Scholz, Dietmar: Analyse der Surfaktantprotein A-Gene bei Patienten mit Verdacht auf einen Surfaktantproteindefekt

19

Kapitel 3. Material und Methoden

3.1 Patienten-DNA

DNA von 31 nicht konsanguinen Patienten indogermanischer (caucasian) Abstammung wurde zwischen Juni 1996 und Februar 1998 auf einen Surfaktantproteindefekt untersucht. Alle Patienten befanden sich zum Zeitpunkt der Probenentnahme zur stationären Behandlung in einer Kinder- oder Lungenklinik. Die Indikation zur Untersuchung der Surfaktantproteine wurde von den behandelnden Ärzten in Absprache mit dem Leiter des Projektbereichs “Molekulare und zelluläre Biologie des Surfaktants“ gestellt. EDTA-Blut wurde mit Einwilligung der Eltern beziehungsweise der volljährigen Patienten entnommen und zur DNA-Isolation verwendet. Differentialdiagnostische Erwägungen entschieden, bei welchen Patienten die SP-A-Gene vollständig sequenziert wurden.

3.1.1 Indikation zur Untersuchung der Surfaktantproteine

Zwölf Patienten waren Frühgeborene, die seit der Geburt beatmungspflichtig waren. Zwei litten an einer therapierefraktären Pneumonie und zehn am Atemnotsyndrom des Neugeborenen ( RDS ). Von diesen zehn konnten sieben nicht vom Respirator entwöhnt werden, bei einem war ein fatales Atemnotsyndrom aus der Familienanamnese bekannt, bei den beiden anderen war PAS -positives Material in der bronchoalveolären Lavage ( BAL ) nachgewiesen worden.

Vierzehn Patienten waren reifgeborene Säuglinge, von denen sich sieben zum Zeitpunkt der Untersuchung noch im Neugeborenenalter befanden. Drei der Säuglinge wurden wegen einer therapierefraktären Pneumonie behandelt und einer hatte ein akutes Atemnotsyndrom (ARDS) im Anschluss an eine virale Pneumonie entwickelt. Von den zehn übrigen Säuglingen mit dem klinischen Bild eines RDS waren sieben nicht vom Respirator zu entwöhnen, zwei benötigten vorübergehend eine extrakorporale Membranoxygenierung (ECMO), beim anderen war ein fatales Atemnotsyndrom aus der Familienanamnese bekannt.

Fünf ältere Kinder und Erwachsene mit allmählicher Verschlechterung der Lungenfunktion und interstitieller radiologischer Zeichnungsvermehrung wurden wegen PAS-positivem Material in der BAL oder einer Lungenbiopsie unter dem Verdacht auf eine Alveolarproteinose untersucht. Fünf Mitarbeiter ohne pulmonale Erkrankung hatten ihre SP-A-Gene ebenso analysieren lassen.


20

Tabelle 3-1: Patientendaten mit Angaben zur Indikation und Alter zum Zeitpunkt der Blutabnahme
ARDS = akutes Atemnotsyndrom, BPD = bronchopulmonale Dysplasie, CMV = Zytomegalievirus, ECMO = extrakorporale Membranoxygenierung, PAS+ = PAS -positives Material in BAL oder Biopsat (pathognomonisch für Alveolarproteinose), RDS = Atemnotsyndrom, SSW = vollendete Schwangerschaftswochen bei Frühgeburt, Surf = Zahl der Surfaktantgaben (falls bekannt), verst = verstarb im Alter von: Ta(gen), Wo(chen), Mo(naten) oder J.(ahren). * = aufgrund dieser Diagnose wurde eine vollständige Sequenzierung der SP-A-Gene durchgeführt.

Nr

Alter

SSW

Indikation

Differentialdiagnose

Surf

verst

1

2 Wo

 

RDS mit Langzeitbeatmung

pulmonale Maladaptation bei maternalem Diabetes

 

 

2

4 Mo

 

therapierefraktäre Pneumonie

Aspiration, Chromosom 20p-Syndrom, Glykogenose

 

4 Mo

3

2 Wo

 

RDS mit 10 Tagen ECMO

idiopathische Alveolarproteinose*

3 ×

4 Wo

4

15 J.

 

chronische Dyspnoe (PAS+)

idiopathische Alveolarproteinose*

 

 

5

9 Wo

25

RDS mit Langzeitbeatmung

BPD, therapierefraktärer Surfaktantmangel*

 

 

6

4 Wo

 

RDS mit Langzeitbeatmung

idiopathische Alveolarproteinose*

 

7 Wo

7

1 Mo

35

therapierefraktäre Pneumonie

rezidivierende konnatale Pneumonie*

 

 

8

7 Wo

25

RDS mit Langzeitbeatmung

BPD, therapierefraktärer Surfaktantmangel*

4 ×

 

9

14 J.

 

chronische Dyspnoe (PAS+)

idiopathische Alveolarproteinose*

 

 

10

4 Wo

 

RDS mit Langzeitbeatmung

zeitweise verminderter SP-A-Gehalt in der BAL*

8 ×

 

11

2 Wo

 

RDS, Familienanamnese

Besserung nach Ausschluss der Alveolarproteinose

 

 

12

11 J.

 

chronische Dyspnoe (PAS+)

Leukämie, idiopathische Alveolarproteinose*

 

 

13

7 Mo

25

rezidivierende Pneumonie

Wilson-Mikity-Syndrom (Blasenlungensyndrom)

 

 

14

2 Wo

25

RDS mit Langzeitbeatmung

Vierling mit BPD

9 ×

 

15

4 Mo

27

RDS mit Langzeitbeatmung

BPD, therapierefraktärer Surfaktantmangel*

5 ×

 

16

5 Mo

 

therapierefraktäre Pneumonie

rezidivierende interstitielle Pneumonie*

 

 

17

9 Mo

 

therapierefraktäre Pneumonie

rezidivierende Bronchopneumonie*

 

 

18

5 Wo

 

RDS mit Langzeitbeatmung

konnatale Alveolarproteinose bei SP-B-Mangel

 

4 Mo

21

7 Mo

 

ARDS mit Langzeitbeatmung

ARDS, interstitielle Pneumonie, SP-B-Mangel

3 ×

 

22

4 Wo

 

RDS mit Langzeitbeatmung

Besserung nach Ausschluss der Alveolarproteinose

 

 

23

40 J.

 

chronische Dyspnoe (PAS+)

sekundäre Alveolarproteinose bei Pneumokoniose

 

 

24

1 Wo

35

RDS, Familienanamnese

schweres RDS

3 ×

 

25

7 Wo

 

RDS, ECMO, CMV-Infekt

konnatale Alveolarproteinose bei SP-B-Mangel

2 ×

3 Mo

26

9 Wo

30

RDS mit Langzeitbeatmung

BPD, Sepsis, nosokomiale Pneumonien

13 ×

5 Mo

27

7 Wo

34

RDS mit Langzeitbeatmung

RDS, BPD, nosokomiale Pneumonie

6 ×

 

28

3 Wo

 

RDS mit Langzeitbeatmung

Besserung nach Ausschluss der Alveolarproteinose

 

 

31

4 Mo

34

schweres RDS (PAS+)

konnatale Alveolarproteinose bei GM-CSF-Mangel

1 ×

4 Mo

32

3 Wo

29

RDS mit Langzeitbeatmung

Atelektase mit Verteilungsstörung in der Lunge

 

 

33

6 Wo

 

RDS mit Langzeitbeatmung

nosokomiale Pneumonie, Chromosom 22q-Syndrom

 

3 Mo

34

1 Wo

36

schweres RDS (PAS+)

idiopathische Alveolarproteinose*

3 ×

6 Wo

37

35 J.

 

chronische Dyspnoe (PAS+)

Idiopathische Alveolarproteinose*

 

 


21

3.1.2 Differentialdiagnostische Erwägungen

Bei elf Patienten wurde die Diagnose einer Alveolarproteinose durch den Nachweis des charakteristischen, protein- und phospholipidhaltigen, PAS-positiven Materials in der Lunge gesichert. Bei zwei dieser Patienten war kein Surfaktantprotein B (SP-B) in der Lavage nachweisbar. Es wurden Untersuchungen des SP-B-Gens (sftp3 nach Pilot-Matias et al. 1989) auf die Mutationen 121ins2 ( Nogee et al. 1994), Arg236Cys ( Ballard et al. 1995) und Gly135Cys ( Klein et al. 1998) durchgeführt, die jedoch nicht Bestandteil dieser Arbeit sein sollen. Patient 18 hatte die Leserastermutation 121ins2 (nach den aktuellen Vorschlägen zur Nomenklatur Phe120fs mit einem frameshift in Codon 120) in einem Allel des SP-B-Gens und im anderen Allel eine Einzelbasensubstitution, die den Aminosäureaustausch Cys49Arg bewirkt, es bestand also compound heterozygosity (kombinierte Heterozygotie) für [g.2587delCinsGAA] + [g.1508T>C], was den letalen Ausgang erklärt (L. Nogee et al., unveröffentlicht). Patient 25 hatte ebenfalls eine konnatale Alveolarproteinose, der für den SP-B-Mangel verantwortliche Defekt war jedoch nicht zu ermitteln. Die bei diesem Patienten ebenfalls nachgewiesene Infektion mit dem Zytomegalievirus (CMV) soll bei einigen Formen der Alveolarproteinose pathogenetisch beteiligt sein ( Ranchod und Bissell 1979). Bei Patient 31 konnte ein Defekt im GM-CSF-Rezeptorgen als Ursache der konnatalen Alveolarproteinose nachgewiesen werden, Patient 23 entwickelte die Alveolarproteinose sekundär im Rahmen einer Pneumokoniose. Bei Autopsien ist dies kein seltener Befund ( Honma und Chiyotani 1991). Nach Ausschluss bekannter Ursachen wurden die übrigen sieben Fälle zunächst als idiopathische Alveolarproteinose eingeordnet. Es handelte sich hierbei um drei Neugeborene, die innerhalb weniger Wochen verstarben und vier ältere Kinder oder Erwachsene. Bei Patient 12 wäre auch die Einordnung als sekundäre Alveolarproteinose bei Leukämie gerechtfertigt ( Cordonnier et al. 1994), doch soll der auffällige SP-A-Genotyp in Abschnitt 5.2.2 diskutiert werden.

Außer bei den sieben Patienten mit idiopathischer Alveolarproteinose wurden die SP-A-Gensequenzen bei drei Säuglingen mit rezidivierender Pneumonie im Alter von einem, fünf, beziehungsweise neun Monaten und vier seit mehreren Wochen beatmungspflichtigen RDS-Patienten vollständig ermittelt. Eins dieser Kinder war durch den vorübergehenden Nachweis einer niedrigen Konzentration des SP-A in der BAL aufgefallen, drei waren Frühgeborene, bei denen wegen der schlechten Antwort auf wiederholte Surfaktantgaben ein für den Surfaktantmangel verantwortlicher Defekt in den Surfaktantproteinen als Differentialdiagnose zur sich abzeichnenden bronchopulmonalen Dysplasie ( BPD ) diskutiert wurde. Bei den übrigen Patienten erklärten die in Tabelle 3-1 aufgeführten Differentialdiagnosen die Schwere der Erkrankung. Nach Entlassung wurde der Krankheitsverlauf nicht weiter verfolgt. Drei der


22

Säuglinge waren an nosokomialer Pneumonie verstorben, von diesen hatten zwei Fehlbildungen aufgrund chromosomaler Deletionen (del20p11.23 beziehungsweise del22q11).

3.2 Geräte und Chemikalien

Die benutzten Geräte sind in Tabelle 3-2 aufgeführt, die Verbrauchsmaterialien in Tabelle 3-3 .

Tabelle 3-2: Geräte

Bezeichnung

Typ

Hersteller

Autoklav

2540 EL

tuttnauer®

Schüttelbrutschrank

3032

G.F.L. ®

Direkt-Blotter

1500 System

GATC GmbH in Konstanz (BRD)

Elektrophorese (horizontal)

GFA 100

Pharmacia Biotech in Uppsala (Schweden)

Elektrophorese (vertikal)

SE 600

Hoefer Scientific Instruments in S. F. (USA)

Feinwaage

MC BA 100

Sartorius GmbH in Göttingen (BRD)

Foto Scanner

ScanJet 4C

Hewlett Packard

Gefrierkühlschrank

KK EE 26 A

Robert Bosch GmbH in München (BRD)

Hybridisiertrommel

 

GATC GmbH in Konstanz (BRD)

Imaging-Densitometer

GS-670

Bio-Rad Laboratories GmbH in München (BRD)

Kältezentrifuge

MR 18 22

Jouan®

Kühlpumpe

Colora

Spandau Pumpen in Berlin (BRD)

Netzgerät

PowerPac3000

Bio-Rad Laboratories GmbH in München (BRD)

PH-Meter

761 calimatic

Knick Elektr. Messgeräte GmbH in Berlin (BRD)

Pipetten

Vario

eppendorf® in Hamburg (BRD)

Sofortbildkamera

DS 34

Polaroid® in Cambrigde (Großbritannien)

Sterilwerkbank

BSK 6 MP

antair®

Thermocycler

TRIO-Thermobloc

Biometra® in Göttingen (BRD)

Thermomixer

5436

eppendorf® in Hamburg (BRD)

Tischzentrifuge

5410

eppendorf® in Hamburg (BRD)

UV-Crosslinker

GATC LINK

GATC GmbH in Konstanz (BRD)

UV-Transilluminator

UVVIS-20

Hoefer Scientific Instruments in S.F. (USA)

Vortex

Reax 2000

Heidolph®

Waage

34.002

VEB Wägetechnik Rapido (DDR)

Die Chemikalien stammten, wo nicht anders angegeben, von der Carl Roth GmbH in Karlsruhe, der Serva Feinbiochemica GmbH in Heidelberg oder der Sigma-Aldrich GmbH in Deisenhofen, die Restriktionsendonukleasen und Reaktionspuffer von New England Biolabs in Beverly


23

(USA). Die DNA-Oligomere ( Primer ) wurden bei MWG-BIOTECH® in Ebersberg (BRD) synthetisiert.

Tabelle 3-3: Verbrauchsmaterial

Bezeichnung

Typ

Hersteller

Filter

1573 ½

Schleicher & Schüll GmbH in Dassel (BRD)

Direct Blotting Membrane

Breite 15 cm

GATC GmbH in Konstanz (BRD)

Gel drying film

25,5 × 28 cm

Promega®Boehringer Ingelheim in Heidelberg (BRD)

Parafilm®

4 × 24 cm

American National Can in Greenwich (USA)

Petrischalen

Falcon® 1029

Becton Dickinson Labware in New Jersey (USA)

Pipettenspitzen

Pipet Tips

eppendorf® in Hamburg (BRD)

(dito gestopft)

Safe Seal-Tips

BIOzym® in Hessisch Oldendorf (BRD)

Reaktionsgefäße

Safe-lock

eppendorf® in Hamburg (BRD)

Schwarzweißfilme

Type 667

Polaroid® in Cambrigde (Großbritannien)

3.3 Gelelektrophorese

Mit Hilfe der Gelelektrophorese wurde DNA zur Analyse und Isolierung aufgetrennt. Die Größe der DNA-Moleküle in Basenpaaren (bp) wurde im Vergleich mit einem DNA-Standard abgeschätzt. Tabelle 3-4 zeigt die Reagenzien für die Gelelektrophoresen.

Tabelle 3-4: Reagenzien für die Gelelektrophorese

Reagenz

Bezeichnung

Hersteller

DNA-Standards

100 bp DNA ladder
HindII-digest des lambda-Phagen

GibcoBRL® in Eggenheim (BRD)
Eigenproduktion

Agarose

Agarose (für > 500 bp)

Biozym Diagnostik GmbH in Hessisch Old. (BRD)

Acrylamidlösung

40%-Acryl.(37,5:1)Bis-Acr.

amresco® in Solon, Ohio (USA)

SSCP-Gellösung

MDE® Gel Solution

FMC BioProducts in Rockland, Maine (USA)

abweisendes Silan

Dimethyldichlorsilan

Serva Feinbiochemica GmbH in Heidelberg (BRD)

Hochmolekulare genomische DNA und Plasmid-DNA wurden in der Agarosegelelektrophorese aufgetrennt. Die DNA kann nach Einschmelzen des Gels in Anwesenheit chaotropischer Salze leicht isoliert werden. PCR-Produkte und DNA-Restriktionen wurden aufgrund der besseren Trennschärfe in der Polyacrylamidgelelektrophorese analysiert. Dem Auftragepuffer wurden Farbstoffe zur Markierung der Laufmittelfront zugesetzt. Tabelle 3-5 zeigt die Stammlösungen.


24

Tabelle 3-5: Lösungen für die Gelelektrophorese

Lösung

Konzentration der

Bestandteile

Auftragepuffer

10 mmol/l
25 %
0,1 %
0,1 %

Tris-Base (pH 8,0)
Ficoll 400
Xylencyanol FF
Bromphenolblau

Polymerisationsstarter

0,1 %
0,15 %

Ammoniumpersulfat (APS)
N, N, N’, N’-Tetramethylethylendiamin (TEMED)

TAE-Puffer
(pH 8,0 bei 25 °C)

40 mmol/l
5 mmol/l
1 mmol/l

Tris-Base
Natriumacetat
Na2EDTA

(10×)TBE-Puffer
(pH 8,0 bei 25 °C)

900 mmol/l
900 mmol/l
20 mmol/l

Tris-Base
Borsäure
Na2EDTA

Die SSCP-Gelelektrophorese wurde in Polyacrylamidgelen geringer Querverzweigung zum Nachweis des Einzelstrangkonformationspolymorphismus ( single strand conformation polymorphism) mit amplifizierter DNA durchgeführt. Die Proben wurden vor der Elektrophorese im Einzelstrangpuffer denaturiert, also in sense- und antisense-Einzelstränge aufgetrennt, die im nicht denaturierenden Gel eine individuelle Konformation (räumliche Anordnung) annehmen und sich dadurch von der ebenfalls gebildeten Doppelstrang-DNA isolieren lassen. Zum Farbnachweis der DNA im Gel wurden interkalierende Fluoreszenzfarbstoffe eingesetzt. Beim Nachweis von Einzelstrang-DNA war die Silberfärbung sensitiver.

3.3.1 Agarosegelelektrophorese

1 µl genomische DNA oder 2 µl amplifizierte DNA wurde mit 1 µl Auftragepuffer in einem 8 × 4 × ½ cm-Gel aus 1 % Agarose in TAE-Puffer bei einem konstanten Strom von 40 mA etwa 20 Minuten aufgetrennt. Zur Gelexzision wurde 50 µl PCR-Produkt mit 10 µl Auftragepuffer in einem 12 × 8× 0,8 cm-Gel bei 85 mA etwa 60 Minuten aufgetrennt.

3.3.2 Polyacrylamidgelelektrophorese

5 - 10 µl amplifizierte DNA wurde in 16 × 14 × 0,15 cm-Gelen aus 5 - 8 % Polyacrylamid in TBE-Puffer mit 5 µl Auftragepuffer bei 55 mA etwa 1 h aufgetrennt.


25

3.3.3 SSCP-Gelelektrophorese

Die in Tabelle 3-6 gezeigten Stammlösungen mit verschiedenen Bisacrylamidanteilen wurden bei 4 °C aufbewahrt. Die Glasplatten wurden vor dem Gießen mit abweisendem Silan beschichtet. 5 - 10 µl PCR-Amplifikat wurden mit 5 - 10 µl Einzelstrangpuffer für 5 Minuten bei 95 °C inkubiert und in 16 × 16 × 0,15 cm-Gelen aus 3,5 - 12 % Polyacrylamid in TBE-Puffer 90 - 150 Minuten mit einer konstanten Leistung von 7 Watt aufgetrennt. Eine zusätzliche Probe wurde mit Doppelstrangpuffer gemischt und nicht denaturiert.

Tabelle 3-6: Lösungen für die SSCP-Gelelektrophorese

Lösung

Konzentration

der Bestandteile

40%-Acrylamidlösung Acryl.(39:1)Bis-Acryl.

35,1 g
0,9 g
90 ml

Acrylamid
N, N’-Methylenbisacrylamid
H2O

40%-Acrylamidlösung Acryl. (99:1)Bis-Acryl.

39,6 g
0,4 g
100 ml

Acrylamid
N, N’-Methylenbisacrylamid
H2O

40%-Acrylamidlösung Acryl. (199:1)Bis-Acryl.

19,9 g
0,1 g
50 ml

Acrylamid
N, N’-Methylenbisacrylamid
H2O

Einzelstrangpuffer

80 %
1 mmol/l
10 mmol/l
0,1 %

Formamid
Na2EDTA
NaOH
Xylencyanol FF/ Bromphenolblau

Doppelstrangpuffer

80 %
1 mmol/l
0,1 %

Formamid
Na2EDTA
Xylencyanol FF/ Bromphenolblau

3.3.4 Farbnachweis der DNA im Gel

Polyacrylamidgele wurden 10 Minuten in Ethidiumbromidlösung gefärbt. Agarosegelen wurde Ethidiumbromid in entsprechender Konzentration zugegeben. Zum Nachweis schwacher Banden wurde das Gel mit 1,5 ml SYBR®-Green I für 30 Minuten überschichtet.

SSCP-Gele wurden mit dem silver stain kit aus Tabelle 3-7 auf dem Horizontalwipptisch gefärbt. Zunächst wurde 60 Minuten in Fixativ 1 und zweimal 30 Minuten in Fixativ 2 gespült. Der Oxidizer wirkte 10 Minuten auf das Gel ein, bevor er in drei Waschschritten von 10 Minuten Dauer gründlich ausgespült wurde. Das Silberreagenz wirkte 30 Sekunden ein, bevor 2 Minuten mit H2O gespült wurde. Entwicklerlösung wurde dreimal bis zur Ausflockung eingesetzt. Stopplösung beendete die Reaktion, bevor sich eine Hintergrundfärbung einstellte.


26

Tabelle 3-7: Lösungen zum Farbnachweis der DNA im Gel
1): Biozym Diagnostik GmbH in Hessisch Oldendorf
2): silver stain kit der Bio-Rad Laboratories in Richmond, California

Lösung

Konzentration der

Bestandteile

Ethidiumbromidlösung

0,5 µg/ml

in H2O

SYBR®-Green I stain solution1)

1:10.000

in TBE-Puffer (pH 8,0)

Fixativ 1

40 %

Methanol

Fixativ 2

10 %

Ethanol

Oxidizer2)

(keine Angaben)

KCr2O7 und HNO3

Silberreagenz2)

0,05 %

AgNO3

Entwickler2)

3 %
0,2 %

NaCO3
Paraformaldehyd

Stopplösung

5 %

Essigsäure

3.4 DNA-Isolation

Genomische DNA aus Leukozyten wurde nach Auflösen der Zellen mittels geeigneter Detergentien und Präzipitation der Proteine in einer Salzlösung durch alkoholische Fällung pelletiert. Die freigesetzte RNA wurde enzymatisch abgebaut. Plasmid-DNA wurde nach der Methode von Birnboim und Doly (1979) isoliert. Amplifizierte DNA-Sequenzen wurden durch Bindung an silikatisches Trägermaterial isoliert. In der PCR nicht verbrauchte Nukleotide und Primer wurden enzymatisch abgebaut. Nebenprodukte wurden elektrophoretisch abgetrennt und die gewünschte DNA mittels Gelexzision isoliert.

3.4.1 Genomische DNA aus Leukozyten

Tabelle 3-8: Lösungen zur Isolation chromosomaler DNA
Puregene®DNA-Isolation Kit: Volumina zur DNA-Isolation aus 300µl Vollblut und Zusammensetzung nach Angaben des Herstellers: Gentra Systems, Inc. in Minneapolis (USA)

Lösung

Volumen

Zusammensetzung

Red Blood Cell (RBC) Lysis Solution

900 µl

NH4Cl, Na2EDTA, Na2CO3

Cell Lysis Solution

300 µl

Tris-Base, Na2EDTA, SDS

RNase A Solution

1,5 µl

>120 Units/µl RNase A

Protein Precipitation Solution

150 µl

Ammoniumacetat

DNA Hydration Solution

100 µl

10 mmol/l Tris-Base, 1 mmol/l Na2EDTA


27

Die Isolation der Leukozyten-DNA wurde mit den in Tabelle 3-8 aufgeführten Lösungen des Puregene®DNA-Isolation Kit nach Herstellerprotokoll durchgeführt. Aus 300 µl Vollblut wurden etwa 30 µg DNA isoliert. Die DNA-Proben mit einer Konzentration von etwa 0,3 µg/µl wurden bei -20 °C aufbewahrt. Verdünnungen von 1:10 in wurden bei 4 °C bereitgehalten, um wiederholtes Auftauen und Gefrieren zu vermeiden (vgl. Abbildung 4-1 in Abschnitt 4.1.2 ).

3.4.2 Plasmid-DNA

1,5 ml Bakterienkultur wurden 5 Minuten zentrifugiert. Das Pellet wurde in 100 µl des Suspensionspuffers in Tabelle 3-9 suspendiert, unter Vortexen mit 200 µl Detergenz gemischt und für 5 Minuten auf Eis gestellt. 30 Minuten nach Zugabe von 150 µl Salzlösung 1 wurde 10 Minuten bei Raumtemperatur zentrifugiert (13.000 Upm). Der Überstand wurde mit 1 ml 96 %igem Ethanol gemischt und die DNA bei -20 °C für 30 Minuten ausgefällt. Nach 10 Minuten Zentrifugieren bei 4 °C (13.000 Upm) wurde der Überstand abgesaugt.

Tabelle 3-9: Lösungen zur Isolation von Plasmid-DNA

Lösung

Konzentration

der Bestandteile

Suspensionspuffer

25 mmol/l
50 mmol/l
10 mmol/l

Tris-HCl (pH 8,0)
Glucose
Na2EDTA

Detergenz

1%
0,2 mol/l

SDS
NaOH

Salzlösung 1

3,0 mol/l

Natriumacetat (pH 4,8)

Salzlösung 2

0,3 mol/l

Natriumacetat (pH 4,8)

Das Pellet wurde in 150 µl Salzlösung 2 gelöst, mit 300 µl tiefgekühltem Ethanol gefällt, in der Vakuumzentrifuge 5 Minuten getrocknet und in 30 µl H2O zur weiteren Analyse gelöst.

3.4.3 Amplifizierte DNA-Sequenzen

Ein PCR-Ansatz (50 µl) wurde mit je 0,5 µl Exonuklease und Phosphatase 60 Minuten bei 37 °C inkubiert. 15 Minuten Erhitzen auf 80 °C inaktivierte die Enzyme. Die Probe wurde mit 250 µl Puffer PB in ein QIAquick®spin column überführt und 30 Sekunden zentrifugiert (13.000Upm). Nach Waschung mit 500 µl Puffer PE wurde mit 30 µl H2O eluiert. Zur Gelexzision wurde die entsprechende Farbbande aus dem Agarosegel geschnitten und mit QIAEXII-Suspension aus


28

Tabelle 3-10 nach Herstellerprotokoll extrahiert.

Tabelle 3-10: Materialien zur Aufbereitung amplifizierter DNA
1): Reagent pack for use with Sequencing Kit Nr. US 70995 von Amersham in Cleveland, Ohio (USA)
2): Reagenzien zur DNA-Extraktion von der QIAGEN GmbH in Hilden (BRD)

Produkt

Bestandteile

Enzyme1)

2 Units/µl shrimps alcaline phosphatase + 10 Units/µl Exonuclease I

QIAquick®spin column2)

silikatisches Trägermaterial

Puffer PB/ Puffer QX 1

Chaotropische Salze

Puffer PE

Tris-Base / NaCl / 70% Ethanol

QIAEX II-Suspension

silikatisches Trägermaterial

3.5 Polymerasekettenreaktion (PCR)

Tabelle 3-11: Reagenzien für die PCR
1): Promega® oder TaKaRa®, Boehringer Ingelheim Bioproducts in Heidelberg (BRD)
2): Expand®-Long Template PCR-System von Boehringer in Mannheim (BRD)
3): PerkinElmer Weiterstadt, 4): PAN-Systems GmbH Aidenbach, 5): Braun® Melsungen (BRD)

Reagenz

Konzentration

der Bestandteile

(10×)PCR-Puffer1)
(pH 9,0 bei 25 °C)

500 mmol/l
100 mmol/l
1 %

KCl
TrisHCl
Triton® X 100

(10×)PCR-Puffer II3)
(pH 8,3 bei 25 °C)

500 mmol/l
100 mmol/l

KCl
TrisHCl

Additiva

5 - 10 mmol/l

10 %

5 - 10 %

Ammoniumsulfat

Glycerol

Formamid

Magnesiumlösung1)

25 mmol/l

MgCl2

dNTP-Mix1)
(pH 7,8 bei 25 °C)

10 mmol/l
10 mmol/l
10 mmol/l
10 mmol/l

dATP
dCTP
dGTP
dTTP

thermostabile
DNA-Polymerasen

5 Units/µl

5 Units/µl

Taq-DNA-Polymerase1)

Tfl-DNA-Polmerase1)

hot start -DNA-Polymerase3)

5 Units/µl

AmpliTaq Gold®

DNA-Polymerasen mit proof reading-Aktivität

5 Units/µl

5 Units/µl

5 Units/µl

ExTaq-DNA-Polymerase1)

Pwo-DNA-Polymerase + Taq-DNA-Polymerase2)

PowerScript DNA-Polymerase + Pyrophosphatphosphohydrolase4)

aqua ad iniectibilia5)

100 %

H2O


29

Bei der Polymerasekettenreaktion (PCR) wird ein bestimmter DNA-Abschnitt durch eine thermostabile DNA-Polymerase mit Temperaturoptimum zwischen 70 - 80 °C synthetisiert. Die Startpunkte für die Extension werden durch Hybridisierung der bei hoher Temperatur denaturierten DNA mit spezifischen DNA-Oligomeren gebildet. Diese Primer haben meist nur etwa 20 Nukleotide und lagern sich erst bei Unterschreitung ihrer Schmelztemperatur an die DNA an. Die Wiederholung der drei Reaktionsschritte Denaturierung, Hybridisierung und Extension in einer zyklischen Reaktion im Thermocycler bewirkt die exponentielle Amplifikation der entsprechenden Sequenz. Wird aus einer DNA-Probe mit “externen“ Primern ein größerer Abschnitt amplifiziert und aus dem PCR-Produkt mit “internen“ Primern eine kürzere Sequenz erneut synthetisiert, nennt man dies nested PCR ( Newton und Graham 1997).

Die Berechnung geeigneter Primersequenzen mit speziellen Algorithmen bildet die Grundlage für die experimentelle Auswahl der Primer. Die verschiedenen Reagenzien aus Tabelle 3-11 wurden zur Optimierung der Reaktionsbedingungen in wechselnden Konzentrationen eingesetzt. Alle Schritte der DNA-Isolation und die Vorbereitung der PCR wurden unter der Sterilwerkbank mit gestopften Pipettenspitzen und Einmalhandschuhen durchgeführt. Reaktionsgefäße und Reagenzien wurden autoklaviert. Bei jeder PCR wurde ein Reaktionsansatz ohne DNA mitgeführt, um Kontaminationen auszuschließen.

3.5.1 nested PCR

Um wie bei einer allelspezifischen PCR ( ASPCR ) nur eine aus mehreren annähernd identischen DNA-Sequenzen zu amplifizieren, sind “diskriminierende“ Primer nötig, deren 3‘-terminale Nukleotide in unserem Fall für eine der beiden SP-A-Gensequenzen spezifisch sind. Mit jeder genomischen DNA-Probe wurden wie in Abbildung 3-1 dargestellt zwei separate Polymerasekettenreaktionen zur Isolation der beiden Genkopien durchgeführt. In diesen externen PCRs wurde mit diskriminierenden Primern eine alle kodierenden Exone umfassenden Sequenz des SP-A1-Gens (3.104 bp) beziehungsweise des SP-A2-Gens (3.090 bp) amplifiziert. Die voramplifizierten Sequenzen dienten jeweils als template (DNA-Matrize) zur Amplifikation der Exonsequenzen in den internen PCRs. Die für ein Exon spezifischen Primer diskriminieren nicht SP-A1 von SP-A2. Als optimale Verdünnung des externen PCR-Produkts in der internen PCR wurde 1:50.000 bei Anwendung von 25 Reaktionszyklen ermittelt. Von der externen PCR wurde unter sterilen Bedingungen 1 µl entnommen, mit 999 µl H2O verdünnt und bei minus 20 °C aufbewahrt. 1 µl je Reaktionsansatz wurde als DNA in der internen PCR eingesetzt.


30

Abbildung 3-1: Getrennte Amplifikation der SP-A-Gene mittels nested PCR


31

3.5.2 Berechnung geeigneter Primersequenzen

Die Schmelztemperatur (Tm), bei der Oligonukleotide von komplementärer DNA dissoziieren, wurde nach Gleichung 3-1 berechnet. Multiple annealing tests nach Hillier und Green (1991) dienten der Selektion spezifischer Primersequenzen. Diese wurden mit dem FastA-Algorithmus nach Pearson und Libman (1988) auf Homologie zu den in der GenBank gespeicherten Sequenzen von Primaten geprüft. Primer mit über 94 % Analogie zu einem anderen Gen wurden ausgeschlossen. Bei Identität am 3‘-Ende wurden nur 85 % Analogie akzeptiert.

Gleichung 3-1: Schmelztemperatur von DNA-Oligomeren (nach Rychlik et al. 1990)
Legende: DeltaH ist die Enthalpie und DeltaS die Entropie der Helixbildung. R ist die Gaskonstante (1.987 cal/°C/mol).
c ist die Primer- und [K+] die Kaliumionenkonzentration

Einige Sequenzen wurden manuell modifiziert. Um alle Primer vergleichen zu können, wurde der Schätzung der Hybridisierungstemperatur ( T a) eines Primerpaars die vom Hersteller nach Gleichung 3-2 berechnete Schmelztemperatur (Tm) zugrundegelegt.

Gleichung 3-2: Schmelztemperatur von DNA-Oligomeren (vereinfacht nach Newton und Graham 1997)
Legende: n ist die Zahl der Nukleotide und (%G+C) der Anteil der DNA-Basen Guanin und Cytosin

Angrenzend an jedes Exon wurden innerhalb der Introne Paare interner Primer konzipiert, die Tabelle 4-1 im Ergebnisteil zeigt. Auf ihre Eignung geprüft wurden Sequenzen von 18 - 22 bp mit einem G+C-Gehalt von 40 - 55 % und G oder C als 3‘-terminalem Nukleotid. Tm wurde zwischen 50 - 65 °C gewählt mit weniger als 2 °C Differenz zwischen Tm(forward-Primer) und Tm(reverse-Primer). In den nichttranslatierten Bereichen ober- und unterhalb der kodierenden Gensequenz wurden beide SP-A-Gene diskriminierend e Primer identifiziert, die sich am 3‘-Ende wie in Tabelle 3-12 zu sehen in mindestens zwei Nukleotiden unterscheiden und so zwischen SP-A1- und SP-A2-Sequenzen diskriminieren.


32

Tabelle 3-12: Getestete diskriminierende Primer
Miteinander amplifizierende Primer sind unterstrichen, Einzelheiten siehe in Abschnitt 4.1.2 .

Bezeichnung

Nukleotide

Position

DNA-Basensequenz (vom 5‘- zum 3‘-Ende)

T m [°C]

SPA-1-FW-01

911-932

vor Exon D

GTCGCCCGCCCTGCCTCGTCGG

73,5

SPA-1-FW-02

916-932

vor Exon D

CCGCCCTGCCTCGTCGG

62,0

SPA-1-FW-04

913-929

vor Exon D

GTCGCCCGCCCTGCCTCGT

66,0

SPA-1-FW-05

131-151

vor Exon A

AAATGCTGCGTCTACCTTACC

50,6

SPA-1-FW-07

917-933

vor Exon D

CGCCCTGCCTCGTCGGG

62,0

SPA-1-FW-08

555-579

Exon B

CTGAAAAGAAAGTAACACAGCAGGG

60,3

SPA-1-FW-09

603-628

nach Exon B

GTGAGTGAGTGACCTGACTAATAGCC

63,8

SPA-1-FW-10

442-466

vor Exon B

AGAGAACAGACCCCAAAAAGAAAGG

60,3

SPA-1-FW-11

553-577

Exon B

GCCTGAAAAGAAAGTAACACAGCAG

55,6

SPA-1-FW-12

550-574

Exon B

GGAGCCTGAAAAGAAAGTAACACAG

54,7

SPA-1-FW-13

548-572

Exon B

TTGGAGCCTGAAAAGAAAGTAACAC

55,1

SPA-1-RE-01

3381-3361

UT von Exon 4

GAGGCCGACAAGGAGAGCGTC

59,8

SPA-1-RE-05

3406-3387

UT von Exon 4

ACAGACCAAGTGGAGCCTCA

51,8

SPA-1-RE-06

3394-3376

UT von Exon 4

GAGCCTCAGGATGGAGGCC

55,8

SPA-1-RE-07

3470-3452

UT von Exon 4

TAAGGGTGCCTCCAGTCCC

53,7

SPA-1-RE-08

3416-3392

UT von Exon 4

CTAGCATCTCACAGACCAAGTGGAG

56,1

SPA-2-FW-01

940-960

vor Exon D

CTCGCCCGCCCTGCCTCTCGC

70,4

SPA-2-FW-02

944-960

vor Exon D

CCCGCCCTGCCTCTCGC

61,2

SPA-2-FW-03

578-599

Exon B

CCTGAAAAGAAGGTAACTGGGC

53,8

SPA-2-FW-04

577-597

Exon B

GCCTGAAAAGAAGGTAACTGG

50,1

SPA-2-RE-01

3395-3373

UT von Exon 4

GAAACTGAAGGCCAGACAGGATC

55,8

SPA-2-RE-02

3403-3385

UT von Exon 4

TGGGGATGGAAACTGAAGG

52,0

SPA-2-RE-03

3403-3386

UT von Exon 4

TGGGGATGGAAACTGAAG

47,6

3.5.3 Optimierung der Reaktionsbedingungen

Primer wurden in Konzentrationen von 0,1 µmol/l, Nukleotide in einer Konzentration von 200 µmol/l eingesetzt. Magnesiumionenkonzentration [Mg++] und Hybridisierungstemperatur (Ta) wurden in parallelen Reaktionen aufeinander abgestimmt. Bei der touchdown-Technik wurde Ta zur Erhöhung der Spezifität im ersten Zyklus etwa 5 - 15 °C über der Idealtemperatur gewählt und in den folgenden 10 - 20 Zyklen um jeweils ½ - 1 °C herabgesetzt ( Don et al. 1991). Zur Durchführung eines hot starts ( d‘Áquila et al. 1991) wurde eine DNA-Polymerase eingesetzt, die erst nach dem Denaturierungsschritt aktiv wird und so die DNA-Synthese an den vor dem Reaktionsstart entstandenen, unspezifischen Primerbindungen verhindert. Additiva wurden dem Reaktionspuffer in Einzelversuchen zugesetzt. Fehlerkorrigierende ( proof reading )


33

DNA-Polymerasen mit 3‘rarr5‘-Exonuklease-Aktivität wurden für die Amplifikation längerer DNA-Sequenzen (long template PCR) eingesetzt.

Tabelle 3-13: Universalprimer zur Amplifikation klonierter DNA
1): Position in pCR2.1 ( Mead et al. 1991); 2): Position in pUC19 ( Yanisch-Perron et al. 1985)

Bezeichnung

pCR2.11)

pUC192)

Nukleotidsequenz

T m [°C]

M13(-29)

205-221

481-464

CAGGAAACAGCTATGACC

41,9

M13(-43)

453-431

356-378

AGGGTTTTCCCAGTCACGACGTT

59,7

Zur Amplifikation oder Sequenzierung klonierter DNA aus den isolierten Plasmiden können die in beiden Vektoren integrierten Universalprimersequenzen M13 dienen. Tabelle 3-13 zeigt die nach der Entfernung von der multiplen Klonierungsstelle (multiple cloning site) als M13(-29) und M13(-43) bezeichneten Sequenzen. Die entsprechende PCR erforderte 25 Zyklen mit einer Magnesiumionenkonzentration [Mg++] = 1,5 mmol/l und Hybridisierung bei Ta = 48 °C.

3.6 DNA-Sequenzierung

Die DNA wurde nach der Kettenterminationsmethode (chain termination method, Sanger et al. 1977) sequenziert. Jede Probe wurde in vier separaten zyklischen Sequenzierreaktionen ( cycle sequencing reactions , Murray 1989), bei denen im Gegensatz zur PCR nur ein Primer eingesetzt wird, amplifiziert. Da jeweils eine der vier Desoxynukleotidfraktionen teilweise durch Didesoxynukleotide ersetzt wird, bricht die Synthese der DNA-Sequenzen früher oder später bei der entsprechenden Base ab. Die DNA-Einzelstränge wurden während der elektrophoretischen Auftrennung in einem denaturierenden Gel direkt auf eine Membran übertragen ( direct blotting , Beck et al. 1984) und anschließend durch eine enzymatische Farbreaktion sichtbar gemacht.

3.6.1 cycle sequencing reactions

Für dGTP wurde das analoge dITP eingesetzt, wie Tabelle 3-14 zeigt. Aus je 1,3 µl (10×)-Reaktionspuffer und dITP-Mix wurden mit jeder DNA-Probe 13 µl Reaktionsgemisch mit einer Primerkonzentration von 1,5 pmol/µl und 6 Units Enzym vorbereitet. 3,1 µl Reaktionsgemisch wurden zu 1 µl eines ddNTP-Mix gegeben und mit einem Tropfen Mineralöl überschichtet, bevor die in Protokoll 3-1 gezeigte cycle sequencing reaction gestartet wurde. Die amplifizierten Sequenzen wurden mit 2,7 µl Stoppmix 5 Minuten auf 95 °C erhitzt, auf Eis


34

gekühlt und nebeneinander auf das denaturierende Harnstoffgel aufgetragen.

Tabelle 3-14: Lösungen für die cycle sequencing reaction
BioCycle Sequencing Kit von GATC in Konstanz (BRD) außer 1): Amersham in Cleveland, Ohio (USA).
ddNTP steht für jeweils eins der vier Didesoxynukleotide, die durch eine Biotinylierung markiert sind.

Lösung

Konzentration

der Bestandteile

(10×)-Reaktionspuffer

274 mmol/l
68,6 mmol/l
200 mmol/l
27,4 mmol/l

TrisHCl (pH 7,5)
Trinatriumcitrat
NaCl
MnCl2

dITP-Mix

(unbekannt)

dATP, dCTP, dITP, dTTP

Enzym1)

32 Units/µl

Thermo Sequenase®-DNA-Polymerase

ddNTP-Mix

1,25 µmol/l
50 mmol/l
je 125 µmol/l

ddNTP
NaCl
dATP, dCTP, dGTP, dTTP

Stopp-Mix

99%
0,1%
5 mmol/l

Formamid
Bromphenolblau
Na2EDTA

Protokoll 3-1: cycle sequencing reaction

Reaktionsschritt

Temperatur

Dauer

 

initiale Denaturierung

95 °C

180 Sekunden

 

Denaturierung

95 °C

30 Sekunden

 

Hybridisierung

48 °C

25 Sekunden

60 Zyklen

Extension

60 °C

30 Sekunden

 

finale Extension

72 °C

180 Sekunden

 

3.6.2 direct blotting

Zwischen speziell geschliffenen Glasplatten, die zuvor mit 150 µl bindendem Silan beschichtet worden waren, wurde ein denaturierendes 4 %iges Polyacrylamidgel von 22 × 32 × 0,019 cm mit 50 % Harnstoffanteil gegossen. 21,65 ml Harnstoffreagenz aus Tabelle 3-15 und 3,35 ml Acrylamidlösung wurden gemischt und mit 110 µl APS und 25 µl TEMED polymerisiert. Parafilm ® verhinderte das Austrocknen der Gelkante. Nach drei Gelen wurden die Platten 1 h in 0,5-molarer NaOH-Lösung gereinigt. Von jeder Sequenzreaktion wurden 3 - 4 µl aufgetragen und nach einer langsamen Einlaufphase von 5 Minuten bei 500 V mit einer konstanten Leistung von 30 W bei einer angelegten Spannung von 1.400 - 1.800 V elektrophoretisch aufgetrennt. Die Membran wurde tangenzial an der Gelkante durch einen Schrittmotor vorangetrieben und nach der Elektrophorese mit Heißluft getrocknet. Vor der weiteren Entwicklung wurde die DNA


35

durch dreiminütiges cross-linking unter UV-Licht auf der Membran fixiert.

Tabelle 3-15: Lösungen für das denaturierende Harnstoffgel
1): BioCycle Sequencing Kit von GATC in Konstanz (BRD)

Lösung

Konzentration

der Bestandteile

(10×)-TBE-Puffer
(pH 8,0 bei 25 °C)

154,5 g
26,2 g
9,0 g
810,0 g

Tris-Base
Borsäure
Na2EDTA
H2O

Harnstoffreagenz

56,9 g
11,4 ml
ad 100 ml

Harnstoff
(10×)-TBE-Puffer
H2O

Acrylamidlösung

30 %

Acrylamid-(30:0,8)-Bisacrylamidlösung1)

bindendes Silan

50 µl
30 µl
9,92 ml

3-Methacryloxypropyltrimethoxysilan
Essigsäure (99,9 %)
Ethanol (95 %)

3.6.3 Farbreaktion

Tabelle 3-16: Lösungen zum Nachweis der biotinylierten DNA auf der Membran
1): GATC GmbH in Konstanz; 2): Boehringer in Mannheim; 3): Bio-Rad Laboratories GmbH in München

Lösung

Konzentration

der Bestandteile

Maleinsäurepuffer
(pH 7,5 bei 20 °C)

12,61 g/l
8,77 g/l
8 g/l

Maleinsäure
NaCl
NaOH

Reaktionspuffer
(pH 9,5 bei 20 °C)

5,84 g/l
0,83 g/l
11,58 g/l

NaCl
TrisHCl
Tris-Base

(10×)-blocking reagent

10 g
90 ml

blocking powder2)
Maleinsäurepuffer

SA-AP-Lösung

1:7.500

Streptavidin-Alkalische Phosphatase-Konjugat1)

NBT-Lösung

300 mg
7 ml
3 ml

Nitrotetrazoliumblauchlorid3)
N, N-Dimethylformamid
H2O

BCIP-Lösung

150 mg
10 ml

5-Brom-4-chlor-3-indolylphosphat-p-toluidinsalz3)
N, N-Dimethylformamid

Der pH-Wert des in Tabelle 3-16 gezeigten Maleinsäurepuffers wurde mit NaOH-Lösung exakt titriert. Das mit Maleinsäurepuffer verdünnte (10×)-blocking reagent blockiert unspezifische Bindungsstellen. In der Hybridisiertrommel wurde die Membran mit 150 ml Maleinsäurepuffer 5 Minuten equilibriert. Nach 45 Minuten Inkubation mit 80 ml blocking reagent wurde mit 4 µl SA-AP-Lösung in 20 ml blocking reagent 45 Minuten inkubiert. Nach 3 Waschungen für


36

10 Minuten mit 150 ml Maleinsäurepuffer wurde der pH-Wert 5 Minuten mit 150 ml Reaktionspuffer umgestellt, bevor 227 µl NBT und 300 µl BCIP in 20 ml Reaktionspuffer aufgetragen wurden. Spätestens nach 24 h wurde die Farbreaktion durch Waschen mit H2O und Trocknen gestoppt.

3.7 DNA-Restriktion

Mit der GCG -Software wurde in den SP-A-Genen nach den Erkennungssequenzen von 217 verschiedenen Restriktionsendonukleasen gesucht. Zum Nachweis eines beschriebenen Restriktionsfragmentlängenpolymorphismus (RFLP) wurde die DNA mit 5 Units Enzym für 2 Stunden inkubiert. Im Falle einer kombinierten Restriktion mit zwei Enzymen, die sich im in Tabelle 3-17 angegebenen Temperaturoptimum unterscheiden, wurde zunächst mit dem Enzym bei der niedrigen Temperatur inkubiert. Nach Deaktivierung des ersten Enzyms bei 80 °C für 15 Minuten wurde mit dem anderen Enzym bei höherer Temperatur inkubiert. PCR-Amplifikate ohne Nebenprodukte wurden zum Teil unter Verzicht auf die Aufreinigung durch Hinzufügen entsprechender Volumina an Magnesiumlösung, Puffer und H2O auf die nötigen Pufferbedingungen gebracht und mit 5 Units Enzym inkubiert. Plasmid-DNA wurde vor der gelelektrophoretischen Auftrennung mit RNase inkubiert.

Tabelle 3-17: Restriktionsendonukleasen
Gezeigt werden die Schnittstelle darr innerhalb der palindromischen Erkennungssequenz, die gelieferte Konzentration, die optimale Temperatur und der verwendete, vom Hersteller mitgelieferte Restriktionspuffer.

Enzym

Palindrom

Konzentration

Optimum

Puffer

ApaI

GGGCCdarrC

10 Units/µl

25°C

NEB 4

BamHI

GdarrGATCC

20 Units/µl

37°C

NEB for Bam

EcoRI

GdarrAATTC

20 Units/µl

37°C

NEB for Eco

HindIII

AdarrAGCTT

20 Units/µl

37°C

NEB 2

NcoI

CdarrCATGG

10 Units/µl

37°C

NEB 4

NdeI

CAdarrTATG

20 Units/µl

37°C

NEB 4

PstI

CTGCAdarrG

20 Units/µl

37°C

NEB 3

RsaI

GTdarrAC

10 Units/µl

37°C

NEB 1

SmaI

CCCdarrGGG

10 Units/µl

25°C

NEB 4

StuI

AGGdarrCCT

10 Units/µl

37°C

NEB 2


37

3.8 DNA-Klonierung

Zur Insertion amplifizierter DNA in einen Vektor wurde dieser mit dem entsprechenden PCR-Produkt ligiert. In der internen PCR amplifizierte Sequenzen einzelner Exone, die Muster bestimmter allelischer Varianten repräsentieren, wurden im pCR2.1-Vektor ( Mead et al. 1991) kloniert. Der Vektor liegt als lineare DNA mit beiderseits überhängendem 5‘-Thymidin vor. Das PCR-Produkt, an das die Taq-DNA-Polymerase beiderseits ein überhängendes 3‘-Adenosin synthetisiert, schließt die DNA zu einem ringförmigen Plasmid. Amplifizierte Sequenzen aus der externen PCR, die auffällige Haplotypen der gesamten kodierenden Sequenz eines SP-A-Gens enthalten, wurden im Vektor pUC19 ( Yanisch-Perron et al. 1985), der bereits als ringförmiges Plasmid vorliegt, kloniert. Mit Hilfe von Endonukleasen wurde der Vektor geöffnet und an den Enden der amplifizierten Gensequenz komplementäre Schnittstellen geschaffen, die die Ligation von Vektor und Plasmid ermöglichen.

Zur Transformation mit Plasmid-DNA wurden Escherichia coli des Stammes NM 522 (Serogruppe K12) verwendet. Sie waren durch Vorbehandlung auf Eis mit MgCl2 und CaCl2 in “kompetente Zellen“ ( Himeno et al. 1984) verwandelt worden, die in der Lage sind, Plasmid-DNA aus ihrer Umgebung aufzunehmen. Das Einbringen fremder DNA in einen Mikroorganismus und die Anzucht und Selektion dieser gentechnisch veränderten Organismen (GVOs) stellen einen genehmigungspflichtigen Eingriff im Sinne des Gentechnikgesetzes (GenG) dar. Die Arbeiten wurden in einem Genlabor der Sicherheitsstufe 1 durchgeführt und bei der zuständigen Behörde angemeldet. Die transformierten Klone wurden gegen Ampicillin, im Falle der Transformation mit pCR2.1 zusätzlich gegen Kanamycin, selektiert. Klone mit eingefügtem PCR-Produkt wurden anhand fehlender Laktaseaktivität identifiziert.

3.8.1 Insertion amplifizierter DNA in einen Vektor

5 µl PCR-Produkt wurden mit je 1 µl T4-DNA-Ligase, (10×)-Ligationspuffer und gelöstem Vektor pCR2.1 aus Tabelle 3-18 und 2 µl H2O bei 14 °C etwa 18 Stunden inkubiert. Zur Ligation mit pUC19 wurden PCR-Produkt und Vektor mittels DNA-Restriktion präpariert und das PCR-Produkt mittels Gelexzision isoliert. Das Plasmid wurde in 1/10 Volumen 3-molarer Natriumacetatlösung (pH 4,8) und 2 Volumina 96 %igem Ethanol gefällt (30 Minuten bei - 20 °C), zentrifugiert (5 Minuten mit 13.000 Upm) und als getrocknetes Pellet in H2O gelöst. Etwa 20 ng Vektor und PCR-Produkt wurden gemischt und mit 1 µl T4-DNA-Ligase und 2 µl (10×)-Ligationspuffer in 20 µl Volumen 18 Stunden bei 14 °C inkubiert. Die DNA-


38

Konzentration war anhand der Ethidiumbromidfluoreszenz im Gel im Vergleich mit Proben bekannter Konzentration geschätzt worden (ethidium bromide dot quantitation).

Tabelle 3-18: Reagenzien zur Insertion von DNA in einen Vektor
Hersteller: New England Biolabs in Beverly (USA) außer 1): Invitrogen Corporation in Carlsbad, California

Reagenz

Konzentration

der Bestandteile

Ligase

4 Units/µl

T4-DNA-Ligase

(10×)-Ligationspuffer

500 mmol/l
100 mmol/l
100 mmol/l
10 mmol/l
500 µg/ml

TrisHCl (pH 7,8 bei 25°C)
MgCl2
DTT
ATP
BSA

pCR2.1 1) ( Mead et al. 1991)

25 ng/µl

lineare Doppelstrang-DNA

pUC19 ( Yanisch-Perron et al. 1985)

40 ng/µl

Plasmid-DNA

3.8.2 Transformation mit Plasmid-DNA

Die kompetenten Zellen wurden in einer Suspension mit Glyzerin ( Tabelle 3-19 ) bei - 70 °C in Portionen von 100 µl gelagert. Sie wurden ½ Stunde auf Eis mit den ligierten Plasmiden sanft suspendiert. Zur Aufnahme der angelagerten Plasmide wurden die Zellen 2 Minuten bei 42 °C inkubiert und einige Minuten auf Eis gestellt. Zur Expression der Antibiotikaresistenzgene wurden sie in 1,5 ml LB-Medium 1 ½ Stunden bei 37 °C inkubiert.

Tabelle 3-19: Reagenzien zur Transformation kompetenter Zellen (GibcoBRL Life Technologies, Paisley, UK)

Reagenz

Konzentration

der Bestandteile

Kompetente Zellen
(E. coli K12 strain NM 522)

88 µl
12 µl

Zellen in 100 mmol/l CaCl2; 10 mmol/l Tris-Base
Glyzerin

LB-Medium
(Lennox L Broth Base; pH 7,0)

10,0 g/l
5,0 g/l
5,5 g/l

SELECT Pepton 140
Hefe Extrakt
NaCl

3.8.3 Anzucht und Selektion

Bei Zugabe des als Induktor wirksamen IPTG wird ein unvollständiges beta-Galactosidase-Protein exprimiert, das mit dem vom Vektor kodierten Teil der beta-Galactosidase ein aktives Enzym bildet (alpha-Komplementation auf Proteinebene). Die Hydrolyse von X-Gal setzt ein blaugrünes Indoxylderivat frei. Die mit der in der PCR amplifizierten DNA transformierten Klone bleiben


39

weiß, da die Insertion des DNA-Doppelstrangs in die Klonierungsstelle (cloning site) die Expression des komplementierenden beta-Galactosidase-Fragments unterbricht.

Tabelle 3-20: Reagenzien zur Anzucht und Selektion der Klone (GibcoBRL Life Technologies, Paisley, Scotland)

Reagenz

Konzentration

der Bestandteile

LB-Agar

10 g/l
5 g/l
5 g/l
12 g/l

SELECT Pepton 140
Hefe Extrakt
NaCl
Agar

Ampicillin

100 mg/ml

Binotal®

Kanamycin

125 mg/ml

Kanamycinsulfat

IPTG-Lösung

500 mmol/l

Isopropyl-beta-D-thiogalactopyranosid

X-Gal-Lösung

40 mg/ml

5-Brom-4-chlor-3-indolyl-beta-D-galactosid in N, N-Dimethylformamid

250 ml LB-Agar wurden autoklaviert und nach Zugabe von je 100 µl der in Tabelle 3-20 gezeigten Antibiotika und je 250 µl IPTG und X-Gal auf zehn Petrischalen verteilt. Auf den abgekühlten Agarplatten wurden jeweils 100 µl der transformierten Zellkulturen mit einem Drigalskispatel verstrichen. Nach Inkubation bei 37 °C über Nacht wurden weiße Kolonien auf eine Agarplatte überimpft und in je 1,5 ml LB-Medium mit Antibiotikazusatz kultiviert. Nach Inkubation bei 37 °C über Nacht wurden die Agarplatten mit den selektierten Kolonien bei 4°C zur erneuten Anzucht aufbewahrt und die Kulturen zur Isolation der Plasmid-DNA verwendet.

3.9 Statistische Auswertung der DNA-Sequenzen

Die DNA-Sequenzen wurden mit Hilfe der WISCONSIN PACKAGE®-Software (GCG Version 9.0) der Genetics Computer Group in Madison, Wisconsin (USA) bearbeitet. Die Numerierung der Nukleotide richtete sich nach den in der “GenBank“ des National Center for Biotechnology Information, Rockville Pike, Bethesda (USA) veröffentlichten, genomischen Sequenzen der SP-A-Gene. M30838 ( White et al. 1985) ist die später (wie in Abschnitt 5.1.4 erläutert) korrigierte Sequenz des Wildtypallels 6a2 (SP-A1) und M68519 ( Katyal und Singh 1992) die Sequenz des Wildtypallels 1a0 (SP-A2). Alle Polymorphismen wurde entsprechend den jüngsten Empfehlungen der Nomenclature Working Group ( den Dunnen und Antonarakis 2000) beschrieben. Dabei werden die Aminosäuren beginnend vom Methionin, das vom Startcodon kodiert wird, numeriert. Dies entspricht den Veröffentlichungen der Arbeitsgruppe um J. Floros, bei denen die Signalsequenz die Aminosäuren 1 - 20 umfasst und die Glutaminsäure am aminoterminalen Ende des prozessierten Peptids als Aminosäure 21 (21Glu) bezeichnet wird.


40

Die Arbeitsgruppe um F. X. McCormack bezeichnet in ihren Veröffentlichungen die Aminosäure am aminoterminalen Ende des prozessierten Peptids als erste (1Glu). Die “mannosebindende“ Aminosäure 215Glu ist daher bei McCormack Aminosäure 195.

Die bei den statistischen Berechnungen verwendeten utility programs for analysis of genetic linkage® ( Ott 1992) sind jeweils in Klammern angegeben. Zu den Häufigkeiten p und q einer Wildtypsequenz und ihrer allelischen Variante und der Proportion Heterozygoter h wurden die 95 %-Clopper-Pearson-Konfidenzgrenzen aus den Quantilen der F-Verteilung bestimmt (BINOM Version 1.76). Der Heterozygotiegrad, also die nach dem Hardy-Weinberg-Gesetz erwartete Proportion Heterozygoter, wurde als unbiased estimation (Het) zusammen mit dem Gehalt an Polymorphismusinformation (PIC) nach Gleichung 3-3 aus den Zahlen der beobachteten Allele bestimmt (HET Version 1.80).

Gleichung 3-3: Formeln zur Berechnung von Heterozygotiegrad und PIC ( Ott 1992)
a: Zahl der verschiedenen Allele, n: Gesamtzahl beobachteter Allele, qi: Häufigkeit des i-ten Allels

Die Konkordanz der Verteilung der beobachteten Genotypen mit dem Hardy-Weinberg-Gesetz wurde mit Hilfe des Chi-Quadrat-Tests als Wahrscheinlichkeit P(chi12>chi2) errechnet, mit der die Prüfgröße überschritten wird. Fällt die Irrtumswahrscheinlichkeit unter ein Signifikanzniveau (gewöhnlich alpha < 0,05), befinden sich die Genotypen nicht im Hardy-Weinberg-Gleichgewicht (HWE Version 1.05). Die Häufigkeit der Haplotypen wurde nach der maximum likelihood-Methode mit 50 Iterationen aus der Zahl der beobachteten Genotypen unter Annahme der Kopplung beider SP-A-Gene geschätzt (ASSOCIATE Version 2.35).

In Subpopulationen voneinander abweichende Frequenzen wurden in einer 2×2-Kontingenztafel mit einem Freiheitsgrad im Chi-Quadrat-Test auf Signifikanz getestet (CONTING Version 2.71). Die Wahrscheinlichkeit P(chi12>chi2) entspricht der Irrtumswahrscheinlichkeit alpha. Der einseitige, exakte Test nach Fisher (2BY2 Version 1.50) wurde angewandt, wenn eine der Feldhäufigkeiten Null, zwei kleiner als fünf oder n < 25 war. Der erforderliche Stichprobenumfang n‘ zum Test einer beobachteten gegen eine vorgegebene Proportion und die Umfänge n1 & n2 zum Vergleich zweier gleich großer Populationen wurden im Vorzeichentest von Lorenz ( Bock 1998) für eine power von 1 - beta ge 80 % mit Irrtumswahrscheinlichkeit alpha < 5% errechnet (SAMPSI Version 6.0 der Stata Corporation, Texas, USA).


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiML DTD Version 2.0
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Fri Sep 21 13:56:41 2001