachweisbar blieb.

Die Untersuchung der einzelnen Populationen ergab, dass in allen T-Zell Populationen ein für [Seite 49↓]das TCR-Rearrangement identischer Klon vorhanden war. Damit konnte gezeigt werden, dass dieser Klon für CD7 sowie für CD26 jeweils sowohl positiv als auch negativ sein kann. Gleichzeitig heißt das auch, dass der T-Zell-Klon keinen konstanten Phänotyp zeigte. So wurde der expandierte TCR-Klon in 11/15 Proben in der CD3+CD7+ Population nachgewiesen, in 15/15 Proben in der CD3+CD7- Population, in 8/15 Proben in der CD3+CD26+ Population und in 15/15 Proben der CD3+CD26- Population. Aufgrund der zum Teil sehr kleinen Populationen war es bei DK und RM nicht möglich, ausreichend Material von allen Population zu gewinnen. Dies betraf im einzelnen die CD7+ Fraktion und CD26+ Fraktion aller Proben von DK und die CD26+ Fraktion von RM2 und RM3. Hier wurde die präparierte DNA in der LightCycler® PCR mit klonspezifischen Primern eingesetzt und das Ergebnis dieser PCR für das Ergebnis der qualitativen PCR übernommen.

Die Klonalität in den einzelnen T-Zell-Populationen der Patienten konnte auch im Verlauf konstant nachgewiesen werden. Einzige Ausnahme bildet die Probe der CD3+CD26+ Zellen von RM1, dieser Population war kein Amplifikat in der qualitativen PCR zu erzielen.

Für die Patienten FN, OS und SH war in allen untersuchten Proben und Populationen der initiale T-Zell-Klon nachweisbar. Für den Patienten DK war eine nur für die CD7 negativen und CD26 negativen Population ein reine qualitative Untersuchung möglich. Hier zeigte sich in allen Proben der initiale Klon. Für die CD7+ und die CD26+ Fraktion wurden die Ergebnisse aus der quantitativen PCR übernommen. Hier konnten keine klonalen Zellen quantifiziert werden, so dass diese Populationen als negativ hinsichtlich der Klon-Präsenz bewertet wurden. Für RM wurde analog zu DK verfahren. Auch hier konnte in den betreffenden Proben RM2 und RM3 in der CD26+ Fraktion keine klonalen Zellen quantifiziert werden, so dass diese Populationen als negativ für den Klon bewertet wurden.

Abb. 6: Bsp. für eine klonspezifische PCR an sortierten Zellen (OS vom 04.08.00), Auftrennung im Agarosegel

Spurlegende:

   

1. 100bp Marker

2. CD3+CD7+ Zellen

3. CD3+CD7- Zellen

4. CD3+CD26+ Zellen

5. CD3+/CD26- Zellen

6. Positivkontrolle

7. Negativkontrolle (PBMC)

8. Negativkontrolle (H2O)


[Seite 50↓]

4.3  Quantitative PCR-Analysen an PBMC von Patienten mit Sézary Syndrom

4.3.1 Entwicklung der PCR-Bedingungen für eine quantitative PCR im LightCycler®

Um eine Aussage darüber zu erhalten, wie hoch der Anteil der klonalen Zellen in den einzelnen T-Zell Populationen ist, musste eine quantitative PCR durchgeführt werden. Dazu wurden die Bedingungen der klonspezifischen PCR an die Bedingungen im LightCycler® angepasst.

Um optimale Bedingungen für die PCR im LightCycler® zu erreichen, wurde entsprechend den Vorgaben des Herstellerprotokolls verfahren (Roche Molecular Biochemicals(a) 2000). Im einzelnen wurden die Anlagerungstemperatur der Primer (Annealingtemperatur) die Elongationszeit und die MgCl2 Konzentration angepasst. Da schon von der qualitativen PCR bekannt war, dass die Primer höhere Anlagerungstemperaturen haben, wurde mit einer höheren Temperatur begonnen. Um einen unspezifischen Hintergrund in der Amplifizierung zu vermeiden und die Entstehung von Primerdimeren zu reduzieren, wurde die Anlagerungstemperatur so hoch wie nötig gewählt. Für die MgCl2 Konzentration empfiehlt das Protokoll eine Konzentration von 1mM bis 5mM.

Die Anlagerungstemperatur, die Temperatur der Messung der Fluoreszenzintensität (IF) und die eingesetzte MgCl2 Konzentration sind in der Tabelle 16 aufgeführt. Die Temperatur während der Elongation und die Zyklenzahl betrugen einheitlich 72°C und 50 Zyklen.

Tab. 16: PCR-Programme für den LightCycler®

Patient

Annealing –

temperatur

(in °C)

Messung

von IF bei

(in °C)

[MgCl2]

(in mM)

DK

70

80

2,5

SH

70

82

2,5

RM

65

79

4

FN

66

82

4

OS

60

79

4

Bei der Sortierung der Zellen wurden Zellen jeder Population gewonnen. Die Menge der gewonnen Zellen wurde durch die Größe der Subpopulation bestimmt, es wurde versucht, so viele Zellen wie möglich zu gewinnen. Die Zellzahl nach der Separation lag zwischen 2,5x104 und 1,25x105 Zellen. Anschließend wurden die Zellen einer DNA-Extraktion zugeführt. Danach wurde die Anzahl Kopien DNA (2 Kopien pro Zelle) pro Volumeneinheit berechnet und die quantitative PCR mit DNA aus 5x103 Zellen durchgeführt. D.h. für jede Zellpopulation wurden, um bei gleicher PCR-Effizienz zu quantifizieren, unabhängig vom [Seite 51↓]realen Anteil im Blut des Patienten 5x103 Zellen eingesetzt. Im Anschluss wurden die Ergebnisse der quantitativen PCR auf die reale Verteilung der einzelnen Populationen umgerechnet und die Ratio der CD7+/ CD7- bzw. CD26+/ CD26- klonalen Zellen ermittelt.

Die Nachweisgrenze dieser Technik liegt bei ca. 102 klonalen Zellen je Ansatz von 5x103 Zellen.

4.3.2 Quantifizierung der CD7+ und CD7- Fraktion

Tabelle 17 stellt die Ergebnisse der quantitativen PCR für CD3+CD7+ bzw. CD3+CD7- Zellfraktionen des peripheren Blutes dar. Zum einen sind die Absolutzahlen aufgeführt, zum anderen die Verteilung der CD7+/ CD7- klonalen Zellen bei einem theoretischen Verhältnis der CD7+/ CD7- der CD3+ Zellen von 1:1 und des weiteren die Ratio der CD7+ zu den CD7- klonalen Zellen ( RCD7+/CD7-) für das reale Verhältnis der CD7+/ CD7- Zellen in der CD3+ Zellpopulation. Für die Berechnung der Ratio RCD7+/CD7- wurde die reale Verteilung der CD7+/ CD7- Populationen, ermittelt mit Hilfe der FACS-Analyse (A2 ), ins Verhältnis zu der Verteilung der klonalen Zellen auf die CD7+/ CD7- Populationen (A1 ) gesetzt, woraus sich folgende Formel ergab:

 

RCD7+/CD7- = A1 x A2, wobei

 

A1 = LCCD7+/ LCCD7-

 

A2 = FACSCD7+/ FACSCD7- .

Tab. 17: Ergebnisse der quantitativen PCR der nach der CD7 Expression sortierten Zellen

Blutprobe

CD3+CD7+

CD3+CD7-

LCCD7+

LCCD7-

RCD7+/CD7-

DK1

0,0

4,57x103

<1,0*

>99,0*

<0,0001*

DK2

0,0

7,05x103

<1,0*

>99,0*

<0,0001*

DK3a

0,0

1,08x104

<1,0*

>99,0*

<0,0001*

DK3b

0,0

8,94x103

<1,0*

>99,0*

<0,0001*

FN1

6,44x104

7,69x103

89,3

10,7

52,16

FN2

k.P.

k.P.

k.P.

k.P.

k.P.

FN3

7,13x103

0,0

>98,6*

<1,4*

>429,4*

FN4

8,50x103

0,0

>98,8*

<1,2*

>269,1*

OS1

1,10x104

1,20x104

47,8

52,2

1,38

OS2

4,60x104

6,27x104

42,3

57,7

1,4

RM1

6,58x103

7,66x103

46,2

53,8

0,98

RM2

5,06x103

5,05x103

50,0

50,0

0,12

RM3

7,26x103

7,07x103

50,7

49,3

0,38

SH1

0,0

1,6 x103

<0,9*

>99,1*

<0,01*

SH2

3,64x103

2,84x103

56,2

43,8

1,11

LCCD7+→ Anteil CD7+ in % an den CD3+ klonalen Zellen, LCCD7-→ Anteil CD7- in % an den CD3+ klonalen Zellen, k.P. → kein Produkt in der quantitativen PCR, * → für negativen Wert in der Quantifizierung wurde von weniger als 102 klonalen Zellen in dieser Population ausgegangen, RCD7+/CD7-→ Ratio der klonalen CD3+CD7+ zu den klonalen CD3+CD7-


[Seite 52↓]

Die quantitative PCR der 15 Patientenproben ergab, dass in 14/ 15 Proben eine Amplifikation mit Hilfe der Klon-spezifischen Primer möglich war. Die Abbildung 7 zeigt beispielhaft das Ergebnis einer Quantitativen PCR von CD7+ und CD7- Zellen. Es sind die Standardkurven, die Kurven der amplifizierten DNA und die Negativkontrolle dargestellt. In Abb.8 ist die dazugehörige Schmelzkurvenanalyse dargestellt.

Abb. 7: Bsp. für eine quantitative PCR (CD7+ und CD7- Populationen von RM)

Legende:

rote Kurven →

Fluoreszenz der Standardverdünnungsreihe

 

schwarze Kurven →

Fluoreszenz der amplifizierten DNA

 

grüne Kurve →

Fluoreszenz der negativ Kontrolle(H2O)

Abb. 8: Schmelzkurvenanalyse der quantitativen PCR aus Abb.7

Legende wie in Abb.7

Die Untersuchung zeigte, dass in der CD7 positiven Population in 9/15 Fällen und in der CD7 negativen Population in 12/15 Fällen ein Amplifikat zu erzielen war. In den Fällen, in denen die Quantifizierung 0 ergab, muss davon ausgegangen werden, dass hier weniger als 102 klonale Zellen vorhanden waren. Aus diesem Grund wurde zur Berechnung der Ratio ein Wert von 102 klonale Zellen angenommen. Im Vergleich zur qualitativen PCR zeigt sich, dass [Seite 53↓]in 5/30 quantitativen Analysen keine Amplifikation im LightCycler® System erfolgte, obwohl der entsprechende T-Zell-Klon in der qualitativen PCR nachgewiesen wurde. Das betrifft im einzelnen die Probe von FN2, wo Klonalität in der qualitativen PCR, nicht jedoch in der quantitativen PCR für beide Populationen CD3+CD7+ und CD3+CD7- gezeigt wurde. Weiterhin betrifft dies die Proben von FN3 und FN4, bei denen die Klonalität der CD3+CD7- Fraktion nur in der qualitativen PCR Klonalität gezeigt werden konnte. Außerdem ist auch die Probe SH1 betroffen, bei der in der CD3+CD7+ Fraktion die quantitative PCR kein Ergebnis brachte. In diesen Fällen waren entweder keine klonalen Zellen vorhanden oder deren Zahl unterschritt die Nachweisgrenze der quantitativen PCR.

Im Verlauf zeichnet sich für die Gesamtheit der Patienten ein uneinheitliches Bild ab. So ist aus den einzelnen, auf die reale Verteilung der CD3+CD7+ bzw. CD3+CD7- Zellen angepasste Ratio RCD7+/CD7- ersichtlich, dass im Verlauf sowohl eine Veränderung des Phänotyps der klonalen Zellen zur CD7+ aber auch zur CD7- Population stattfindet, als auch ein konstanter Phänotyp der klonalen Zellen auftritt (s. Tab.17).

In den Proben von FN ließen sich klonal expandierte Zellen v.a. in der CD7+ Population nachweisen. Im Verlauf kam es zu einer Zunahme der klonalen CD7+ Population, was sich in den hohen Werten von RCD7+/CD7- widerspiegelt. So stieg RCD7+/CD7- im Verlauf von 52,1 über 429,4 auf 269,1 an. Für die Beurteilung der Werte von FN vom 15.01.02 und 26.03.02 ist zu berücksichtigen, dass es zu einer stetigen Zunahme einer CD3dim Population kam, die in der letzten Probe alle anderen Populationen dominierte. Auf diese Besonderheit wird in 4.5 eingegangen.

Für DK ergab die Quantifizierung der CD7- Fraktion Werte zwischen 4,57x103 und 1,08x104 klonale Zellen. Im Verlauf zeigte sich von der Probe DK1 bis zur Probe DK3b eine stetige Zunahme der klonalen Zellen von 4,57x103 bis auf 1,08x104. In der CD7+ Fraktion konnten keine klonalen Zellen quantifiziert werden. RCD7+/CD7- blieb für DK im Verlauf konstant bei unter 0,0001, was einem überwiegend CD7- Phänotyp der klonal Zellen entspricht.

Die Proben von OS, RM und SH zeigten, mit Ausnahme von SH1, eine Verteilung der klonalen Zellen sowohl auf die CD3+CD7+ als auch auf die CD3+CD7- Zellpopulationen. Wie aus den Ratios RCD7+/CD7- ersichtlich, blieb die Verteilung bei OS fast konstant (RCD7+/CD7- lag bei 1,38 und 1,4), bei RM kam es zu einer Verschiebung hin zur CD3+CD7- (Abfall der Ratio von 0,98 auf 0,12 und leichter Anstieg auf 0,38). Die Ratio RCD7+/CD7- für die Proben von SH war zunächst kleiner 0,01 und stieg dann auf 1,11 an. Dies erscheint jedoch auch in Anbetracht der qualitativen PCR-Ergebnisse eher unrealistisch, so dass von einem Messfehler für die CD7+ Fraktion der Probe SH1 ausgegangen werden muss. Die Quantifizierung dieser [Seite 54↓]Probe wurde wiederholt, mit unverändertem Ergebnis. Für weitergehende Untersuchungen stand kein Material zur Verfügung.

4.3.3 Quantifizierung der CD26+ und CD26- Fraktion

Tabelle 18 zeigt die Ergebnisse der quantitativen PCR für CD3+CD26+ bzw. CD3+CD26- Zellfraktionen des peripheren Blutes. Die Darstellung der Daten wurde analog zu den CD7 Fraktionen vorgenommen.(s. 4.3.2) Auch die Berechnung der Ratio RCD26+/CD26- erfolgte wie in 4.3.2 beschrieben.

Tab. 18: Ergebnisse der quantitativen PCR der nach der CD26 Expression sortierten Zellen

Blutprobe

CD3+CD26+

CD3+CD26-

LCCD26+

LCCD26-

RCD26+/CD26-

DK1

0,0

3,49x103

<2,8*

>97,2*

<0,0003*

DK2

0,0

1,20x104

<0,8*

>99,2*

<0,0001*

DK3a

0,0

1,48x104

<0,7*

>99,3*

<0,0001*

DK3b

0,0

1,42x104

<0,7*

>99,3*

<0,0001*

FN1

1,74x103

2,56x104

6,4

93,6

0,01

FN2

k.P.

k.P.

k.P.

k.P.

k.P.

FN3

1,67

1,59x103

0,1

99,9

0,0005

FN4

4,96x102

0,0

>98,0*

<2,0*

>160,2*

OS1

0,0

3,39x104

<0,0*

100,0*

0,0002*

OS2

0,0

4,64x104

0,0*

100,0*

0,0002*

RM1

1,39x103

8,82x103

13,6

86,4

0,006

RM2

0,0

9,18x103

<1,1*

>98,9*

0,0001*

RM3

0,0

7,57x103

<1,3*

>98,7*

0,0001*

SH1

k.P.

2,1x103

k.P.

k.P.

k.P.

SH2

4,59x103

3,47x103

56,9

43,1

0,04

LCCD26+→ Anteil CD26+ in % an den CD3+ klonalen Zellen, LCCD26-→ Anteil CD26- in % an den CD3+ klonalen Zellen, k.P. → keine verwertbare quantitative PCR, * → für negativen Wert in der Quantifizierung wurde von weniger als 102 klonalen Zellen in dieser Population ausgegangen, RCD26+/CD26-→ Ratio der klonalen CD3+CD26+ zu den klonalen CD3+CD26-

Analog zur quantitativen PCR der CD7 Fraktionen ließ sich in dieser Analyse ebenfalls in 14/ 15 Patientenproben ein Amplifikat erzielen. In Abb.9 ist das Ergebnis einer quantitativen PCR von CD26+ und CD26- T-Zell Populationen dargestellt. Die Abbildung beinhaltet die Standardverdünnungsreihe, die Fluoreszenzkurven der amplifizierten DNA und die der negativ Kontrolle. In Abb.10 ist die dazugehörige Schmelzkurvenanalyse dargestellt.


[Seite 55↓]

Abb. 9: Bsp. für eine quantitative PCR der CD26+ und CD26- Populationen (von SH)

Legende:

rote Kurven →

Fluoreszenz der Standardverdünnungsreihe

 

schwarze Kurven →

Fluoreszenz der amplifizierten DNA

 

grüne Kurve →

Fluoreszenz der negativ Kontrolle(H2O)

Abb. 10: Schmelzkurvenanalyse der quantitativen PCR aus Abb.9

Legende wie in Abb.9

Die Untersuchung der einzelnen CD26 Populationen zeigte, dass in der CD26+ Population nur in sechs Fällen und in der CD26- Population in 13/15 Fällen klonale Zellen quantifiziert werden konnten. Hier lag die Ursache zum einen darin, dass keine klonalen Zellen vorhanden waren oder deren Zahl die Nachweisgrenze von 102 klonale Zellen unterschritt. In den drei Fällen, mit k.P. gekennzeichnet, konnte die Quantifizierung trotz Wiederholung wegen nicht


[Seite 56↓]

reproduzierbarer Ergebnisse nicht ausgewertet werden. Im Vergleich zur qualitativen PCR zeigt sich, dass in 7/30 quantitativen Analysen kein Amplifikat zu erzielen war, trotz eines nachweisbaren T-Zell-Klons in der qualitativen PCR. Dies betrifft im einzelnen die Probe von FN2, hier sowohl die CD3+CD26+ als auch die CD3+CD26- Population und die Proben FN4, OS1, OS2 und SH1 hier die Zellen der CD3+CD26- Population. Für die T-Zell Populationen der Proben FN4, RM, OS und DK, in denen keine klonalen Zellen nachgewiesen wurden, unterschritt deren Zahl die Nachweisgrenze bzw. es waren keine klonalen T-Zellen in diesen Populationen vorhanden. Bei SH1 und FN2 wurde die Untersuchung mehrfach mit widersprüchlichen Ergebnissen wiederholt, so dass hier von einem Messfehler ausgegangen werden muss, da in der qualitativen PCR ein positives Ergebnis gezeigt werden konnte.

Mit einer Ausnahme, der Probe FN4, lag die auf die reale Verteilung der CD3+CD26+ bzw. CD3+CD26- Zellen angepasste Ratio RCD26+/CD26- konstant für alle Proben unter 0,04, was bedeutet, dass die klonale Zellen überwiegend CD26- waren.

Für FN lassen sich die Ergebnisse nur für die Proben FN1 und FN3 verwerten, hier lag die Ratio RCD26+/CD26- für beide Proben unter 0,01. Für die Probe FN2 ließen sich trotz wiederholter PCR-Ansätze keine Ergebnisse generieren. Das Ergebnis der Quantifizierung der CD3+CD26- Zellen für die Probe FN4 muss mit Vorbehalt betrachtet werden, da es in dieser Probe eine dominierenden CD3dim Population gab.

Für die Proben von DK, ließ sich nur in den CD26- Populationen ein T-Zell-Klon nachweisen, in der CD26+ Fraktion konnten keine klonalen Zellen gezeigt werden, die Ratio RCD26+/CD26- lag konstant unter 0,0003.

Für OS, RM und SH2 ergab eine Ratio RCD26+/CD26- von 0,04, welche auch unverändert in allen Proben blieb und auf einen dominanten Klon mit CD26- Phänotyp hindeutet. Für die Probe SH1 ließ sich in der CD26+ Population keine Quantifizierung erreichen.

4.3.4 Korrelation der PCR- und FACS-Ergebnisse

Für die Gegenüberstellung der Daten der FACS-Analyse und der Daten der Quantifizierung wurden die CD7 bzw. CD26 Expressionen der CD3 Populationen, wie sie sich in der FACS-Analyse darstellten, mit den Ratios RCD7+/CD7- bzw. RCD26+/CD26- , und damit der CD7 bzw. CD26 Expression der klonalen Zellen, verglichen. Zur Veranschaulichung sind die Daten in Tabelle 19 gegenübergestellt.


[Seite 57↓]

Tab. 19: Gegenüberstellung der quantitativen PCR-Daten und der FACS-Daten

Blutprobe

RCD7+/CD7-

FACSCD7

RCD26+/CD26-

FACSCD26

DK1

<0,0001

-

<0,0003

-

DK2

<0,0001

-

<0,0001

-

DK3a

<0,0001

-

<0,0001

-

DK3b

<0,0001

-

<0,0001

-

FN1

52,16

+

0,01

+/-

FN2

k.P.

+/-

k.P.

+/-

FN3

>429,4

+

0,0005

+/-

FN4

>269,1

+

>160,2

+/-

OS1

1,38

+/-

0,0002

-

OS2

1,4

+/-

0,0002

-

RM1

0,98

+/-

0,006

-

RM2

0,12

+/-

0,0001

-

RM3

0,38

+/-

0,0001

-

SH1

<0,01

+/-

k.P.

-

SH2

1,11

+/-

0,04

-

Die Auswertung für die CD7+ und CD7- Populationen zeigte, dass die Ergebnisse der FACS-Analyse in 12/15 Fällen mit den Daten der LightCycler®-Analyse übereinstimmen. Hierzu wurde verglichen, welches Antigenmuster der T-Zell-Klon aufwies und ob sich in der Probe mit dem T-Zell-Klon auch eine dominante T-Zell Population in der FACS-Analyse finden ließ.

Für FN ergab sich folgendes Bild: Bei Betrachtung der Verteilung der klonalen Zellen zeigte sich ein dominanter CD7+ Klon, in der FACS-Analyse stellte sich, mit Ausnahme von FN2 mit einem intermediären Typ, ein positiver Verteilungstyp dar. Für die CD26 Population konnte für FN1 und FN3 ein dominanter Klon in der CD26- Population gezeigt werden, bei intermediärem Typ in der FACS-Analyse. Das bedeutet für FN, dass die klonalen Zellen überwiegend CD7+ und CD26- sind und die alleinige FACS-Analyse keinen eindeutigen Rückschluss auf die Verteilung der klonalen Zellen zulässt.

In den Proben von DK konnte sowohl in der CD7 als auch in der CD26 Population kein Klon nachgewiesen werden. In der FACS-Analyse konnte diese dominante Verteilung auf die negativ Populationen ebenfalls gezeigt werden, so dass hier bereits die FACS-Analyse der CD3+ Zellen auf die Phänotypen der klonalen Zellen schließen lässt.

Für die Proben der Patienten OS, RM und SH konnte, mit Ausnahme von SH1, eine Verteilung der klonalen Zellen sowohl auf die CD7+ als auch auf die CD7- Population gezeigt werden. Für die Proben stellte sich in der FACS-Analyse ebenfalls ein intermediäres Verteilungsmuster dar. Desweiteren zeigten sich die klonalen Zellen dominant in der CD26- Population. In der FACS-Analyse der CD26-Populationen zeigte sich ein negativer Expressionstyp. Somit lässt sich für die CD7- und CD26-Population bereits von der FACS-Analyse der CD3+ Zellen auf den Phänotyp der klonalen Zellen schließen.


[Seite 58↓]

4.4  Korrelation der Analysen mit klinischen Befunden

4.4.1 Klinische und paraklinische Befunde

In Tabelle 20 sind für die einzelnen Patienten und untersuchten Proben die Daten der Erstdiagnose, der Paraklinik (Leukozytenzahl, Menge CD3+, CD4+ und CD8+ Zellen, prozentuale Angaben zu den Zellpopulationen, die CD4/CD8 Ratio und die LDH), Angaben zum Hautstatus, Lymphknotenstatus, Therapie und die Überlebenszeit seit Diagnosestellung dargestellt.

Für Patient FN, Erstdiagnose März 1999 zeigte sich eine stabile Leukozytenzahl, es kam jedoch vom 29.03.99 zum 07.03.01 zu einer Abnahme der CD3+ Zellen auf ein Drittel des Ausgangswertes, der auch in der CD4+ Population zu beobachten war. Gleichzeitig nahm die Zahl der CD8+ Lymphozyten zu, so dass die CD4/ CD8 Ratio einen starken Abfall von 21 auf 3,7 zeigte. Diese Werte blieben dann im weiteren Verlauf nahezu unverändert. Die LDH zeigte leicht erhöhte Serumlevel mit Werten von 237U/l und 283U/l. Klinisch fand sich eine Erythrodermie und eine diskrete Lymphknotenschwellung. Die Therapie bestand aus einer PUVA-Behandlung, Leukapherese und einer Kombination aus Chlorambucil und Prednisolon. Die Therapie mit Prednisolon und Chlorambucil wurde bis zum Ende des Beobachtungszeitraumes weitergeführt. Zu diesem Zeitpunkt lebte der Patient 43 Monate seit der Erstdiagnose.

Bei dem Patienten DK, Erstdiagnose 12/96, waren im Beobachtungszeitraum ständig erhöhte Leukozytenzahlen (zwischen 13,82gpt/l und 16,4gpt/l) mit einer abnehmenden Tendenz nachweisbar. Die Zahl der CD3+ und CD4+ Lymphozyten war erhöht, die Zahl der CD8+ unterhalb der Nachweisgrenze, so dass auch hier eine deutlich erhöhte CD4/ CD8 Ratio bestand. Darüber hinaus waren normale bis leicht erhöhte LDH Werte (226U/l, 233U/l, 267U/l) nachweisbar. Der Haut- und Lymphknotenstatus, Erythrodermie sowie axilläre und inguinale Lymphknotenschwellung, blieben unverändert. Die Therapie bestand in einer extracorporalen Photophorese (ECP). Der Patient verstarb 63 Monate nach Diagnose Sézary Syndrom an Komplikationen der Erkrankung..

Patient RM, Erstdiagnose 10/99, zeigte im gesamten Beobachtungszeitraum einen stabilen Haut- und Lymphknotenstatus. Der Hautstatus war gekennzeichnet durch eine Erythrodermie mit Pruritus und Hyperkeratosen. Es bestand eine zervikale, axilläre und inguinale Lymphknotenschwellung. Die Leukozytenzahl war immer erhöht und stieg von 17,76gpt/l auf Werte von 35,45gpt/l und 30,48gpt/l an. Es bestand eine erhöhte Zahl CD4+ Zellen, die CD8+ waren in den letzten zwei Proben nicht nachweisbar. Die LDH war erhöht und zeigte einen [Seite 59↓]Anstieg von 306U/l über 613U/l auf 769U/l. Therapeutisch wurden Leukapheresen durchgeführt. Der Patient verstarb 23 Monate nach Diagnosestellung.

Für Patienten OS stellt sich ein ähnliches Bild dar. Es wurden stabile Leukozytenzahlen im Normbereich beobachtet, bei einer erhöhten Zahl CD4 positiver Lymphozyten und einer CD4/ CD8 Ratio von 13,29 und 19,2. Die LDH war erhöht und lag bei 431U/l bzw. 333U/l. Die Klinik des Patienten, Erythrodermie mit Pruritus und eine generalisierten Lymphknotenschwellung, zeigten einen stabilen Verlauf. Die Therapie bestand anfangs aus Endoxan, Prednisolon, Vincristin und Leukeran und wurde umgestellt auf eine ECP in Kombination mit einer PUVA-Behandlung. Der Patient verstarb 23 Monate nach Diagnosestellung, ein klinisch-pathologischer Zusammenhang zur Erkrankung ist nicht bekannt.

Die Diagnose Sézary Syndrom wurde für Patienten SH im April 1996 gestellt. Es waren im Beobachtungszeitraum normale bis niedrige Leukozytenzahlen, bei erhöhten Werten für CD4+ Lymphozyten und einer erhöhten CD4/ CD8 Ratio, festzustellen. Die LDH war konstant mit Werten von 242U/l und 241U/l. Die Klinik zeigte eine Erythrodermie mit axillärer, inguinaler Lymphknotenschwellung. Die Therapie bestand aus Leukapheresen, Prednisolon, Leukeran und einer PUVA-Behandlung. Die Überlebenszeit nach Diagnosestellung betrug 43 Monate.


[Seite innerhalb Tabelle 60↓]

Tab. 20: Klinische und paraklinische Parameter der Patienten.

Pat.

Datum

Leuko

Gpt/l

CD3

CD4

CD4 in %

CD8

CD8 in %

Ratio

LDH

ED

Therapie

T/ ÜL*

LK-Status

Hautstatus

RM

11/99

17,76

7,32

7,4

97

0,16

2

46

306

10/99

 

09/01

(23 Mo)

LKS, ax bds.

Erythrodermie, Pruritus

05/00

35,45

-

-

-

-

-

-

613

 

Leukaph.

LKS, cerv, ax, ing

Erythrodermie,

palmoplantare Hyperkeratosen

09/00

30,48

-

-

-

-

-

-

769

 

Leukaph.

LKS cerv, ax, ing

Erythrodermie

SH

12/98

5,2

4,3

4,2

96

0,18

4

23

242

4/96

Leukaph.

12/99

(43 Mo)

  

02/99

3,84

2,5

-

-

-

-

-

241

 

PUVA, Leukaph.

Pred., Leukeran

LKS ax, ing

Erythrodermie

palmo/ plantare Hyperkeratose

DK

11/00

16,4

7,43

7,42

98

0

0

-

226

12/96

 

03/02

(63 Mo)

LKS ax, ing

Suberythrodermie

11/01

14,35

6,29

6,29

98

0

0

-

233

 

ECP

LKS ax, ing

Suberythrodermie

01/02

13,82

5,98

5,97

98

0

0

-

267

  

LKS ax, ing

Suberythrodermie

01/02

13,94

-

-

-

-

-

-

   

LKS ax, ing

Suberythrodermie

FN

03/99

6,35

1,57

1,52

88

0,07

4

21

 

03/99

 

43+ Mo

unauffällig

 

03/01

5

0,71

0,56

66

0,15

18

3,71

237

 

PUVA , Leukaph. Chlorambucil, Pred.

LKS ax

Erythrodermie

Pruritus

01/02

5,87

1,03

0,82

74

0,21

18

4

-

 

Chlorambucil, Pred.

unauffällig

Erythrodermie

03/02

4,95

0,91

0,73

74

0,17

17

4,2

283

 

Chlorambucil, Pred.

unauffällig

Suberythrodermie

OS

08/00

8,23

1,05

0,98

91

0,07

7

13,29

431

10/98

Endoxan, Pred.

Vincristin, Leukeran

09/00

(23 Mo)

LKS cerv, ax, ing

Erythrodermie

Pruritus

11/00

7,29

1,13

1,09

93

0,06

5

19,20

333

 

ECP, PUVA

LKS cerv, ax, ing

Erythrodermie

Pruritus

* → Monat und Jahr des Todes und überlebte Monate seit Diagnosestellung; cerv → zervikal, ax → axillär, ing → inguinal; Pred → Predisolon, Leukaph. → Leukapherese, Leuko → Leukozytenzahl, LDH → Laktat-Dehydrogenase, ED → Erstdiagnosedatum, LK → Lymphknoten, LKS → Lymphkotenschwellung, PUVA → Photochemotherapie (8-Mathoxypsoralen mit UVA), ECP → extracorporale Photophorese


[Seite 61↓]

4.4.2  Betrachtung der Daten im Zusammenhang zum klinischen Verlauf

In diesem Abschnitt wird darauf eingegangen, inwieweit sich die in der Quantifizierung und FACS-Analyse gefundenen Veränderungen im klinischen Bild der Patienten wiederspiegeln. Bei malignen Tumoren ist ein entscheidendes klinisches Merkmal der Erkrankung die Überlebenszeit. Diese wird auch hinzugezogen zur Bewertung prognostischer Faktoren und Therapieschemata.

Betrachtet man die hier vorliegenden Patientendaten, stellt man fest, dass es in bezug auf die Überlebenszeit drei Gruppen von Patienten gibt: die erste ist die der Patienten, die zum Ende des Beobachtungszeitraumes noch lebten (FN), die zweite die der Patienten, die fünf Jahre seit Diagnosestellung lebten (DK) und die dritte die der Patienten die kurze Zeit (< 43 Monate) nach der Diagnose Sézary Syndrom verstarben (OS, RM, SH).

Nimmt man die Überlebenszeiten der Patienten als Grundlage und stellt sie den paraklinischen und den hier gefundenen PCR-Analyse- und FACS-Daten gegenüber, ergibt sich folgendes Bild: der Patient FN lebte am Ende des Beobachtungszeitraums 43 Monate. Im Verlauf konnte im Blut eine hohe Ratio RCD7+/CD7- und eine niedrige Ratio RCD26+/CD26- gefunden werden. Das heißt die klonalen Zellen bei FN zeigten eine Dominanz in der CD7+ und CD26- Population. In der FACS-Analyse zeigte sich ein überwiegend positives Expressionsmuster für CD7 und ein intermediäres Muster für CD26, d.h. FN hatte einen relativ hohen Anteil nicht klonaler CD26+ Zellen. Von allen Patienten zeigte FN die niedrigste CD4/CD8 Ratio. Die weitere klinischen und paraklinischen Parameter zeigten im Verlauf keine entscheidenden Veränderungen. Zu beachten bei der Bewertung der Ergebnisse ist die Expansion einer CD3dimCD7-CD26- Zellpopulation.

Patient DK weißt eine Überlebenszeit von 63 Monaten auf. Bei allen Proben von DK finden sich die niedrigsten Ratios sowohl für die klonalen CD7- als auch CD26-Populationen. Die Dominanz der CD3+CD7- und CD3+CD26- Zellen konnte in der FACS-Analyse gezeigt werden. Darüber hinaus zeigte DK im Verlauf konstant erhöhte Leukozytenzahlen. Die weitere klinischen Daten zeigten sich auch im Verlauf stabil.

Die Patienten OS, RM und SH gehören zur Gruppe der früh Verstorbenen, sie lebten 23 bzw. 43 Monate nach Diagnosestellung. Für OS, RM und SH konnte anhand der Ratio RCD7+/CD7- eine intermediäre Verteilung der klonalen Zellen auf die CD7-Populationen festgestellt werden. Desweiteren zeigten die klonalen Zellen ein negatives Expressionsmuster für CD26. Die FACS-Analyse ergab ein intermediäres Muster für die CD7-Population und zeigte das kaum CD26+ Zellen vorhanden waren. Die Patienten OS [Seite 62↓]und RM zeigten darüber hinaus die höchsten LDH-Werte und RM zusätzlich noch die höchste Leukozytenzahl aller Patienten. Bei allen Patienten blieb der Hautstatus und der Lymphknotenstatus nahezu unverändert.

Die folgenden zwei Vermutungen lassen sich anhand dieser Daten anstellen:

Exakte Aussagen sind jedoch aufgrund der geringen Anzahl von Patienten, den unterschiedlichen Therapieschemata und dem nur 43monatigem Beobachtungszeitraum von FN nicht möglich.

4.5 Zusätzliche Aspekte der FACS-Analysen

4.5.1 Ungewöhnliche Expressionsmuster von CD7 und CD26 auf peripheren Lymphozyten

In der Analyse der PBMC der Patienten, traten bei fünf Proben Zellpopulationen auf, die den im vorangegangenen Text erwähnten Gruppen nicht zugeordnet werden konnten. Dies war der Fall in den Proben von FN2, FN3, FN4, OS1 und OS2. In diesen Proben waren Populationen vertreten, die einen Verlust von CD7 bzw. CD26 und eine sogenannte „dim“ Expression von CD3 bzw. einen Verlust von CD3 zeigten.

Die Proben von FN zeigten eine stetige Zunahme einer CD3dim Population. In der Probe FN2 deutete sich diese Population an, wurde in der Probe FN3 deutlicher und war dominant in der Probe FN4. Diese CD3dim Population zeigte sowohl einen CD7 als auch einen CD26 Antigen Verlust.

Das Auftreten einer „dim“-Population wurde nur bei FN beobachtet. Um trotz dieses Phänomens die Ergebnisse vergleichbar zu den Ergebnissen der anderen Patienten zu gestalten, wurden die CD3-/CD3dim Zellen nicht in die Analyse einbezogen.

In den Proben von OS konnte eine Population CD3- und gleichzeitig CD7 und CD26 defizienter Zellen nachgewiesen werden. Die Möglichkeit des Verlustes der Pan-T-Zell Marker ist auch in der Literatur beschrieben (Harmon et al. 1996). Mit Hilfe einer PCR mit sortierten Zellen diesen Phänotyps konnte bestätigt werden, dass in dieser Population klonale Zellen vorkommen.


[Seite 63↓]

4.5.2  Koexpression von CD7 und CD26 auf peripheren Lymphozyten

Um zu analysieren, wie sich der Antigenverlust von CD7 und CD26 zueinander verhält, wurde eine Doppelfärbung mit CD7 und CD26 durchgeführt. Um die Analyse auf überwiegend Lymphozyten zu beschränken, wurde ein Lymphozytenfenster in der FACS Analyse genutzt, bei dem nur Zellen eingeschlossen wurden, die in Größe und Granularität den Lymphozyten entsprachen. Es wurde jedoch kein Pan-T-Zell Marker verwendet.

Exemplarisch ist eine Graphik der Auswertung der Analyse dargestellt.

Abb. 11: CD7, CD26 Koexpression der PBMC von RM

Die Verteilung der Lymphozyten auf die einzelnen Populationen ist in der Tabelle 21 dargestellt.

Tab. 21: CD7, CD26 Koexpression der PBMC als prozentualer Anteil der einzelnen Populationen

Probe

CD7+CD26+

CD7-CD26+

CD7+CD26-

CD7-CD26-

DK1

0,8

0,6

0,3

98,3

DK2

0,8

1,1

0,4

97,7

DK3a

0,7

1,6

0,3

97,4

DK3b

0,8

1,6

0,3

97,3

FN1

14,7

1,0

69,2

14,9

FN2

22,4

5,4

45,9

26,3

FN3

12,5

6,2

16,6

64,6

FN4

14,0

3,1

33,1

49,8

RM1

4,8

0,5

47,1

47,6

RM2

0,6

0,4

11,1

88,0

RM3

1,1

0,9

18,0

80,1

OS1

0,5

1,3

43,7

54,5

OS2

5,9

6,3

41,8

46,0

SH2

2,5

1,2

33,6

62,7

∅ Kontrollen

40,1

4,7

32,1

23,1


[Seite 64↓]

Die Koexpression von CD7 und CD26 lässt sich gut mit den bisher dargestellten Ergebnissen vereinbaren.

So findet sich bei FN der höchste Anteil CD7+CD26+ Zellen, der aber mit Werten zwischen 12,5 und 22,4 noch weit unter dem Wert der Kontrollpopulationen (40,1) liegt. Vor allem die CD7+CD26- und CD7-CD26- Populationen sind erhöht. Da für FN bisher gezeigt wurde, dass die klonalen Zellen sowohl CD7+ als auch CD7- aber vor allem überwiegend CD26- sind, liegt die Vermutung nahe, dass die CD7+CD26+ Zellen bei FN keine maligne entarteten und damit immunkompetente Zellen sind.

Bei DK findet sich, wie erwartet, die überwiegende Zahl der Zellen in der CD7-CD26- Population. Auffällig ist der im Vergleich zu den anderen Patienten geringe Anteil CD7+CD26- Zellen.

Für die Patienten OS, RM und SH zeigt sich ein sehr geringer Anteil CD7+CD26+ Zellen jedoch ist der Anteil der CD7+CD26- Zellen erhöht, in vier von den sieben Proben sogar höher als bei den Kontrollen. Da gezeigt wurde, dass die klonalen Zellen sowohl CD7+ als auch CD7- sind und fast alle klonalen Zellen CD26- sind, handelt es sich bei diesen CD7+CD26- und CD7-CD26- Zellen sehr wahrscheinlich um überwiegend klonale Zellen.

Zusammenfassend kann hier festgestellt werden, dass bei den Patienten mit schlechterer Prognose (DK, OS, RM, SH), fast alle Zellen auf die CD7+CD26- bzw. CD7-CD26- Population verteilt sind und bei diesen Patienten der Anteil CD7+CD26+ Zellen sehr gering ist. Im Unterschied dazu besitzt FN einen relativ hohen Anteil an nicht klonalen CD7+CD26+ Zellen. Dies würde die These stützen, dass ein hoher Anteil CD26+ Zellen ein prognostisch günstiger Faktor sei.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
22.10.2004