4 Material und Methoden

4.1 Material

4.1.1 Chemikalien und ihre Bezugsquellen

↓51

Soweit nicht anders angegeben wurden Chemikalien in höchst möglicher Qualität von den Firmen Merck (Darmstadt), Roth (Karlsruhe) und Sigma (Deisenhofen), Enzyme von New England Biolabs (Frankfurt), Zellkulturmedien von der Firma GIBCO (Invitrogen, Karlsruhe) und Zellkulturschalen von der Firma TPP (Trasadingen, Schweiz) bezogen.

4.1.2 Oligonukleotide

↓52

Alle Oligonukleotide wurden bei der Firma Biotez, Berlin-Buch, in hoher Qualität bestellt und synthetisiert.

Tabelle 2 : Verwandte Oligonukleotide mit Sequenzen und jeweiliger Anwendung

Gen

5'-Primer

3'-Primer

Anwendung

E2f1

GGTGAAACGGAGGCTGGA

TGTTCTGCAGGGTCTGCAA

qPCR

E2f3

CGCGGTATGATACGTCCCTC

GCTGCCTTGTTCAGATCCAGG

qPCR

Mcm6

GAGTCTACCCTTACCTGTGTCG

GGAAAGTTCCACTCACAAGCTC

qPCR

p107

GATGCTCATCTGACCGGAGT 

ATAAGTCACGTAGGCGCACA 

qPCR

Tgfb1

TGACGTCACTGGAGTTCTACGG

GGTTCATGTCATGGATGGTGC

qPCR

PAI-1

TGCCTGACATGTTTAGTGCAACCC

TGTGCCGAACCACAAAGAGAAAGG

qPCR

p21

CGAGAACGGTGGAACTTTGAC

CAGGGCTCAGGTAGACCTTG

qPCR

p19

TCTTGGTCACTGTGAGGATTCAGC

TCGAATCTGCACCGTAGTTGAGCA

qPCR

p16

AACTCTTTCGGTCGTACCCC

GCGTGCTTGAGCTGAAGCTA

qPCR

Vimentin

GCCCTTAAAGGCACTAACGA

GCAGAGAAATCCTGCTCTCCT

qPCR

Fibronectin

CTGGGGTCACGTACCTCTTCA

AGTCGGTAGCCTGCTATACGG

qPCR

S14

GGCTGACCGAGATGAGTCCTC

CAGGTCCAGGGGTCTTGGTCC

qPCR

b-actin

TCTACGAGGGCTATGCTCTCC

GGATGCCACAGGATTCCATAC

qPCR

Tgfb1

TCC TTT GAC CCT TCA ACA ACT CCC

ACT GTC TTC ATC TTA GCG TGG GC

ChIP

Tgfb1

GGATCCTCCAGACAGCCAGG

CCTCTTCTCTCAACCAGCTCGTCC

ChIP

PAI-1

ACATCTGGTATAAAGGGAGGCAGC

TGCCTTGTGATTGGCTCTTGTTGG

ChIP

p21

CACAGTTGGTCAGGGACAGA

CAGGACCAACCCACTCCTT

ChIP

Cdc2

ACAGAGCTCAAGAGTCAGTTGGC

CGCCAATCCGATTGCACGTAGA

ChIP

Fibronectin

TGTCCCATATAAGCCTCTGCTCTTGG

TGAGCATCTTGAGTGGATGGGAGG

ChIP

Vimentin

TTGGCGTTGTCCAGTCCTCTGC

AGGACACAGACCTGGTAGACATGG

ChIP

b-actin

GCTTCTTTGCAGC TCCTTCGTTG

TTTGCACATGCCGGAGCCGTTGT

ChIP

E2f3-com

GTATCTGGGAAACACAAGGAGGTG

Genotypisierung

E2f3-neo

GCTCATTCCTCCCACTCATGATC

Genotypisierung

E2f3-WT

GGTACTGATGCCACTCTCGCC

Genotypisierung

p53-ko

CTATCAGGACATAGCGTTGG

Genotypisierung

p53-com

TATACTCAGAGCCGGCC

Genotypisierung

p53- wt

ACAGCGTGGTGGTACCTTAT

Genotypisierung

T7-(dT)24

GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-(dT24)

Microarray

shE2F3 seq1

ACAGCAATCTTCCTTAATA

shRNA

shE2F3 seq2

GAGAAGGATTTATGATATC

shRNA

shLuc

CATCACGTACGCGGAATACT

shRNA

E2Fmut

CTCGCTAGGTCCCGTGCAGCTGGG

GCGCTC

GCGCGGCTGCGTCTATGATTAGGG

GACCTC

Mutagenese

4.1.3 Antikörper

Tabelle 3 : Aufführung der verwandten Antikörper

Antikörper

Katalog-Nr.

Firma

Konzentration

Anwendung

Hase-αE2F1

sc-193

Santa Cruz

1:1000 ; 4µg

Western; ChIP

Hase-αE2F3

sc-878

Santa Cruz

1:1000 ; 4µg

Western; ChIP

Hase-αE2F4

sc-1082

Santa Cruz

1:1000 ; 4µg

Western; ChIP

Maus-αE2F3

2G2

monoklonaler Überstand

1:2-1:4

Western

Maus-αVimentin

V5355

SIGMA

1:2000

Western

Maus-αFibronectin

F6140

SIGMA

1:2000

Western

Maus-αVinculin

V9131

SIGMA

1:2000

Western

Maus-αTGFβ

T0438

SIGMA

1:1000

Western

Hase-αTGFβ

ab25121

abcam

1:1000

Western

Hase-αphosphoSMAD2

#3101

Cell Signaling

1:1000

Western

Hase-αSMAD2/3

#3102

Cell Signaling

1:1000

Western

Maus-αp21

sc-6246

Santa Cruz

1:1000

Western

Hase-αp19

ab80

abcam

1:2000

Western

Hase-αp19

NB200-106

Acris

1:1000

Western

αHase-Immunoglobuline/HRP

P0448

DAKO

1:2000

Western

αMaus-Immunoglobuline/HRP

P0447

DAKO

1:2000

Western

Hase-IgG

I5006

SIGMA

4µg

ChIP

αBrdU-FITC

#347583

Becton Dickinson

unverdünnt

FACS

αAnnexinV-FITC

209256-T100

ALEXIS

unverdünnt

FACS

4.1.4 Plasmide

↓53

pSuperior puro:

Leervektor zur shRNA-Klonierung mit Puromycin-Resistenz

pMSCV puro:

viraler Leervektor mit Puromycin-Resistenz

pMSCV-shLuc:

viraler shRNA-Vektor gegen Luziferase

pMSCV-shE2F3:

viraler shRNA-Vektor gegen E2F3

pWZL-ecoR:

retroviraler Vektor mit Neomycin-Resistenz, enthält ekotrophen Rezeptor von S. Gaubatz

pGL3-basic

Leervektor zur Klonierung von Luziferase-Reportergenen

Vim:

Luziferase-Reporter für den humanen Vimentinpromotor, enthält die Sequenzen -964 ~ + 73, Originalkonstrukt von C. Gilles

Vim-E2Fm:

Luziferase-Reporter für den humanen Vimentinpromotor mit Mutation in der proximalen E2F-Bindestelle (+ 24~ +31; GCGCCAGA in TAATCATA)

(CAGA)12 MLP-Luc:

Luziferase-Reporter enthält 12 Kopien der CAGA-Box vor einem minimalen adenoviralen MLP-Promotor von W. Krujier

4.2 Molekularbiologische Methoden

Die im Folgenden nicht näher beschriebenen Standardmethoden wurden aus den Laborhandbüchern von Sambrock et al. (1989) und Ausubel et al. (1987) übernommen[340,341 ]. Diese Methoden waren: Plasmid-DNA-Präparation im analytischen Maßstab, Bestimmung von DNA-Konzentration, Spaltung von DNA mit Restriktionsendonukleasen, Dephosphorylierung linearisierter Plasmide, Ligationsreaktion, Transformation in chemisch kompetente Bakterien sowie Auftrennung von Nukleinsäuren in Agarosegelen. Folgende Kits wurden verwandt: Plasmid-DNA-Präparation (Genomed), RNeasy Purification Kit (Qiagen), ECL-Detection Kit (Millipore), Mutagenese-Kit (Stratagene).

4.2.1  Site-directed-Mutagenese

Die Mutation der E2F-Erkennungssequenz im Vimentinpromotor erfolgte mithilfe der so genannten site-directed Mutagenese unter Verwendung des QuickChangeII Site-Directed Mutagenesis Kits (Stratagene). Dafür wurde das heterologe Luziferasereporterkonstrukt Vim (-964~+73) als Ursprungsvektor verwandt und zusammen mit den E2Fmut-Primern nach Anleitung des Herstellers für die Reaktion angesetzt. Nach erfolgter Mutagenese wurde der Ursprungsvektor mit dem Restriktionsenzym DpnI verdaut und das mutierte Konstrukt in chemisch kompetente XL1-Zellen transformiert. Zur Überprüfung der erfolgreichen Mutagenese wurde das Plasmid sequenziert.

4.2.2 Luciferase-Assay

↓54

Um die Aktivität von Promotoren in Abhängigkeit verschiedener Transkriptionsfaktoren zu untersuchen, wurden Reportergenassays durchgeführt. Hierbei ist die Expression des Firefly-Luciferasereporters abhängig vom vorgeschalteten Promotor.

Das jeweilige Reportergenkonstrukt wurde zusammen mit einem Renilla-Luciferase-Kontrollvektor in die A549-Zellen mit Lipofektamin2000 transfiziert. Am nächsten Tag wurden die transfizierten Zellen für 24h mit 0,1% BSA gehungert und anschließend für 48h mit oder ohne TGFβ1 behandelt. Die Zellen wurden in PBS (140mM NaCl, 2,6mM KCl; 4,5mM Na2HPO4; 1,4mM KH2PO4) geerntet und 20min auf Eis lysiert (50mM HEPES pH 7,4, 250mM KCL, 0,1% NP-40, 10% Glycerin, 1mM DTT, 2mM PMSF). Je 10µl der Extrakte wurden als Doppelwerte in eine Mikrotiterplatte vorgelegt und jeweils 50µl Firefly-Luziferase-Injektionslösung (25mM Glycyl-Glycin, 15mM KxPO4, 4mM EGTA, 15mM MgSO4, 1mM DTT, 1mM ATP, 100µM CoEnzymA, 75mM Luziferin) und 50µl Renilla-Luciferase-Injektionslösung (1,1M NaCl; 2,2mM EDTA; 220mM KxPO4; 0,44mg/ml BSA; 0,008% NaN3; 1,43µM Coelenterazin) injiziert. Die Lichtreaktion wurde mithilfe eines Luminometer detektiert.

4.2.3 Chromatin-Immunpräzipitation

Um die Bindung der E2F-Transkriptionsfaktoren in vivo an die verschiedenen Promotoren zu untersuchen, wurden Chromatin-Immunpräzipitationen (ChIP) durchgeführt.

↓55

2-3x106 Zellen pro IP wurden auf eine 15cm-Schale ausplattiert und in der Regel für 48h bei 37°C inkubiert. Für die ChIPs der TGFβ1-behandelten Zellen wurden die Zellen erst 24h in DMEM/ 0.1% BSA gehungert und anschließend für 48h mit oder ohne 100pM TGFβ1 behandelt.

Die Zellen wurden mit 540µl 37% Formaldehyd für 10min bei Raumtemperatur fixiert und anschließend mit 1M Glycin behandelt, um die Fixierung abzustoppen. Die Zellen wurden auf Eis mit dem Zelllysispuffer (5mM PIPES pH 8,0, 85mM KCl, 1% SDS, 0,5mM PMSF, Proteinase-Inhibitor-Cocktail (1:1000) SIGMA P8340) aufgebrochen und die Kerne herunter zentrifugiert. Anschließend wurden die Kerne mit dem Kernlysispuffer (50mM Tris-HCl pH 8,1, 10mM EDTA, 1% SDS, 0,5mM PMSF, Proteinase-Inhibitor-Cocktail) lysiert, abzentrifugiert und mittels Sonifikation die DNA zerkleinert. Die sonifizierte DNA wurde mit dem Verdünnungspuffer (0,01% SDS; 1,1% TritonX; 1,2 mM EDTA; 16,7mM Tris-HCl pH 8,2; 167mM NaCL, 0,5mM PMSF, Proteinase- Inhibitor-Cocktail) 1:10 verdünnt und zweimal mit blockierter Protein-A-Sepharose (GE Healthcare; 17-0780-01) vorinkubiert. Der geklärte Überstand wurde aufgeteilt und mit den entsprechenden Antikörpern über Nacht bei 4°C inkubiert. Am nächsten Tag wurden die Immunpräzipitate für zwei weitere Stunden mit der blockierten Protein-A-Sepharose bei 4°C inkubiert. Anschließend wurden die von der Protein-A-Sepharose gebundenen Immunpräzipitate einmal mit Niedrigsalz-Puffer (0,1% SDS, 1% TritonX, 2mM EDTA; 10mM Tris-HCl pH 8,0; 150mM NaCl), einmal mit Hochsalz-Puffer (0,1% SDS; 1% TritonX; 2mM EDTA; 10mM Tris-HCl pH 8,0; 500mM NaCl) und fünfmal mit Waschpuffer (0,25M LiCl, 0,5% NP-40; 0,5% Desoxycholsäure; 1mM EDTA; 10mM Tris-HCl pH 8,0) gewaschen. Nach dem letzten Waschen wurde jeglicher Überstand entfernt und die Protein-A-Sepharose in 250µl Eluierungspuffer (50mM Tris-HCl pH 8,0; 1% SDS; 10mM EDTA) und 10µl 5M NaCl aufgenommen. Über Nacht wurde bei 65°C die Protein-DNA-Vernetzung aufgehoben und anschließend mit 10µg RNAse A und 20µg Proteinase K verdaut. Durch eine Phenol-Chloroform-Extraktion und anschließender EtOH-Fällung konnte die immunpräzipitierte DNA von den Proteinen getrennt werden. Mit Hilfe der PCR wurden Abschnitte der zu untersuchenden Promotoren amplifiziert. Für die PCR wurden 1-3µl ChIP-DNA mit 2µl 10x PCR-Puffer (500mM KCl; 100mM Tris pH8,3; 1mg/ml BSA; 2mM dNTPs; 15mM MgCl2), 2µl 10mM Primermix und 0.2µl TrueStart Tag (Fermentas) in 20µl Endvolumen angesetzt. Die erste Denaturierung erfolgte bei 95°C für 3min. Daran angeschlossen wurde 30-35 Zyklen von 30sec 94°C, 30sec 60°C und 30sec 72°C. Die letzte Extension erfolgte bei 72°C für 5min. Die so amplifizierten Produkte wurden auf ein 2% Agarose-Gel aufgetragen. Für die qPCR-Analyse war durch die Verwendung des SYBRGreen-Mix (Abgene) eine initiale Denaturierung von 15min bei 95°C nötig, die übrigen Bedingungen waren gleich.

4.2.4 RNA-Isolierung

Um RNA zu verschiedenen Zeitpunkten des Zellzyklusses zu erhalten, wurden Wildtyp und E2f3-/- MEFs mit einer Dichte von 6x105 Zellen/ 6cm-Schale ausplattiert und bis zur Konfluenz wachsen gelassen (48-72h). Zur Synchronisation wurden die Zellen 72h in DMEM/ 0.1% FCS gehungert. Anschließend wurden die Zellen mit DMEM/ 10% FCS stimuliert und zu den angegebenen Zeitpunkten geerntet.

↓56

Um RNA von verschiedenen Passagen zu erhalten, wurden Passage 2, 4, 6 und 8 Wildtyp und E2f3-/- MEFs mit einer Zelldichte 6x105 Zellen/ 6cm-Schale in DMEM/ 10%FCS ausplattiert und nach 48h für die RNA-Isolation geerntet.

Um RNA von BSA beziehungsweise TGFβ1-behandelten Zellen zu erhalten, wurden Passage 2 Wildtyp und E2f3-/- MEFs mit einer Zelldichte 6x105 Zellen/ 6cm-Schale ausplattiert, für 48h in DMEM/ 10% FCS wachsen gelassen, 24h in DMEM/ 0,1% BSA gehungert und anschließend mit oder ohne 100pM TGFβ1 in DMEM/ 0,1% BSA inkubiert. Nach 48h wurden die Zellen für die RNA-Isolation geerntet.

Die Gesamt-RNA-Isolierung erfolgte nach der Ein-Stufen-Methode (Chomcyznski,P & Sacchi, N) mithilfe des Trizol-Reagenz (Invitrogen). Trizol besteht aus einem Phenol-guanidinisothiocyanat-Gemisch, das ermöglicht die Zellen aufzuschließen, ohne dass dabei die RNA degradiert wird. Durch Zugabe von Chloroform und anschließender Zentrifugation kann die wässrige von der organischen Phase getrennt werden. Dabei verbleibt die RNA in der wässrigen Phase und kann mit Isopropanol gefällt werden. Die RNA-Isolierung wurde wie folgt durchgeführt.

↓57

Die Zellen wurden in 500µl Trizol von der Platte geschabt und gevortext. Zur Isolation der embryonalen Lungen-RNA wurden Schock gefrorene Lungenstücke in 500µl Trizol aufgenommen, homogenisiert und wie folgt weiter verarbeitet. Nach 5 Minuten Inkubation bei Raumtemperatur wurde 100µl Chloroform dazugegeben, 15 Sekunden gevortext, und für weitere 2-3 Minuten bei Raumtemperatur inkubiert. Anschließend wurde durch Zentrifugation (12000g, 15 min, 4°C) die wässrige von der organischen Phase getrennt. Der Überstand wurde abgenommen, mit 250µl Isopropanol versetzt und für 10 Minuten bei Raumtemperatur inkubiert. Die RNA wurde durch Zentrifugation (12000g, 15 min, 4°C) gefällt und mit 70% Ethanol/DEPC gewaschen. Das getrocknete Pellet wurde in 30-50µl DEPC-H2O aufgenommen, für 5 Minuten bei 60°C inkubiert und anschließend wurde die RNA-Konzentration in einer Quarzküvette gemessen.

4.2.5 cDNA-Synthese und quantitative PCR

Um RNA mithilfe einer quantitativen Realtime-PCR analysieren zu können, musste die RNA zuerst in cDNA umgeschrieben werden. Dafür wurden 2-5µg RNA mittels Reverse Transkriptase (Superscript II, Invitrogen) in cDNA nach Angaben des Herstellers umgeschrieben. Für die nachfolgende Realtime-qPCR wurde ein 20µl Ansatz bestehend aus 0,5µl cDNA, 0,5µl 10µM Primermix und 10µl 2x SYBR-Green (Abgene) in Dublikaten pipettiert. Die Primer wurden so designt, dass für alle die optimale Annealingtemperatur bei 60°C lag und die 100-300bp langen DNA-Stücke mit dem folgenden PCR-Programm amplifiziert werden konnte (95°C 15min; 94°C 20sec, 60°C 45sec, 72°C 45sec; 40 Zyklen). Die qPCRs wurden jeweils mit drei unabhängig präparierten cDNAs durchgeführt, die Ergebnisse zusammengefasst und die Variabilität als Standardfehler angegeben.

4.2.6 Präparation der Proben für die Microarray-Analyse

Die Tumor-RNA wurde mithilfe des TRIZOL-Reagenz (Invitrogen) isoliert und anschließend über RNeasy Kit (Qiagen) nach Anleitung des Herstellers aufgereinigt. RNA von asynchron wachsenden Passage P4 Wildtyp und Rb-/-; E2f3-/- MEFs wurde direkt über den RNeasy KIT nach Anleitung des Herstellers isoliert. Für die cDNA-Synthese wurden jeweils 10µg RNA zusammen mit 100pmol T7-(dT)24-Primer eingesetzt, für 10min auf 70°C erhitzt und anschließend auf Eis abgekühlt. Zu RNA und Primer wurden 1x Erststrang-Puffer (Invitrogen), 10mM DTT und 2mM dNTP-Mix gegeben und für 2min bei 42°C inkubiert. Anschließend wurde 400U SupersScript II Reverse Transkriptase (Invitrogen) dazugegeben und bei 42°C für 60min inkubiert.

↓58

Die Erststrangreaktion wurde kurz abzentrifugiert und während der Vorbereitung der Zweitstrangreaktion kurz auf Eis gestellt. Für die Zweitstrangreaktion wurden Zweitstrang-Puffer, 800µM dNTP-Mix, 10U E.coli DNA Ligase (M0205S, NEB), 40U E.coli DNA Polymerase I (M0209S, NEB) und 2U E.Coli RNase H (M0297S, NEB) dazugegeben und zusammen mit der Erststrangreaktion auf 150µl aufgefüllt. Nach 2h Inkubation bei 16°C wurden 10U T4 DNA Polymerase (M0203L, NEB) für weitere 5min dazugegeben. Um die Reaktion abzustoppen, wurde der Ansatz mit 10µl 0.5M EDTA versetzt. Die so synthetisierte doppelsträngige cDNA wurde mittels Phenol-Chloroform-Extraktion aufgereinigt und mit Ammoniumacetat und absolutem Ethanol gefällt.

Zur Herstellung der Biotin-markierten RNA wurde die cDNA unter Verwendung des BioArray High Yield RNA Transcription Labeling Kit (Enzo) nach Angaben des Herstellers in vitro transkribiert. Jedoch wurde dabei nur die Hälfte des vorgeschlagenen Ansatzes verwandt. Zur Entfernung der nicht inkorporierten Nukleotide wurde der in vitro Transkriptionsansatz (cRNA) über RNeasy-Säulchen (Qiagen) aufgereinigt. Nach Bestimmung der Menge an gewonnener cRNA, wurden 15µg cRNA fragmentiert. Die fragmentierte cRNA wurde zur Hybridisierung an Affymetrix-Facility (Frau Born) weggegeben. Für den Tumor-Microarray wurden die murinen MOE430A Arrays (Affymetrix) und für den WT/DKO-Microarray die neuere Version, Mouse 430A 2.0 (Affymetrix) benutzt.

Die erhaltenen CEL-Files wurden mit der Genespring-Software analysiert. Zur Korrektur des Hintergrunds und Normalisierung wurde die GCRMA-Methode gewählt. Die GCRMA-Methode ist eine veränderte Version der Robusten-Multiarray-Analyse (RMA), die auch den GC-Gehalt der Proben in Betracht zieht. Die weitere Normalisierung wurde nach den vorgeschlagenen Angaben des Programms durchgeführt.

↓59

Zur weiteren Analyse wurden die metastatischen mit den nicht-metastatischen Tumoren verglichen und alle Gene mit mindestens zweifacher Expressionsveränderung herausgefiltert. Mit der erhaltenen Genliste wurde dann ein t-Test durchgeführt.

Zur Analyse der Wildtyp und Rb-/-;/E2f3-/- MEFs wurde zuerst ein t-Test durchgeführt und anschließend die Gene herausgefiltert, die eine mindestens zweifache Expressionsveränderung zwischen Wildtyp und Rb-/-;/E2f3-/- MEFs aufwiesen. Die Listen wurden untersucht und die Expression der interessantesten Gene mittels qPCR verifiziert.

4.3 Biochemische Methoden

4.3.1 Proteinextraktion aus Säugerzellen

80-90% konfluente Zellen wurden zweimal mit eiskaltem PBS gewaschen und anschließend mit dem 4-fachen des Zellvolumens in RIPA-Puffer (50mM Tris pH 7,5, 150mM NaCl, 1% NP40, 0,5% Natriumdesoxycholat, 0,1% SDS) mit zugesetzten Proteininhibitoren (0,5mM PMSF, 1mM DTT, 1µg/ml Aprotinin, 1µg/ml Leupeptin, 0,4mM Natriumvanadat, 0,4mM NaF) für 20min auf Eis lysiert. Um Proteinextrakte aus Lungen herzustellen, wurden die Lungen ebenfalls mit RIPA-Puffer (s.o) versetzt und anschließend auf Eis mit einem Ultraturrax homogenisiert. Die so gewonnenen Extrakte wurden für 20min auf Eis inkubiert. Danach wurde der Zelldebri durch 15-minütiger Zentrifugation 13000rpm 4°C entfernt, die Proteinmenge gemessen und anschließend 1:1 mit 2x Probenpuffer (125 mM Tris-HCl pH 6,8; 4% SDS; 20% Glyzerin; 0,01% Bromphenolblau; 2% β-Mercaptoethanol) verdünnt. Die fertigen Proben wurden entweder sofort weiter verwandt oder bei -20°C gelagert.

4.3.2 Bestimmung der Proteinmenge

↓60

Die Proteinmenge wurde mittels der DC-Methode von BIORAD bestimmt. Dazu wurde jedes Mal eine neue Standardkurve mit vier Verdünnungen des Standardproteins BSA zwischen 0,2mg/ml und 1,5mg/ml hergestellt. 5µl Standard und Proteinproben (1:5 verdünnt) wurden in eine Mikrotiterplatte vorgelegt, mit 25µl Biorad-Reagenz A’ vermengt und anschließend mit 200µl Biorad-Reagenz B vermischt. Nach einer 15-minütigen Inkubation wurde die Absorption bei 750nm bestimmt.

4.3.3 SDS-PAGE und Western-Blot-Analyse

Gleiche Proteinmengen wurden mithilfe der SDS-PAGE (10% Trenngel: 10% Acrylamid; 0,32% N,N´-Methylenbisacrylamid; 375 mM Tris-HCl pH 8,8; 0,1% SDS; 0,1% APS; 0,1% TEMED; Sammelgel: 4% Acrylamid; 0,1% N,N´-Methylenbisacrylamid; 125 mM Tris-HCl pH 6,8; 0,1% SDS; 0,1% APS; 0,1% TEMED) in Elektrophoresepuffer (25mM Tris; 20mM Glycin; 2% SDS) aufgetrennt. Die mit 2x Probenpuffer (s.o.) versetzten Proben wurden zusammen mit dem Proteinmarker (Prestained Protein Marker, NEB) vor dem Auftragen zum Denaturieren für 5 min auf 95°C erhitzt. Die Elektrophorese erfolgte in der Regel bei 130V für mehrere Stunden oder bei 10mA über Nacht. Die Proteine wurden anschließend mit einem Nass-Transfer über Nacht (4°C; 30V) auf eine PVDF-Membran (Immobilon-P, 45µm, Millipore) übertragen. Dazu wurde die Membran kurz mit Methanol aktiviert und zusammen mit dem in Transferpuffer (200mM Glycin; 25mM Tris; 20% Methanol) getränkten Proteingel und je drei Lagen Whatman-Papier luftblasenfrei aufeinander gelegt und in die Transferzelle eingespannt. Nach erfolgtem Transfer wurde die Membran zur Absättigung unspezifischer Bindungsstellen mindestens 30min in Milchpuffer (4% Magermilch-Pulver, 0,5% Tween20 in TBS) geschüttelt und anschließend für 1-2h mit dem Primärantikörper (in der in Tabelle 3 angegebenen Verdünnung) in Milchpuffer inkubiert. Anschließend wurde die Membran dreimal 5min in TBS-T (25mM Tris pH 7,4; 137mM NaCl; 5mM KCl; 0,7mM CaCl2; 0,5mM MgCl2; 0,5% Tween20) gewaschen und danach 45min mit dem Sekundärantikörper (in der in Tabelle 3 angegebenen Verdünnung) in Milchpuffer inkubiert. Nach erneutem dreimaligem Waschen in TBS-T wurde die Membran einmal in TBS gewaschen und die vom Primärantikörper erkannten Proteine sichtbar gemacht. Dazu wurde die Membran 1min mit einer 1:1 Mischung der beiden ECL-Lösungen (2 ml pro dm2 Membranfläche, Millipore WBKLS05000) überschichtet. Nach Entfernung der überschüssigen Flüssigkeit wurde auf die Membran ein Röntgenfilm (Hyperfilm, GE Healthcare) exponiert und anschließend entwickelt.

4.3.4 Bestimmung der TGFβ1-Konzentration im Zellüberstand

Die TGFβ1-Konzentration im Mediumüberstand der MEFs wurde mittels eines ELISA-Assays (Quantikine TGFβ1 Immunoassay, R&D Systems) bestimmt. Dafür wurden 1,2x105 Zellen auf einem 12-well-Platte ausplattiert. Am nächsten Tag wurden die Zellen mit PBS gewaschen und mit DMEM/ 0,1% BSA für 48h konditioniert. TGFβ1 wird als latenter Komplex sekretiert, der TGFβ1-ELISA kann jedoch nur aktiviertes TGFβ1 erkennen. Um latentes TGFβ1 zu aktivieren, wurden je 100µl Überstand mit 20µl 1N HCl versetzt, für 10min bei Raumtemperatur inkubiert und anschließend mit 1,2N NaOH/ 0,5M HEPES neutralisiert. Dabei wurde darauf geachtet, dass der pH am Ende zwischen 7,2 - 7,6 lag. Nun wurde der TGFβ1-ELISA nach Anleitung des Herstellers durchgeführt.

4.4 Zellbiologische Methoden

4.4.1 Kultivierung von Zellen

↓61

Die verschiedenen Zellen (MEFs, A549, PhoenixE) wurden bei 37°C, 5% CO2 und einer 95% relativen Luftfeuchtigkeit kultiviert. Das verwandte Zellkulturmedium bestand aus DMEM (GIBCO), 10% inaktiviertem fötalen Kälberserum (FCS, GIBCO) und 1% Penicillin/Streptomycin (GIBCO).

4.4.2 Isolierung von Mausembryonalen Fibroblasten (MEFs)

Mausembryonalen Fibroblasten wurden aus Embryonen im Alter von E13.5 (WT/E2f3) beziehungsweise E14.5 (WT/p53) isoliert. Die Embryonen wurden aus dem Uterus entnommen, der Kopf abgetrennt und Herz, Lunge, Leber und Gedärme entfernt. Der Rest wurde in kleine Stückchen zerschnitten, in PBS gewaschen und über Nacht in 2ml 0.5% Trypsin/EDTA auf Eis inkubiert. Am nächsten Morgen wurde das überschüssige Trypsin abgenommen und die Gewebestückchen für 30min bei 37°C inkubiert. Nach mehrmaligem Resuspendieren in 5ml Vollmedium wurden die vereinzelten Zellen in eine 175cm Zellkultur-Flasche ausplattiert. Die Zellen wurden bis zur Konfluenz wachsen gelassen und anschließend als Passage P0 in 90% FCS (Hitze inaktiviert, GIBCO), 10% DMSO (SIGMA) eingefroren.

4.4.3 Genotypisierung von Mausgewebe

Um die MEFs zu genotypisieren, wurde Gewebe des Embryos (Dottersack, Leber oder Kopf) über Nacht in 100-200µl MGB-Puffer (6,7mM Tris pH 8,8; 16,6mM (NH)4SO4; 6,5mM MgCl2; 1% β-Mercaptoethanol; 0,5% TritonX; 0,4mg/ml Proteinase K) bei 55°C unter Schütteln lysiert. Anschließend wurde die Proteinase K durch Erhitzen auf 95°C für 5min inaktiviert. Zur Genotypisierung von E2F3 wurde 1µl der lysierten DNA mit 2µl 10x PCR-Puffer (500mM KCl; 100mM Tris pH8,3; 1mg/ml BSA; 2mM dNTPs; 15mM MgCl2), je 0,4µl 10µM E2F3-WT- und E2F3-Neo-Primer, 0,8µl 10µM E2F3-Com-Primer und 0,3µl im Labor hergestellter Taq in 20µl Endvolumen angesetzt. Die erste Denaturierung erfolgte bei 94°C für 2min. Im Anschluss folgten 35 Zyklen von 94°C 1min, 64°C 90sec, 72°C 2min. Die letzte Extension erfolgte bei 72°C für 5min. Zur Genotypisierung von p53 wurden 4µl der lysierten DNA mit 2µl 10x PCR-Puffer, je 0,4µl 10µM p53-WT- und p53-Com-Primer, 0,8µl 10µM p53-KO-Primer und 0,3µl im Labor hergestellter Taq in 20µl Endvolumen angesetzt. Die erste Denaturierung erfolgte bei 94°C für 3min. Im Anschluss folgten 30 Zyklen von 94°C 1min, 59°C 2min, 72°C 2min. Die letzte Extension erfolgte bei 72°C für 5min. Die amplifizierten PCR-Produkte wurden auf einem 1-2% Agarose-Gel aufgetragen.

4.4.4 CaPO4-Transfektion

↓62

Die Zellen wurden am Vortag der Transfektion so ausgesät, dass sie am Tag der Transfektion etwa 50% konfluent waren. 2h vor der Transfektion wurde das Medium gewechselt. Zur Transfektion einer 10-cm-Kulturschale wurde 10-30µg DNA mit 62µl 2M CaCl2 versetzt und mit dH2O auf 500µl aufgefüllt. Dieser Ansatz wurde tropfenweise unter vortexen zu 500µl 2xHBS (280mM NaCl, 1,5mM NaHPO4, 50mM HEPES; pH 7,13) pipettiert. Nach 30min Inkubation wurde die Lösung mit DNA-Präzipitat langsam auf die Zellen gegeben und über Nacht inkubiert. Am nächsten Tag wurde das Medium erneuert.

4.4.5 Transfektion mit Lipofectamin

Für die Transfektion der A549 wurde das Lipofektamin2000-Reagenz (Invitrogen) verwandt. Dafür wurden die Zellen am Vortag mit einer Dichte von 1x105 pro 24-well in Antibiotika-freiem Medium ausplattiert. Am nächsten Tag wurden 2µl Lipofektamin2000 in 50µl Opti-MEM verdünnt und 5min bei Raumtemperatur inkubiert. Währenddessen wurden 0,8µg DNA in 50µl Opti-MEM aufgenommen. Der Lipofektamin-Mix wurde mit dem DNA-Mix kombiniert und für 20min bei Raumtemperatur inkubiert. Dieser Mix wurde anschließend auf die Zellen tropfenweise verteilt. Am nächsten Tag wurde das Medium erneuert.

4.4.6 Produktion ekotropher Viren durch Phoenix-Zellen

Zur Produktion ekotropher Viren wurde die Phoenix-Verpackunszelllinie verwandt. Hierbei handelt es sich um eine Zelllinie, die stabil Gene für die viralen Proteine Gag, Pol und Env exprimiert. Durch Transfektion von geeigneten Plasmiden können somit Retroviren produziert werden, die Zellen mit ekotrophen Rezeptor infizieren können. In die Viren werden RNA-Moleküle verpackt, die von Ψ-Sequenz flankiert sind (auf dem Plasmid codiert), welche dann nach der Infektion der Zielzelle in DNA umgeschrieben und stabil ins Genom integriert werden.

↓63

Hierzu wurden ein Tag vor der Transfektion 5x106 Phoenix-Zellen pro 10-cm Kulturschale ausplattiert und am nächsten Tag mithilfe der CaPO4-Methode 30µg DNA transfiziert. Am darauf folgenden Tag wurde das Medium der Zellen gewechselt und die Zellen über Nacht mit 6ml frischem Medium bei 32°C inkubiert. Der Virusüberstand konnte am nächsten Tag geerntet und zur Infektion verwandt werden.

4.4.7 Infektion von A549 mittels ekotropher Viren

Um humane A549 zu infizieren, wurden A549-Zellen, die den ekotrophen Rezeptor stabil enthielten, einen Tag vor der Infektion mit einer Dichte von 106 Zellen pro 10-cm Schale ausplattiert. Am nächsten Tag wurde der geerntete Virusüberstand 1:1 mit Vollmedium verdünnt, steril filtriert (0.4µ) und mit Polybren (Endkonzentration 10µg/ml) versetzt. Zu den A549-Zellen wurden 6ml so behandelter Virusüberstand gegeben und bei 32°C inkubiert. Diese Prozedur wurde am Abend des gleichen Tages und am Morgen des nächsten Tages wiederholt, so dass die Zellen dreifach infiziert wurden, um die Infektionsrate zu erhöhen. Am Abend wurde der Virusüberstand durch Vollmedium ersetzt. Je nach vorhandenem Selektionsmarker wurde die Zellen mit 2,5µg/ml Puromycin oder 400µg/ml G418 behandelt. Nach erfolgreicher Selektion wurden die Zellen für die Experimente weiter verwandt.

4.4.8 TGFβ1-induzierte Reduktion der Zellzahl

Um den TGFβ1-induzierten Wachstumsarrest zu ermitteln, wurden 2,5x105 Zellen pro 6-well in Gegenwart oder Abwesenheit von 100pM TGFβ1 (R&D) in DMEM/ 10%FCS ausplattiert. Nach 48h wurde die Zellzahl mithilfe eine Zellzählers (Casy1, Schärfe System) bestimmt. Dafür wurden die Zellen zweimal mit PBS gewaschen, abtrypsiniert und in 2ml DMEM/ 10%FCS aufgenommen. Eine 1:200 Verdünnung wurde im Zellzähler analysiert.

4.4.9 BrdU-Proliferationsassay

↓64

Um die Menge an S-Phase-positiven Zellen zu ermitteln, wurde die Anzahl an BrdU-positiven Zellen bestimmt. BrdU ist ein Thymidinanalogon und wird während der S-Phase in die DNA eingebaut und kann mithilfe eines Antikörpers sowohl immunhistochemisch als auch im Durchflußzytometer nachgewiesen werden.

106 Zellen wurden auf eine 10cm-Schale in Gegenwart oder Abwesenheit von 100pM TGFβ1 (R&D) ausplattiert. Damit BrdU für die FACS-Analyse in ausreichenden Mengen eingebaut wird, wurde ein Puls von 30µM BrdU (SIGMA) für 24h gegeben. Nach 48h TGFβ1-Behandlung wurden die Zellen mit PBS gewaschen, abtrypsiniert und in 70% Ethanol bei 4°C über Nacht fixiert. Am nächsten Tag wurden sie entweder weiter für die FACS-Analyse behandelt oder bei -20°C gelagert. Nach Zentrifugation wurde die DNA für 30 min mit 2M HCl/ 0,5% Triton X-100 denaturiert und mit 0,1M Na2B4O7 neutralisiert. Die Zellen wurden gezählt und jeweils 5x105 Zellen mit 25µl anti-BrdU-FITC (BD) für weitere 30min im Dunkeln inkubiert. Anschließend wurden die Zellen mit 25µl RNAse A (10mg/ml) in 500µl PBS behandelt, um die Zellen aufzubrechen, und mit 15µl PI (1mg/ml) versetzt. Die so behandelten Zellen wurden mit einem FACS-Calibur analysiert.

4.4.10 AnnexinV-Färbung

Um die Apoptoserate zu ermitteln, wurde die Anzahl an AnnexinV-positiven Zellen bestimmt. AnnexinV bindet an Phospatidylserin (PS), das sich in lebenden Zellen auf der Membran-Innenseite befindet und durch Apoptose auf die Außenseite transloziert. Dadurch kann mithilfe eines FITC-AnnexinV–Antikörpers auf einfache Weise zwischen lebenden und apoptotischen Zellen unterschieden werden. Da die Zellmembran in nekrotischen Zellen durchlässig wird, kann AnnexinV auch in nekrotischen Zellen an PS binden und zu einer falschpositiven Färbung führen. Um dies auszuschließen wurde eine Doppelfärbung mit AnnexinV und Propidiumiodid (PI) durchgeführt, da PI nur in nekrotische Zellen eindringen kann. So wurden für die Apoptoserate nur AnnexinV-positive, PI-negative Zellen angegeben.Für die AnnexinV-Färbung, wurden 106 Zellen auf eine 10cm-Schale in Gegenwart oder Abwesenheit von 100pM TGFβ1 (R&D) ausplattiert und für 48h inkubiert. Nach Behandlung wurde der Überstand der Zellen gesammelt. Anschließend wurden die Zellen vorsichtig abtrypsiniert, im Überstand resuspendiert und abzentrifugiert (1200rpm, 3min). Die Zellen wurden in PBS gewaschen und erneut abzentrifugiert (1200rpm, 3min). Das Pellet wurde in 0,5ml AnnexinV-Bindepuffer (10mM HEPES pH 7,4, 140mM NaCl, 2,5mM CaCl2) resuspendiert und auf 2-5x105 Zellen/ ml verdünnt. 195µl dieser Zellsuspension wurden mit 5µl Annexin-FITC für 10min im Dunkeln inkubiert. Nach Abzentrifugation und Aufnahme in 285µl AnnexinV-Bindepuffer wurden die Zellen mit 10µl Propidiumiodid (PI; 20µg/ml) versetzt und mithilfe eines Durchflußzytometers (FACS Calibur) analysiert.

4.4.11 Seneszenz-assoziierte β-Gal Färbung (SA-β-Gal)

↓65

Um die von TGFβ1 induzierte Seneszenz zu analysieren, wurden die Zellen auf Senesezenz-assoziierte β-Galactosidase-Färbung untersucht. SA-β-Gal wird nur in seneszenten, nicht aber in präseneszenten oder proliferierenden Zellen bei einem pH 6,0 detektiert.

Dafür wurden die MEFs wie für den TGFβ1-induzierten Wachstumsarrest ausplattiert und nach 48h TGFβ1-Behandlung mit 0,5% Glutaraldehyde für 10min fixiert. Nach Waschen mit PBS pH 6.0/ 1mM MgCl2 folgte eine Färbung mit der X-Gal Färbelösung (1mg/ml X-Gal, 0,12mM K3Fe[CN]6, 0,12mM K4Fe[CN]6, 1mM MgCl2 in PBS pH 6,0) über Nacht bei 37°C. Am nächsten Tag wurden die Kerne mit DAPI gefärbt und das Verhältnis SA-β-Gal positiver Zellen zu DAPI-Kernen ausgezählt.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
28.01.2009