Scholz, Dietmar: Analyse der Surfaktantprotein A-Gene bei Patienten mit Verdacht auf einen Surfaktantproteindefekt

41

Kapitel 4. Ergebnisse

Es wurde eine nested PCR zur Isolation und Amplifikation der SP-A-Gensequenzen etabliert. Bei der Analyse der SP-A-Gensequenzen von vierzehn Patienten mit Verdacht auf Defekt eines Surfaktantproteins wurden zwei “stille“ Einzelbasensubstitutionen im SP-A1-Gen entdeckt, die neue Restriktionsfragmentlängenpolymorphismen ( RFLP ) definieren. Ein bisher nur aus dem SP-A1-Gen bekannter Polymorphismus mit Aminosäureaustausch wurde erstmals im SP-A2-Gen belegt. Bei Berücksichtigung der Kopplung aller Polymorphismen war die Definition fünf neuer Allele möglich. Zur Suche (screening) nach weiteren Allelen wurden die beobachteten Varianten als Muster-DNA kloniert und zusammen mit DNA-Proben einer PCR-SSCP-Analyse zur Detektion des Einzelstrangkonformationspolymorphismus ( single strand conformation polymorphism) unterworfen. Eine Häufung bestimmter Varianten konnte bei der im Verhältnis zur genetischen Variabilität geringen Zahl von DNA-Proben nicht belegt werden.

4.1 Isolation und Amplifikation der SP-A-Gensequenzen

Interne Primer und Reaktionsbedingungen zur Amplifikation der einzelnen Exone, welche DNA-Abschnitte geeigneter Länge zur Sequenzierung oder SSCP-Analyse liefern, wurden experimentell ermittelt. Externe Primer und Reaktionsbedingungen zur Isolierung beider SP-A-Gene wurden ebenfalls experimentell optimiert und auf ihre Spezifität geprüft.

4.1.1 Interne Primer und Reaktionsbedingungen

Protokoll 4-1: Thermocycling der internen PCR

Reaktionsschritt

Temperatur

Dauer

 

initiale Denaturierung

95 °C

180 Sekunden

 

Denaturierung

94 °C

30 Sekunden

 

Hybridisierung

Ta

25 Sekunden

25 Zyklen

Extension

72 °C

30 Sekunden

 

finale Extension

72 °C

180 Sekunden

 

Die Primer zur PCR- SSCP -Analyse wurden möglichst nah an die Spleißregion (splicing consensus site) positioniert, um variable Intronsequenzen nicht mit zu amplifizieren. Die Primer zur DNA- Seq uenzierung mussten 60 bp vor dem Exon beginnen, da der erste DNA-Abschnitt,


42

der vor dem Farbstoff das Gel verlässt, im hier angewandten direct blotting -Verfahren nicht detektiert werden kann. Variable Regionen innerhalb der Introne wurden ausgeschlossen. Für das mit 75 bp als SSCP-Fragment ohne angrenzende Intronsequenzen zu kurze Exon 3 wurde nur ein Primerpaarfür beide Anwendungen definiert. In der internen PCR wurden jeweils 1 µl DNA oder verdünntes PCR-Produkt in 50 µl Reaktionsgemisch mit drei Tropfen Mineralöl (etwa 55 µl) überschichtet und im Thermocycler nach Protokoll 4-1 zur Reaktion gebracht. Tabelle 4-1 zeigt die optimalen Reaktionsbedingungen für die ausgewählten Primerpaare.

Tabelle 4-1: Primer und Amplifikationsbedingungen für die internen Polymerasekettenreaktionen
Legende: EX- bezeichnet das amplifizierte Exon, -SSCP die Primerpaare für die PCR-SSCP-Analyse, -Sequenz die Primerpaare für die Gewinnung von Amplifikaten zur DNA-Sequenzierung.

Bezeichnung

Position
SP-A1

im Gen
SP-A2

DNA-Basensequenz
(vom 5‘-Ende zum 3‘ Ende)

T m
[°C]

T a
[°C]

( Mg ++)
[mmol/l]

SPA-EX1-FW2

994-1016

1021-1043

AGATGGGCTCACGGCCATCCCTC

65,9

EX1

-SSCP

SPA-EX1-RE2

1241-1218

1268-1245

AGGGTGGGGTCTGCAGCACAGTAC

62,2

64

1,2

SPA-EX1-FW3

945-964

971-990

TTCCTGAGTCCTGACAGAGC

48,9

EX1

-Sequenz

SPA-EX1-RE3

1279-1261

1307-1289

AGATGGGCCTCCTGAAAAG

50,7

61

1,7

SPA-EX2-FW2

1508-1528

1528-1548

ATCCATGTCTCTTTTCTCTGC

55,9

EX2

-SSCP

SPA-EX2-RE

1693-1674

1712-1693

CTGTGCCCATGTTTCCACTG

53,6

61

1,5

SPA-EX2-FW

1451-1470

1471-1490

GATAATGGGCATCGAGTCTC

48,5

EX2

-Sequenz

SPA-EX2-RE2

1775-1757

1793-1775

CTTAGGTTGAGCCAAATGC

47,5

61

2,0

SPA-EX3-FW

2313-2331

2333-2351

TTCCAGGATTGCAGATGGC

53,2

EX3

 

SPA-EX3-RE

2533-2514

2555-2536

GAGGGGAATTTGTGGGAAAC

52,3

62

2,3

SPA-EX4-FW

2915-2934

2927-2946

ACAAAGTGGTCAGTGGCCTG

52,3

EX4

-SSCP

SPA-EX4-RE2

3354-3334

3366-3346

GTCCCATGGCCTAAATGCCTC

61,8

61

1,7

SPA-EX4-FW3

2874-2891

2886-2903

ATCTGGTAGCAGAGACCC

42,9

EX4

-Sequenz

SPA-EX4 RE

3413-3395

3427-3409

GCATCTCACAGACCAAGTG

45,2

61

2,2

4.1.2 Externe Primer und Reaktionsbedingungen

Die diskriminierend en Primer wurden in die genetisch stabilere 3‘-UT-Region von Exon 4 und die unmittelbare Umgebung der Exone A - D plaziert. Mogliche forward-Primer wurden unmittelbar vor Exon A, in und um Exon B sowie 100 bp vor Exon D identifiziert, reverse-Primer 150 bp nach dem Stoppcodon ( Tabelle 3-12 ). Kombinationen der Primer SPA-1-FW-01 mit SPA-1-RE-01, SPA-2-FW-01 mit SPA-2-RE-01, SPA-2-FW-02 mit SPA-2-RE-02, SPA-1-FW-05 mit SPA-1-RE-05, SPA-1-FW-04 mit SPA-1-RE-01, -05, -06 oder -07 und SPA-1-FW-11, - 12 oder -13 mit SPA-1-RE-8 amplifizierten DNA bei ( Mg ++) = 2 - 2,5 mmol/l.


43

Abbildung 4-1: Optimierung der externen PCR durch Modifikation des Reaktionspuffers
DNA-Qualität: frisch isoliert in Spur 1 und 2; gefrorene Proben in Spur 3 - 14.
Primer: SPA-1-FW-01/RE-01 in Spur 1, 3, 5 und 7-10; SPA-2-FW-01/RE-01 in Spur 2, 4, 6 und 11 - 14.
Magnesium[Mg++]: 1 mmol/l in Spur 10 + 14; 1,5 mmol/l in 9 + 13; 2 mmol/l in 8 + 12; 2,5 mmol/l in 7 + 11.
Ammoniumsulfat: [(NH4)2SO4] = 5 mmol/l in Spur 5 und 6, [(NH4)2SO4] = 10 mmol/l in Spur 3 und 4.

Abbildung 4-2: Amplifikation der SP-A-Gene durch Polymerasen mit und ohne fehlerkorrigierende Aktivität
Primer: SPA-1-FW-01/RE-01 in Spur 1-4 und 9-12; SPA-2-FW-01/RE-01 in Spur 5-8 und 13-14.
Magnesium [Mg++]: 2 mmol/l in 1+5+9+13; 3 mmol/l in 2+6+10+14; 4 mmol/l in 3+7+11; 5 mmol/l in 4+8+12.

Denaturierende Additiva sollten durch unspezifische Anlagerung (misannealing) der Primer


44

entstandene Nebenprodukte verringern ( Newton und Graham 1997). Frisch isolierte DNA erzielte den gleichen Effekt in Abbildung 4-1 . Enzyme mit 3‘rarr5‘-Exonuklease-Aktivität wie Pwo-DNA-Polymerase erhöhten gegenüber Polymerasen ohne fehlerkorrigierende ( proof reading ) Aktivität die Ausbeute der PCR, ohne die Spezifität zu verbessern, wie Abbildung 4-2 zeigt. Auch die touchdown -Technik erhöhte die Spezifität der Primerbindung nur wenig.

Tabelle 4-2: Externe Primer zur Amplifikation der SP-A-Gene (diskriminierende Nukleotide sind unterstrichen)
*: Beim nichtdiskriminierenden Primerpaar ist nur die Position im SP-A1-Gen angegeben, R steht für A und G.

Bezeichnung

Nukleotide

Nukleotidsequenz (vom 5‘-Ende zum 3‘ Ende)

T m [°C]

SPA-1-FW-EXT

534-572

AGGTCGCTGATTTCTTGGAGCCTGAAAAGAAAGTAACAC

71,1

SPA-1-RE-EXT

3637-3606

AAGGAACTGGACCAGATGGGGAATAAGGAGGG

69,7

SPA-2-FW-EXT

560-597

GTCGCTGATTTCTTGGAGCCTGAAAAGAAGGTAACTGG

72,1

SPA-2-RE-EXT

3649-3618

5‘-AAGGAACTGGACCAGATGGGGAATAAGGAAGC

68,5

SPA-FW-EXT

532-570*

TCAGGTCGCTGATTTCTTGGAGCCTGAAAAGAARGTAAC

76,5

SPA-RE-EXT

3658-3625*

CACTGCTGCCATCTGTAAGTGAACGAACTGGACC

71,1

Durch die 5‘-terminale Verlängerung von SPA-1-FW-13 und SPA-2-FW-4 wurden die in Tabelle 4-2 charakterisierten externen, diskriminierend en Primer für SP-A1 und SP-A2 sowie korrespondierende reverse-Primer ermittelt. Bei [Mg++] = 2,2 mmol/l und Ta = 70 °C herrschten optimale Reaktionsbedingungen. Das unspezifische Primerpaar diente Testzwecken. Nach Einbau eines hot start s durch die in Protokoll 4-2 gezeigte initiale Aktivierung der DNA-Polymerase bei 95 °C wurde in 50 Zyklen genug PCR-Produkt zur DNA-Sequenzierung gebildet. Durch RFLP-Analysen mit ApaI und PstI wurde die Identität der amplifizierten Gene anhand der in Abbildung 4-3 gezeigten invarianten Polymorphismen überprüft. Die DNA-Sequenzen in Abbildung 4-4 demonstrieren die klare Isolierung beider Gene in der nested PCR.

Protokoll 4-2: Thermocycling der externen PCR

Reaktionsschritt

Temperatur

Dauer

 

initial

95 °C

540 Sekunden

(Enzymaktivierung)

Denaturierung

94 °C

30 Sekunden

 

Hybridisierung

70 °C

25 Sekunden

50 Zyklen

Extension

74 °C

150 Sekunden

 

final

74 °C

450 Sekunden

(Elongation)

 

 

 

 


45

Abbildung 4-3: Identifizierung der amplifizierten SP-A-Gene durch RFLP -Analyse
Die Größe der Restriktionsfragmente ist in der jeweiligen Spalte unterhalb des Gens angegeben. Das PstI-Fragment von 942 bp wird in einigen Allelen in Fragmente von 729 und 213 bp geschnitten. In Spur SP-A wurde das Produkt aus der PCR mit den nichtdiskriminierenden Primern SPA-FW-EXT und SPA-RE-EXT aufgetragen.

Abbildung 4-4: DNA-Sequenzierung von Exon 2 (Nukleotide 1596_1615 von SP-A1 bzw. 1616_1635 von SP-A2)
Links: SP-A-Exon 2 aus genomischer DNA mit Polymorphismus 1599A>G (Codon 61) und 1611T>C (Codon 65). Rechts: beide Gensequenzen isoliert aus Produkten der externen PCR amplifiziert und getrennt sequenziert.


46

4.2 Analyse der SP-A-Gensequenzen

Die zum (bisher nur im SP-A1-Gen beobachteten) Aminosäureaustausch Val50Leu führende Einzelbasensubstitution 1220G>C wurde erstmals im SP-A2-Gen detektiert. Die neuen Polymorphismen 1162C>T und 3138T>C wurden bei mehreren Patienten im SP-A1-Gen nachgewiesen. Aus den DNA-Sequenzen aller Exone wurden die SP-A1- und SP-A2-Genotypen von 14 Patienten , bei denen nach differentialdiagnostischen Erwägungen der Verdacht auf einen Surfaktantproteindefekt bestand, abgeleitet. Die Häufigkeiten einzelner Polymorphismen wurden aus der Zahl der jeweils beobachteten DNA-Sequenzen berechnet.

4.2.1 Die neuen Polymorphismen 1162C>T und 3138T>C

Bei Patient 7 und Patient 10 wurde der Polymorphismus 1220G>C im SP-A2-Gen detektiert. Die Einzelbasensubstitution führt zum Aminosäureaustausch Val50Leu, der im SP-A1-Gen die häufigste Variante darstellt. Tabelle 4-3 zeigt die Häufigkeit der Variante 50Leu bei den 14 Patienten, deren SP-A2-Gen sequenziert wurde. Bei der in Tabelle 4-4 gezeigten Verteilung der Genotypen ist mit alpha = 0,77 kein Verstoß gegen das Hardy-Weinberg-Gesetz nachweisbar.

Tabelle 4-3: Allelfrequenzen am Genort SP-A2-Codon 50
(In Klammern sind jeweils die 95 %-Clopper-Pearson-Konfidenzgrenzen angegeben)

Allel

Allelfrequenz

n = 28 Allele

1220G (50Val):

p = 92,9 (76,5-99,1) %

26 Allele

1220C (50Leu):

q = 7,1 (0,9-23,5) %

2 Allele

Tabelle 4-4: Genotypfrequenzen am Genort SP-A2-Codon 50
Die Konkordanz P(chi12>chi2) mit dem Hardy-Weinberg-Gesetz beträgt im Chi-Quadrat-Test : P(chi12>chi2) = 77%.

Genotyp

Frequenz (N = 13 Patienten)

[1220G]+[1220G] (50Val/50Val):

84,6 % (P = 11 Patienten)

[1220C]+[1220G] (50Leu/50Val):

15,4 % (H = 2 Patienten)

[1220C]+[1220C] (50Leu/50Leu):

0,0 % (Q = 0 Patienten)

Bei Patient 8, Patient 12 und einem Mitarbeiter wurde in einem Allel des SP-A1-Gens der Polymorphismus 1162C>T in Codon 39, welches weiterhin Histidin kodiert, entdeckt. Die Substitution schafft eine Restriktionsschnittstelle für NcoI. Die RFLP -Analyse aller 31 Patienten


47

detektierte 7 Heterozygote, die in Abbildung 4-5 zu sehen sind. Wie die Familienanalyse in Abbildung 4-6 zeigt, waren beide Elternteile des Mitarbeiters heterozygot für 1162C>T.

Abbildung 4-5: RFLP-Analyse mit NcoI am Genort SP-A1-Codon 39
Heterozygote Träger der Variante 1162C>T sind kursiv gesetzt.

Abbildung 4-6: Familienanalyse am Genort SP-A1-Codon 39 (Amplifikate von SP-A-Exon 1 geschnitten mit NcoI)
ungerade Nummern: aus dem SP-A1-Gen; gerade Nummern aus dem SP-A2-Gen amplifiziert
Spuren 1 & 2: Vater, 3 & 4: Mutter, 5 & 6: Mitarbeiter mit Variante, 7 & 8: Mitarbeiter ohne Variante


48

Der Vergleich der Frequenz der Variante bei Patienten und Mitarbeitern in der Kontingenztafel in Tabelle 4-5 wird im Chi-Quadrat-Test nicht signifikant (alpha = 0,90). Aus der Verteilung der Genotypen in Tabelle 4-6 ergibt sich kein Verstoß gegen das Hardy-Weinberg-Gesetz.

Tabelle 4-5: 2(2-Kontingenztafel mit Häufigkeit der Einzelbasensubstitution am Genort SP-A1-Codon 39
Die Signifikanz beträgt im Chi-Quadrat-Test : P(chi12>chi2) = 0,90.

Allele (n):

Gesamt (72 Allele)

Patientenallele (62)

Mitarbeiterallele (10)

1162C :

64

55

9

Frequenz p:

88,9 (79,3-95,1) %

88,7 (78,1-95,1) %

90,0 (55,5-99,7) %

1162T:

8

7

1

Frequenz q:

11,1 (4,9-20,7) %

11,3 (4,7-21,9) %

10,0 (0,3-44,5) %

Tabelle 4-6: Häufigkeit der beobachteten Genotypen am Genort SP-A1-Codon 39
Die Konkordanz P(chi12>chi2) mit dem Hardy-Weinberg-Gesetz wurde im Chi-Quadrat-Test berechnet.

Genotypen (N):

Gesamt (36)

Patienten (31)

Mitarbeiter (5)

[1162C]+[1162C] (P):

75,0% (28)

74,2% (24)

80,0% (4)

[1162C]+[1162T] (H):

25,0% (8)

25,8% (7)

20,0% (1)

[1162T]+[1162T] (Q):

0,0% (0)

0,0% (0)

0,0% (0)

Konkordanz:

P(chi12>chi2) = 45 %

P(chi12>chi2) = 48 %

P(chi12>chi2) = 80 %

Die in einem Allel des SP-A1-Gens von Patient 15 entdeckte Variante 3138T>C deletiert eine NdeI-Restriktionsstelle. Das betroffene Codon 184 kodiert weiterhin Tyrosin. In der Kontingenztafel in Tabelle 4-7 wird der Vergleich der durch DNA-Sequenzierung (q ap 3,6 %) oder RFLP-Analyse bestimmten Frequenz (q ap 15,9 %) mit alpha = 0,10 annähernd signifikant.

Tabelle 4-7: 2(2-Kontingenztafel n mit Häufigkeit der Einzelbasensubstitution am Genort SP-A1-Codon 184

Allele (n):

Gesamt (72)

Sequenz (28)

RFLP (44)

Patienten (62)

Mitarbeiter (10)

3138T:

64

27

37

54

10

p [%]:

88,9 (79,3-95,1)

96,4 (81,7-99,9)

84,1 (69,9-93,4)

87,1 (76,1-94,3)

100 (74,1-100)

3138C:

8

1

7

8

0

q [%]:

11,1 (4,9-20,7)

3,6 (0,1-18,3)

15,9 (6,6-30,1)

12,9 (5,7-23,9)

0 (0,0-25,9)

 

Signifikanz:

Chi-Quadrat-Test :

P(chi12>chi2) = 0,10

ex. Fisher -Test:

P(a) = 0,28

Ursache war der unvollständige DNA-Verdau durch NdeI trotz verlängerter Inkubationszeit, wie bei den Proben von Mitarbeiter 3 und 5 sowie Patient 11 und 14 in Abbildung 4-7 zu sehen.


49

Abbildung 4-7: Beispiel für unvollständigen DNA-Verdau durch NdeI (4 Stunden Inkubation mit 10 Units Enzym)
Alle Mitarbeiter waren homozygot für den Wildtyp. Die Patienten 2, 13, und 15 tragen die Variante.

Der Unterschied zwischen der bei den Patienten (q ap 12,9 %) und den Mitarbeitern (q ap 0 %) beobachteten Frequenz wurde im exakten Fisher -Test mit alpha = 0,28 nicht signifikant. Aus der in Tabelle 4-8 wiedergegebenen Verteilung der Genotypen in den gebildeten Subpopulationen konnte kein Verstoß gegen das Hardy-Weinberg-Gesetz abgeleitet werden.

Tabelle 4-8: Häufigkeit der beobachteten Genotypen am Genort (SP-A1)-Codon 184
Die Konkordanz P(chi12>chi2) mit dem Hardy-Weinberg-Gesetz wurde im Chi-Quadrat-Test berechnet.

Population (N):

Gesamt (36)

Patienten (31)

Probanden (5)

Sequenz (14)

RFLP (22)

[3138T]+[3138T]:

2,8% (P=1)

3,2% (P=1)

0,0% (P=0)

0,0% (P=0)

4,5% (P=1)

[3138C]+[3138T]:

16,7% (H=6)

19,4% (H=6)

0,0% (H=0)

7,1% (H=1)

22,7% (H=5)

[3138C]+[3138C]:

80,6% (Q=29)

77,4% (Q=24)

100,0% (Q=5)

92,9% (Q=13)

72,7% (Q=16)

Konkordanz:

P(chi12>chi2)=35%

P(chi12>chi2)=44%

P(chi12>chi2)=100%

P(chi12>chi2)=89%

P(chi12>chi2)=48%

4.2.2 SP-A1- und SP-A2-Genotypen von 14 Patienten

Von 14 Patienten, die nach den in Abschnitt 3.1.2 dargelegten Kriterien ausgewählt worden waren, wurden die DNA-Sequenzen aller Exone beider SP-A-Gene bestimmt. Da diploide Proben amplifiziert und sequenziert wurden, liegen an heterozygoten Genorten zwei verschiedene DNA-Basen vor, die ähnlich wie in der Sequenz auf der linken Seite in Abbildung 4-4 nebeneinander als Farbbanden auf der Membran auftauchen. In Tabelle 4-9 werden die


50

daraus abgeleiteten Sequenzen beider Allele von SP-A1 gezeigt; aus Gründen der Übersichtlichkeit werden nur die Sequenzen der polymorphen Codons wiedergegeben. Nach dem in Tabelle 1-2 wiedergegebenen Schema lassen sich die Allele des SP-A1-Gens an bestimmten Einzelbasensubstitutionen in Exon 1, 2 und 4 erkennen. Außer dem Wildtyp 6a2 haben alle Allele die Substitution 1193G>C. Allel 6a4 trägt darüber hinaus die Substitutionen [1544A>G + 3241C>T], während [1101T>C + 1544A>G + 2985A>G] das Allel 6a definiert. Die bei den Patienten 8, 12 und 15 entdeckten neuen Einzelbasensubstitutionen sind nur durch das Auftreten unbekannter Allele zu erklären, die eine Erweiterung des Schemas erfordern.

Tabelle 4-9: Polymorphe Codons in den Exonsequenzen von SP-A1 und dementsprechende Allele der Patienten
Zur Orientierung ist die seltene Variante hervorgehoben. Neu beschriebene Polymorphismen sind kursiv gesetzt.
Unterstrichene Haplotypen wurden durch Klonierung gesichert.

SP-A1

Exon:

1

1

1

2

4

4

4

 

Einzelbase:

1101T>C

1162C>T

1193G>C

1544A>G

2985A>G

3138T>C

3241C>T

Patient

Aminosäure:

Val19Ala

(39His)

Val50Leu

(62Pro)

(133Thr)

(184Tyr)

Arg219Trp

3

6a2
6a2

GTG
GTG

CAC
CAC

GTC
GTC

CCA
CCA

ACA
ACA

TAT
TAT

CGG
CGG

4

6a2
6a2

GTG
GTG

CAC
CAC

GTC
GTC

CCA
CCA

ACA
ACA

TAT
TAT

CGG
CGG

5

6a3
6a3

GTG
GTG

CAC
CAC

CTC
CTC

CCA
CCA

ACA
ACA

TAT
TAT

CGG
CGG

6

6a
6a3

GCG
GTG

CAC
CAC

CTC
CTC

CCG
CCA

ACG
ACA

TAT
TAT

CGG
CGG

7

6a2
6a3

GTG
GTG

CAC
CAC

GTC
CTC

CCA
CCA

ACA
ACA

TAT
TAT

CGG
CGG

8

6a2
6a*

GTG
GTG

CAC
CAT

GTC
CTC

CCA
CCA

ACA
ACA

TAT
TAT

CGG
CGG

9

6a2
6a3

GTG
GTG

CAC
CAC

GTC
CTC

CCA
CCA

ACA
ACA

TAT
TAT

CGG
CGG

10

6a2
6a3

GTG
GTG

CAC
CAC

GTC
CTC

CCA
CCA

ACA
ACA

TAT
TAT

CGG
CGG

12

6a2
6a*

GTG
GTG

CAC
CAT

GTC
CTC

CCA
CCA

ACA
ACA

TAT
TAT

CGG
CGG

15

6a#
6a2 oder 6a3

GTG
GTG

CAC
CAC

CTC o. GTC
GTC o. CTC

CCA
CCA

ACA
ACA

TAC
TAT

CGG
CGG

16

6a2
6a2

GTG
GTG

CAC
CAC

GTC
GTC

CCA
CCA

ACA
ACA

TAT
TAT

CGG
CGG

17

6a2
6a2

GTG
GTG

CAC
CAC

GTC
GTC

CCA
CCA

ACA
ACA

TAT
TAT

CGG
CGG

34

6a2
6a2

GTG
GTG

CAC
CAC

GTC
GTC

CCA
CCA

ACA
ACA

TAT
TAT

CGG
CGG

37

6a3
6a4

GTG
GTG

CAC
CAC

CTC
CTC

CCA
CCG

ACA
ACA

TAT
TAT

CGG
TGG


51

Die DNA-Klonierung isoliert die amplifizierten Sequenzen beider Allele eines heterozygoten Patienten voneinander. Elf Klone waren erfolgreich mit der amplifizierten DNA-Sequenz von SP-A1-Exon 1 von Patient 8 transformiert worden. In einer kombinierten DNA-Restriktion mit NcoI und EcoRI wurde die klonierte Sequenz aus der Plasmid-DNA herausgeschnitten und auf das Vorliegen der Substitution 1162C>T getestet. Bei der Sequenzierung von acht NcoI-positiven Klonen wurde siebenmal die Substitution 1193G>C ermittelt, der achte Klon hatte in Codon 50 die Valin kodierende Wildtypsequenz “GTC“. Mögliche Ursachen für die Enstehung dieser mutierten Sequenz (Klon 8.2 in Tabelle 4-13 ) werden in Abschnitt 1.1.1 diskutiert. Da die übrigen polymorphen Genorte der Wildtypsequenz entsprechen, tragen Patient 8 und 12 neben dem Wildtypallel 6a2 ein neues Allel 6a* des Haplotyps [1162C>T + 1193G>C], das dieselbe Aminosäuresequenz wie Allel 6a3 kodiert.

Patient 15 besitzt ein unbekanntes Allel mit der Substitution 3138T>C und ist gleichzeitig heterozygot in Codon 50. Um zu bestimmen, ob dieses Allel in Exon 1 die Wildtypsequenz oder die Substitution 1193G>C trägt, musste fast die gesamte SP-A1-Sequenz kloniert werden. In den klonierten Sequenzen waren beide Kombinationen vorhanden, so dass die Frage nicht eindeutig beantwortet werden konnte (vergleiche dazu weiter unten den Hinweis auf das Phänomen der jumping PCR bei der Klonierung des SP-A2-Gens). Patient 15 trägt daher entweder ein Wildtypallel 6a2 und ein Allel 6a6 des Haplotyps [1193G>C + 3138T>C] oder ein Allel 6a3 des Haplotyps [1193G>C] und ein Allel 6a# des Haplotyps [3138T>C].

Tabelle 4-10 gibt die Ergebnisse der DNA-Sequenzierung der SP-A2-Amplifikate wieder. Da die Zahl der verschiedenen SP-A2-Allele größer ist, kann das in Tabelle 1-3 wiedergegebene Schema nicht jeden Genotyp aus einer diploiden Probe identifizieren. Nur Allel 1a ist durch die Substitution 1649G>C charakterisiert. Bei Nachweis der Sequenz [3018C>T + 3265C>A] in Exon 4 entscheidet die Anwesenheit der Substitution 1098A>C in Exon 1, ob Allel 1a1 oder Allel 1a3 vorliegt. Allel 1a2 liegt vor, wenn es sich abgesehen von der Substitution 1098A>C um die Wildtypsequenz handelt. Liegt wie bei Patient 4 sowohl in Exon 1 wie auch in Exon 4 Heterozygotie vor, kann der Genotyp nicht aus der diploiden Probe bestimmt werden.

Die bei Patient 7 und 10 entdeckte Substitution 1220G>C, die zum Aminosäureaustausch Val50Leu führt, lässt sich durch das Auftreten eines bisher nicht beschriebenen Allels erklären. Sieben erfolgreich mit der aus DNA von Patient 10 amplifizierten Sequenz von SP-A2-Exon 1 transformierte Klone wurden sequenziert. Während zwei die Wildtypsequenz und vier den Haplotyp [1098A>C + 1220G>C] aufwiesen, war der siebte (Klon 10.11 in Tabelle 4-14 ) mit dem Haplotyp [1118T>C + 1220G>C] offenbar als Polymerasefehler in der PCR entstanden.


52

Tabelle 4-10: Polymorphe Codons in den Exonsequenzen von SP-A2 und dementsprechende Allele der Patienten
(Fragliche Allele bei Patient 4 und 12 gingen nicht in die Allel- und Haplotypfrequenzen in Abschnitt 5.2.3 ein)

SP-A2

Exon:

1

1

2

4

4

 

Einzelbasensubstitution:

1098A>C

1220G>C

1649G>C

3018C>T

3265C>A

Patient

Aminosäureaustausch:

Asn9Thr

Val50Leu

Ala91Pro

(140Ser)

Gln223Lys

3

1a0
1a0

AAC
AAC

GTC
GTC

GCT
GCT

TCC
TCC

CAG
CAG

(4)

(1a0 oder 1a2)
(1a1 oder 1a3)

AAC oder ACC
ACC
oder AAC

GTC
GTC

GCT
GCT

TCC
TCT

CAG
AAG

5

1a0
1a2

AAC
ACC

GTC
GTC

GCT
GCT

TCC
TCC

CAG
CAG

6

1a
1a2

ACC
ACC

GTC
GTC

CCT
GCT

TCC
TCC

CAG
CAG

7

1a3
1a*

AAC
ACC

GTC
CTC

GCT
GCT

TCT
TCC

AAG
CAG

8

1a2
1a#

ACC
AAC

GTC
GTC

GCT
GCT

TCC
TCT

CAG
CAG

9

1a0
1a0

AAC
AAC

GTC
GTC

GCT
GCT

TCC
TCC

CAG
CAG

10

1a*
1a#

ACC
AAC

CTC
GTC

GCT
GCT

TCC
TCT

CAG
CAG

(12)

(1a§)
(1a§)

ACC
ACC

GTC
GTC

CCT
CCT

TCT
TCT

AAG
AAG

15

1a0
1a2

AAC
ACC

GTC
GTC

GCT
GCT

TCC
TCC

CAG
CAG

16

1a0
1a0

AAC
AAC

GTC
GTC

GCT
GCT

TCC
TCC

CAG
CAG

17

1a0
1a0

AAC
AAC

GTC
GTC

GCT
GCT

TCC
TCC

CAG
CAG

34

1a3
1a3

AAC
AAC

GTC
GTC

GCT
GCT

TCT
TCT

AAG
AAG

37

1a1
1a1

ACC
ACC

GTC
GTC

GCT
GCT

TCT
TCT

AAG
AAG

Durch Restriktion eines SP-A2-Amplifikats aus der DNA von Patient 10 mit StuI in Exon C und Codon 168 wurde eine Sequenz von 2.302 bp (DNA-Basen 860C_3161G) gebildet und mit pUC19 ligiert. Nur 2 von 24 transformierten Klonen waren laktaseinaktiv. Da bei Restriktion mit BamHI keine Sequenz herausgeschnitten werden konnte, muss die Vielfach-Klonierungsstelle (multiple cloning site) dieser Plasmide samt komplementierendem beta-Galactosidasegen deletiert gewesen sein. Durch Kombination der StuI-Restriktion mit HindIII, welches nach Codon 155 schneidet, wurde ein überhängendes 3‘-Ende am SP-A2-Amplifikat (DNA-Basen 860C_3123A) gebildet. Von neun transformierten Klonen enthielten drei die SP-A2-Sequenz. Die DNA-Sequenzierung zeigte den Haplotyp [1098A>C + 1220G>C] mit der Wildtypsequenz “TCC“ in Codon 140 in zwei der Klone, der dritte Klon wies sowohl in Exon 1 als auch in Exon 4 die


53

Wildtypsequenz auf. Sein Auftreten könnte durch ein als jumping PCR bezeichnetes Phänomen der Regeneration von DNA-Sequenzen während der Amplifikation erklärt werden ( Porter-Jord und Garrett 1990) und soll ebenfalls in Abschnitt 1.1.1 diskutiert werden. Eine mit SmaI und EcoRI unter Einschluss des variablen Codons 203 gebildete Sequenz von 2.537 bp (DNA-Basen 910_3446) konnte nicht mit pUC19 ligiert werden. Eine Erklärung wäre das Fehlen der Schnittstelle für SmaI im amplifizierten Allel aufgrund einer Intronvariante, so dass das 5‘-Ende des nur mit EcoRI geschnittenen PCR-Amplifikats (DNA-Basen 560_3446) nicht zum Vektor komplementär war.

Paitient 7 und 10 tragen das neue Allel 1a7 des Haplotyps [1098A>C + 1220G>C], das aufgrund des Aminosäureaustausches Val50Leu ein SP-A1-Monomer mit neuer Primärstruktur kodiert. Bei Patient 7 ist das zweite Allel 1a3 mit dem Haplotyp [3018C>T + 3265C>A].

Bei Patient 10 hat das zweite Allel abweichend von der Wildtypsequenz lediglich die bekannte, “stille“ Einzelbasensubstitution in Codon 140. Dieses neue Allel 1a6 des Haplotyps [3018C>T] kodiert dasselbe Protein wie Wildtypallel 1a0 und wurde ebenfalls bei Patient 8 nachgewiesen.

Patient 12 ist homozygot für alle vier bisher bekannten Einzelbasensubstitutionen im SP-A2-Gen. Der beobachtete Haplotyp [1098A>C + 1220G>C + 3018C>T + 3265C>A] charakterisiert das neue Allel 1a§, das als Einzelbeobachtung in Abschnitt 5.2.2 näher diskutiert wird.

4.2.3 Häufigkeiten einzelner Polymorphismen

Aus den Zahlen der für eine bestimmte Substitution heterozygoten beziehungsweise homozygoten Proben wurde die beobachtete Häufigkeit q des entsprechenden Polymorphismus im untersuchten Patientenkollektiv sowie die beobachtete Proportion Heterozygoter h berechnet. Ein Vergleich mit dem erwarteten Heterozygotiegrad Het kann ebenso wie die Prüfung auf Konkordanz mit dem Hardy-Weinberg-Gesetz im Chi-Quadrat-Test einen in der studierten Population vorherrschenden Heterozygotenvorteil aufdecken. Die in Tabelle 4-11 gezeigte Analyse der einzelnen Polymorphismen im SP-A1-Gen zeigte jeweils eine hohe Konkordanz mit dem Hardy-Weinberg-Gesetz, die Zahl Heterozygoter entsprach dem Erwartungswert.

Im SP-A2-Gen lag die erwartete Häufigkeit Heterozygoter Het für die Substitution 3265C>A in Codon 223 mit 42,3 % am oberen Ende des 95 %-Konfidenzintervalls (1,8 - 42,8 %) der beobachteten Heterozygotie h. Sowohl bei diesem zum Aminosäureaustausch Gln223Lys


54

führenden Polymorphismus wie auch bei der zum Aminosäureaustausch Ala91Pro führenden Substitution 1649G>C wurde die erhöhte Zahl Heterozygoter als Abweichung vom Hardy-Weinberg-Gleichgewicht mit alpha = 0,019 beziehungsweise alpha = 0,015 in Tabelle 4-12 signifikant.

Tabelle 4-11: Häufigkeiten der einzelnen Polymorphismen im SP-A1-Gen (n = 28 Allele)
Die Proportion Heterozygoter h wurde mit dem erwarteten Heterozygotiegrad Het verglichen.
Die Konkordanz P(chi12>chi2) mit dem Hardy-Weinberg-Gesetz wurde im Chi-Quadrat-Test berechnet.

Variante

q [%]

h [%]

Het [%]

P(chi12>chi2)

1101T>C (Val19Ala)

3,6 (0,1 - 18,3)

7,1 (0,2 - 33,9)

7,1

89 %

1162C>T (39His)

7,1 (0,9 - 23,5)

14,3 (1,8 - 42,8)

13,8

77 %

1193G>C (Val50Leu)

42,9 (24,5 - 62,8)

42,9 (17,7 - 71,1)

50,8

64 %

1544A>G (62Pro)

7,1 (0,9 - 23,5)

14,3 (1,8 - 42,8)

13,8

77 %

2985A>G (133Thr)

3,6 (0,1 - 18,3)

7,1 (0,2 - 33,9)

7,1

89 %

3138T>C (184Tyr)

3,6 (0,1 - 18,3)

7,1 (0,2 - 33,9)

7,1

89 %

3241C>T (Arg219Trp)

3,6 (0,1 - 18,3)

7,1 (0,2 - 33,9)

7,1

89 %

Tabelle 4-12: Häufigkeiten der einzelnen Polymorphismen im SP-A2-Gen (n = 28 Allele)

Variante

q [%]

h [%]

Het [%]

P(chi12>chi2)

1098A>C (Asn9Thr)

42,9 (24,5-62,8)

42,9 (17,7 -71,1)

50,8

64 %

1220G>C (Val50Leu)

7,1 (0,9-23,5)

14,3 (1,8 - 42,8)

13,8

77 %

1649G>C (Ala91Pro)

10,7 (2,3-28,2)

7,1 (0,2 - 33,9)

19,8

1,9 %

3018C>T (140Ser)

35,7 (18,7-55,9)

28,6 (8,4 - 58,1)

47,6

15,7 %

3265C>A (Gln223Lys)

28,6 (13,2 - 48,7)

14,3 (1,8 - 42,8)

42,3

1,5 %

4.3 PCR-SSCP-Analyse

Die Elektrophoresebedingungen zum SSCP-Nachweis in den PCR-Amplifikaten wurden experimentell bestimmt. Die Klonierung von Mustersequenzen ermöglichte die wiederholte Amplifikation von DNA, deren Sequenz an den polymorphen Genorten den entsprechenden Abschnitten der einzelnen Allele entsprach. Zur Überprüfung der Sensitivität wurden Exonsequenzen mit weiteren artifiziellen Mutationen kloniert. SSCP-Gelelektrophoresen mit Patienten-DNA waren wegen der Heterozygotie nicht eindeutig zu interpretieren.


55

4.3.1 Elektrophoresebedingungen zum SSCP-Nachweis

Die Reproduzierbarkeit der SSCP-Elektrophorese wird durch Temperatur , Geldichte sowie denaturierende Zusätze beeinflusst ( Orita et al. 1989). Einzelstrang-DNA wurde mit steigender Geldichte stärker im Gel zurückgehalten, die Mobilitätsunterschiede zur Doppelstrang-DNA verringerten sich, so dass in 3,5 % Polyacrylamid Doppelstrang- und Einzelstrang-DNA nicht mehr zu trennen sind. Abbildung 4-8 zeigt ein 5 %iges Polyacrylamidgel im Monoacrylamid-Bisacrylamid-Verhältnis von 99:1. Eine geringere Querverzweigung würde die Unterschiede wieder erhöhen, aber durch die Konsistenz des Gels die Handhabung zu sehr erschweren.

Tabelle 4-13 und Tabelle 4-14 aufgeführt.

Die Temperatur beeinflusst die DNA-Konformation ( Newton und Graham 1997). Bei 4°C sind einige Polymorphismen besser zu sehen, wie bei Klon 8.8 in Abbildung 4-9 . Klon 8.2 lässt sich jedoch besser in der bei 20° C durchgeführten Elektrophorese in Abbildung 4-8 differenzieren.

Abbildung 4-9: SSCP-Analyse mit klonierter DNA von SP-A-Exon 1
6% Polyacrylamid(99:1), Temperatur = 4°C, Laufzeit = 135 Minuten, DS = nicht denaturierte DNA.


56

Diese Ergebnisse sind in Gelen vergleichbarer Dichte reproduzierbar, wie die Elektrophorese mit MDE ® Gel Solution (FMC BioProducts) in Abbildung 4-10 im Vergleich zu der unter den gleichen Bedingungen durchgeführten Elektrophorese mit herkömmlichen Polyacrylamid in Abbildung 4-9 zeigt. Durch denaturierende Zusätze von 5 % Glycerol wurde die Mobilität der Einzelstrang-DNA so weit erhöht, dass sie bei einer Konzentration von 5 % Polyacrylamid (99:1) nun wie in Abbildung 4-11 vor der Doppelstrang-DNA liegt. Diesen Effekt zeigten bereits Orita et al. 1989. Die Unterschiede in der elektrophoretischen Mobilität der mutierten Sequenzen verringern sich dabei oftmals, wie der Vergleich mit Abbildung 4-12 zeigt.

Abbildung 4-10: SSCP-Analyse mit klonierter DNA von SP-A-Exon 1
(0,25×) MDE ® Gel Solution, Temperatur = 4°C, Laufzeit = 135 Minuten, DS = nicht denaturierte DNA.

Abbildung 4-11: SSCP-Analyse von SP-A1-Exon 2 mit DNA-Proben der Patienten 6, 8 und 12
5% Polyacrylamid(99:1) mit 5% Glycerol, Temperatur = 4°C, Laufzeit = 135 min, DS = Doppelstrang-DNA.

Abbildung 4-12: SSCP-Analyse von SP-A1-Exon 2 mit DNA-Proben der Patienten 6, 8 und 12
5% Polyacrylamid(99:1), Temperatur = 4°C, Laufzeit = 135 Minuten, DS = am unteren Gelrand (185 bp).


57

4.3.2 Klonierung von Mustersequenzen

Aus amplifizierter DNA der heterozygoten Patienten 6, 8 und 10 konnten die den einzelnen Exonsequenzen entsprechenden Abschnitte aller Allele als Mustersequenzen im Vektor pCR2.1 kloniert werden. In einer PCR mit den internen Primern SPA-EX1-FW3 und SPA-EX1-RE3 wurden die Sequenzen von Exon 1 beider SP-A-Gene zusammen aus genomischer DNA eines dieser Patienten amplifiziert. Die Plasmid-DNA der erfolgreich transformierten Klone wurde in einer DNA-Restriktion mit PstI wie in Abbildung 4-13 auf das Vorliegen der bereits in Abschnitt 1.1.1 beschriebenen und invariant nur im SP-A2-Gen vorkommenden Einzelbasensubstitution 1018T>A oberhalb von Exon D getestet.

Abbildung 4-13: Restriktionsanalyse der Klone von Patient 10-SP-A-Exon 1
Amplifikate von SP-A1 (Klon 28, 30, 32 und 33) bilden Fragmente von 134, 82, 69 und 26 bp. SP-A2-Amplifikate (Klon 29 und 31) bilden je nach Orientierung im Vektor Fragmente von 203, 82 und 26 oder 177, 82 und 52 bp.

Mit den Universalprimer n M13(-29) und M13(-43) wurden gezielt Amplifikate beider Gene sequenziert, bis von jedem Allel wenigstens zwei klonierte Mustersequenzen identifiziert worden waren, die als Gefrierkultur konserviert wurden. Durch die in Abschnitt 1.1.1 zu diskutierenden Fehlermöglichkeiten waren in einige der Sequenzen bei der PCR falsche DNA-Basen eingefügt worden, die nun als artifizielle Mutationen mit kloniert wurden. Sie traten zum Teil in ohnehin polymorphen Codons auf (wie 1194T>C bei Klon 6.1) und sind in Tabelle 4-13 und Tabelle 4-14 hervorgehoben. Die entsprechenden Klone wurden auch konserviert, da sie gut geeignet


58

sind, die Sensitivität der SSCP-Analyse bei der Detektion beliebiger Einzelbasensubstitutionen zu testen. Die Tabellen zeigen die Sequenzen der Klone in den polymorphen Codons und welchem Allel die klonierte Sequenz entspricht, wobei mehrere Allele in Exon 1 dieselbe Sequenz haben. Artifiziell mutierte Sequenzen sind durch Anführungszeichen gekennzeichnet.

Tabelle 4-13: Mustersequenzen für SP-A1-Exon 1 (kloniert aus einer PCR mit Taq-DNA-Polymerase)
Unterstrichene
Klone wurden in einer Gefrierkultur als Muster für die angegebenen Allele konserviert.
Bei der PCR mutierte Genorte sind hervorgehoben. Anführungszeichen markieren die mutierten Allelsequenzen.

Aminosäure:

Val19Ala

(27Val)

(39His)

Val50Leu

Leu50Pro

(51Lys)

 

Patient

Klon

1101T>C

1126T>C

1162C>T

1193G>C

1194T>C

1198A>G

Allel

 

1

GTG

 

CAC

rarr

CCC (Pro)

 

(6a3, 6a4)‘

 

2

GTG

 

CAC

CTC

 

 

6a3, 6a4

 

3

GCG

 

CAC

CTC

 

 

6a

 

4

GTG

 

CAC

CTC

 

 

6a3, 6a4

6

6

GCG

 

CAC

CTC

 

 

6a

 

7

GTG

 

CAC

CTC

 

 

6a3, 6a4

 

8

GCG

 

CAC

CTC

 

 

6a

 

9

GTG

 

CAC

CTC

 

 

6a3, 6a4

 

10

GCG

GTC

CAC

CTC

 

 

(6a)‘

 

12

GTG

 

CAC

CTC

 

 

6a3, 6a4

 

1

GTG

 

CAT

CTC

 

 

6a*

 

2

GTG

 

CAT

GTC

 

 

(6a2)‘

8

3

GTG

 

CAT

CTC

 

 

6a*

 

5

GTG

 

CAC

GTC

 

 

6a2

 

6

GTG

 

CAC

GTC

 

 

6a2

 

8

GTG

 

CAC

GTC

 

AAG

(6a2)‘‘

 

2

GTG

 

CAC

CTC

 

 

6a3, 6a4

10

3

GTG

 

CAC

GTC

 

 

6a2

 

8

GCG

 

CAC

GTC

 

 

(6a2)‘‘‘

 

10

GTG

 

CAC

CTC

 

 

6a3, 6a4

Mit den internen Primern SPA-EX2-FW und SPA-EX2-RE2 wurden die Sequenzen von Exon 2 beider SP-A-Gene aus genomischer DNA von Patient 6 amplifiziert. Die Plasmid-DNA der erfolgreich transformierten Klone wurde in einer DNA-Restriktion mit ApaI auf das Vorliegen der invariant nur im SP-A2-Gen vorkommenden Einzelbasensubstitution 1640G>A getestet. Wieder wurden gezielt so viele Amplifikate beider Gene sequenziert, bis von jedem Allel zwei klonierte Mustersequenzen identifiziert worden waren. Tabelle 4-16 und Tabelle 4-15 zeigen die Sequenzen der Klone an den polymorphen Genorten von SP-A1 und SP-A2.


59

Tabelle 4-14: Mustersequenzen für SP-A2-Exon 1 (kloniert aus einer PCR mit PwoI-DNA-Polymerase)

Aminosäure:

Asn9Thr

Ser16Pro

Val50Leu

 

Patient

Klon

1098A>C

1118T>C

1220G>C

Allel

 

29

ACC

 

GTC

1a, 1a1, 1a2, 1a§

8

31

ACC

 

GTC

1a, 1a1, 1a2, 1a§

 

34

ACC

 

GTC

1a, 1a1, 1a2, 1a§

 

4

ACC

 

CTC

1a*

 

5

ACC

 

CTC

1a*

 

7

ACC

 

CTC

1a*

10

9

AAC

 

GTC

1a0, 1a3, 1a#

 

11

ACC

CCT

GTC

(1a, 1a1, 1a2, 1a§)‘

 

14

AAC

 

GTC

1a0, 1a3, 1a#

 

15

ACC

 

CTC

1a*

Tabelle 4-15: Mustersequenzen für SP-A2-Exon 2 (kloniert aus einer PCR mit Taq-DNA-Polymerase)

Aminosäure:

(Intron)

Ala91Pro

(Intron)

(Intron)

(Intron)

 

Patient

Klon

1526A>G

1649G>C

1690G>A

1696T>C

1745_1747delGGT

Allel

 

5

ACGCA

GCT

GTGGG

 

 

1a0, 1a1-1a*, 1a#

 

14

 

CCT

GTAGG

 

 

1a, 1a§

 

17

 

CCT

GTAGG

 

 

1a, 1a§

 

20

 

CCT

GTAGG

 

 

1a, 1a§

6

22

 

CCT

GTAGG

 

 

1a, 1a§

 

24

 

CCT

GTAGG

 

 

1a, 1a§

 

26

 

CCT

GTAGG

AGCGG

 

(1a, 1a§)‘

 

27

 

GCT

GTGGG

 

(TGGGDeltaDeltaDeltaCAGA)

1a0, 1a1-1a*, 1a#

 

28

 

CCT

GTAGG

 

 

1a, 1a§

Tabelle 4-16: Mustersequenzen für SP-A1-Exon 2 (kloniert aus einer PCR mit Taq-DNA-Polymerase)

Aminosäure:

(Intron)

(Intron)

(Intron)

(62Pro)

Gly72Pro

 

Patient

Klon

1507C>T

1515T>C

1526T>C

1544A>G

1632_1633GG>CC

Allel

 

2

 

 

 

CCA

 

6a2, 6a3, 6a*, 6a#

 

3

CATAT

 

 

CCG

 

(6a, 6a4)‘

 

4

 

 

TCCGC

CCA

 

6a2, 6a3, 6a*, 6a#

 

7

 

 

 

CCA

CCC

(6a2, 6a3, 6a*, 6a#)‘

6

8

 

 

 

CCA

 

6a2, 6a3, 6a*, 6a#

 

9

 

 

 

CCG

 

6a, 6a4

 

13

 

TGCCT

 

CCA

 

(6a2, 6a3, 6a*, 6a#)‘‘

 

15

 

 

 

CCA

 

6a2, 6a3, 6a*, 6a#

 

25

 

 

 

CCA

 

6a2, 6a3, 6a*, 6a#


60

Die in den Klonen 6.3, 6.4, 6.5, 6.13 und 6.26 detektierten Abweichungen in den Intronen liegen innerhalb der Sequenz der SSCP -Primer, so dass diese Fehler bei der Reamplifikation zur SSCP-Analyse wieder korrigiert werden. Die Deletion von drei DNA-Basen bei Klon 6.27 liegt außerhalb der für die SSCP-Analyse amplifizierten Sequenz. Die Sequenz von Klon 6.26 entsprach ab Nukleotid 1716 der des SP-A1-Gens.

Mit den internen Primern SPA-EX3-FW und SPA-EX3-RE wurden die Sequenzen von Exon 3 beider SP-A-Gene aus genomischer DNA von Patient 7 amplifiziert. Da in diesem Exon keine in einem Gen varianten polymorphen Genorte bekannt sind, wurde bei der Sequenzierung an der invarianten Einzelbasensubstitution 2453T>C erkannt, ob eine amplifizierte Sequenz des SP-A1- oder des SP-A2-Gens vorliegt. Bei einer klonierten SP-A2-Sequenz (Klon 7.9) war zusätzlich Nukleotid 2517 im Intron deletiert, wie Tabelle 4-17 zeigt.

Tabelle 4-17: Mustersequenzen für SP-A-Exon 3 (Delta markiert die deletierte DNA-Base)

Aminosäure:

(94Phe)

(Intron)

 

Patient

Klon

2453T>C

2517delT

Gen

 

3

TTT

 

SP-A1

 

4

TTT

 

SP-A1

 

5

TTT

 

SP-A1

7

6

TTT

 

SP-A1

 

7

TTC

 

SP-A2

 

9

TTC

CCCCDeltaGGGC

(SP-A2)‘

 

10

TTT

 

SP-A1

 

12

TTC

 

SP-A2

Mit den internen Primern SPA-EX4-FW3 und SPA-EX4-RE wurden die Sequenzen von Exon 4 beider SP-A-Gene aus genomischer DNA der Patienten 6 und 10 amplifiziert. Lediglich ein Klon war erfolgreich transformiert worden, was an der Größe des DNA-Fragments liegen kann. Dieser Klon hatte abweichend von der Sequenz von Allel 1a eine G-A-Transition in Codon 240. Aufgrund der im folgenden Abschnitt beschriebenen, unzureichenden Spezifität der SSCP-Analyse diploider Patientenproben wurde auf die weitere Klonierung verzichtet.

Tabelle 4-18: Mustersequenz für SP-A2-Exon 4 (kloniert aus einer PCR mit PwoI-DNA-Polymerase)

Aminosäure:

(140Ser)

Gln223Lys

Tyr240Cys

 

Patient

Klon

3018C>T

3265C>A

3305A>G

Allel

6

 

TCC

AAG

TGC

1a


61

4.3.3 SSCP-Gelelektrophoresen mit Patienten-DNA

Abbildung 4-12 zeigte eine SSCP-Gelelektrophorese , bei der Amplifikate von SP-A2-Exon 2 aus Patienten-DNA gemeinsam mit klonierter Standard-DNA aufgetrennt wurden. Bei den DNA-Standards lässt sich das Wildtypallel 1a0 (Klon 6.27) von der Sequenz mit der Einzelbasensubstitution 1649G>C (Klon 6.14) und der in der PCR mutierten Sequenz mit der Transition 1696T>C (Klon 6.26) unterscheiden. Beim Vergleich der Muster von Klon 6.14 und Patient 12 wird die bei der Sequenzierung in Tabelle 4-10 nachgewiesene Homozygotie in Codon 91 für [1649G>C] + [1649G>C] deutlich. Patient 8 ist in Codon 91 homozygot für die Wildtypsequenz “GCT“. Das von Abweichen des Farbbandenmusters von dem bei Klon 6.27 zu sehenden ist durch die inkonstante Einzelbasensubstitution 1690G>A im Intron bedingt. Bei Patient 6 bilden sich durch die Heterozygotie andere Banden als in den homozygoten Proben, wobei es sich wahrscheinlich um Heteroduplexe handelt ( Humphries et al. 1997).

Bei der SSCP-Gelelektrophorese mit Amplifikaten von Exon 3 ließ sich die SP-A1-Gensequenz von der SP-A2-Gensequenz unterscheiden. Die in der PCR mutierte Sequenz von Klon 7.9 war ebenfalls zu differenzieren. Aufgrund der häufigen Polymorphismen war die Identifikation diploider Proben sehr schwierig. Selbst unter Berücksichtigung der hier nicht gezeigten Analysen aller Exone war die exakte Bestimmung des SP-A-Genotyps anhand der Beobachtung von Einzelstrangkonformationspolymorphismen nicht möglich.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiML DTD Version 2.0
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Fri Sep 21 13:56:41 2001