[Seite 14↓]

Material und Methoden

2.1 Material

2.1.1 Chemikalien, Hersteller und Bezugsquellen

Die benutzten Chemikalien wurden in dem Reinheitsgrad pro analysis verwandt.

Agarose, GibcoBRL, Karlsruhe

Ammoniumacetat, Merck, Darmstadt

APS (Ammoniumperoxodisulfat), Merck, Darmstadt

[ γ -P 32 ] ATP, Amersham, Braunschweig

biotinyl. anti-Kaninchen-IgG-Antikörper (Ziege), Dako, Hamburg

biotinyl. anti-Maus-IgG-Antikörper (Kaninchen), Dako, Hamburg

Bis-Tris-Propan, Merck, Darmstadt

Borsäure, Merck, Darmstadt

Bromphenolblau (3‘,3‘‘,5‘,5‘‘-Tetrabromophenolsulfonphtalein), Sigma, Deisenhofen

BSA (bovine serum albumin, Fraction V), Serva, Heidelberg

Calciumchlorid-Dihydrat, Merck, Darmstadt

Chloroform, Merck, Darmstadt

Citronensäure, Merck, Darmstadt

Dinatriumhydrogenphosphat, Merck, Darmstadt

EDTA (Ethylendiamintetraessigsäure Dinatriumsalz), Boehringer, Mannheim

Eisessig, Merck, Darmstadt

Ethanol, J. T. Baker, Deventer, Holland

Ethidiumbromid, Sigma, Deisenhofen

FCS (fetal calf serum), PAA Laboratories GmbH, Linz, Österreich

Formaldehyd, Merck, Darmstadt

Formamid, Merck, Darmstadt

L-Glutamin, Bio Whittaker, Verviers, Belgien

Glycerol, Merck, Darmstadt

Glycogen, Boehringer, Mannheim

Harnstoff, Serva, Heidelberg

Ham`s F-10 Medium, Sigma, Deisenhofen

Hep2-Mounting Medium, The binding site, Birmingham, GB

[Seite 15↓]H-Insulin, Hoechst, Frankfurt am Main

Isoamylalkohol, Roth, Karlsruhe

Isopropanol, Merck, Darmstadt

Kaliumchlorid, Merck, Darmstadt

Kaliumdihydrogenphosphat, Merck, Darmstadt

Klenow-Enzym, Boehringer, Mannheim

Leibovitz´s L-15 Medium, Life Technologies, Eggenstein

Loading-Dye, Promega, Mannheim

Magnesiumchlorid, Fluka-Chemie, Buchs, Schweiz

MEM-Vitamine, Seromed, Berlin

Molecular Weight Marker VIII, Boehringer, Mannheim

monoklonaler anti-PTHrP-IgG-Antikörper (Maus), Dianova, Hamburg

Natriumacetat, Merck, Darmstadt

Natriumazid, Merck, Darmstadt

Natriumcarbonat, Merck, Darmstadt

Natriumchlorid, Merck, Darmstadt

Natriumhydroxid, Merck, Darmstadt

PerFect-Transfection-Kit, Invitrogen, NV Leek, Holland

Phenol-Chloroform-Isoamylalkohol (25:24:1), Sigma, Deisenhofen

Polyacrylamid, Appligene, Heidelberg

Propidiumjodid, Sigma, Deisenhofen

PTHrP (1-86), Bachem, Heidelberg

Salzsäure, Merck, Darmstadt

Schwefelsäure, Merck, Darmstadt

SDS (n-Dodecylhydrogensulfat), Merck, Darmstadt

SA-Pox Konjugat, HRP, Dako, Hamburg

T4-Polynucleotid-Kinase, Promega, Mannheim

T7-RNA-Polymerase, Boehringer, Mannheim

Taq-DNA-Polymerase, Boehringer, Mannheim

TEMED (N,N,N‘,N‘-Tetramethylethylen-Diamin), Sigma, Deisenhofen

Transferrin, Boehringer, Mannheim

Trasylol, Bayer, Leverkusen

Tris-Base (Trisaminomethan), Merck, Darmstadt

Trypsin, Seromed, Biochrom, Berlin

[Seite 16↓]Tween 20, Serva, Heidelberg

[ α -P 32 ] UTP, Amersham, Braunschweig

Wasserstoffperoxid 30 %, Merck, Darmstadt

2.1.2 Puffer und Lösungen


[Seite 17↓]

2.1.2.1

10x TBE:

(für Polyacrylamid[PAA]-

Gelelektrophorese)

1 M Tris-Base

0,85 M Borsäure

10 mM EDTA pH 8,0

2.1.2.2

50x TAE:

(für Agarosegelelektrophorese)

2,25 M Tris-Base

5,71 % Eisessig

50 mM EDTA pH 8,0

2.1.2.3

Stopppuffer:

(für Kinetikversuche)

9 M Harnstoff

100 mM EDTA

Loading Dye (1:100)

2.1.2.4

RNA-Elutionspuffer:

0,5 M Ammoniumacetat

0.1 % SDS

1 mM EDTA

2.1.2.5

Trypsinlösung:

0,05 % Trypsin

0,02 % EDTA

1x PBS ohne Ca2+ und Mg2+

2.1.2.6

DNA-Auftragspuffer:

(für Agarosegelelektrophorese)

10 % Glyzerin

100 µg/ml Ethidiumbromid

2.1.2.7

RNA-Auftragspuffer:

(für PAA-Gelelektrophorese)

Formamid

6,25 mM EDTA

Loading Dye (1:100)

2.1.2.8

Tris-HCl-Puffer:

(für Kinetikversuche)

1 M Tris-Base

mit 1 M HCl auf pH 7,5 eingestellt

2.1.2.9

1x PBS pH 7,2:

2,7 mM KCl
136 mM NaCl
1,5 mM KH2PO4
8,1 mM Na2HPO4

2.1.3 Verbrauchsmaterial

8-Kammer-Objektträger, Nunc, Wiesbaden-Biebrich

96-Loch-Platten, Nunc, Wiesbaden-Biebrich

24-Loch-Platten, Nunc, Wiesbaden-Biebrich

Röntgenfilme, Amersham, Braunschweig

Zellkulturflaschen, Falcon, Becton und Dickinson, Heidelberg

2.1.4 Geräte


[Seite 18↓]

Kühlzentrifuge:

Centrifuge 5402, Eppendorf, Hamburg

Tischzentrifuge:

Centrifuge 5415C, Eppendorf, Hamburg

Wasserbad:

Typ 1003, GFL Gesellschaft für Lebensmittel-Forschung mbH, Berlin

PCR-Cycler:

Trio-Thermoblock, Biometra, Göttingen

DNA Thermal Cycler 480, Perkin Elmer, Überlingen

Photometer:

RNA/DNA Calculator Gene Quant II, Pharmacia, Freiburg

Densitometer:

Imaging Densitometer Model GS-670, BioRad, München

Phosphordensitometer:

Molecular Imager Model GS-250, BioRad, München

(zugehörig GS-250 Sample Loading Dock, Molecular Imaging Screen-BI, GS-250 Screen Eraser)

Szintillationszähler:

Liquid Scintillation Counter Wallac 1409, Wallac-ADL, Freiburg

Geltrockner:

Gel Dryer Model 583, BioRad, München

UV-Transilluminator:

Herolab GmbH Laborgeräte, Wiesloch

Stromversorgungsgeräte:

(Gelelektrophorese)

PP3000, Biometra, Göttingen

ECPS 3000/150, Pharmacia, Freiburg

Mikrotiterplattenwascher:

Model 1250 Immunowash,BioRad, München

Mikrotiterplattenphotometer:

Automated Microplate Reader Model EL340, Bio-Tek Instruments, Inc.,Winooski, USA

Röntgenkassette:

Hypercassette Neutral (24 x 30 cm) RPN11643, Amersham, Braunschweig

Röntgenfilmentwickler:

Hyperprocessor Automatic Film Processor RPN1700, Amersham, Braunschweig

2.1.5 Software

Für die Verarbeitung des Daten- und Bildmaterials wurde institutseigene Software verwandt. Im Folgenden sind neben den Programmbezeichnungen die Softwarehersteller, der Verwendungszweck und die entsprechenden Dateiformate aufgeführt.

Molecular Analyst, BioRad, München

 

- densitometrisches Messen radioaktiv markierter Banden im PAA-Gel

 

- Erzeugen von Bilddateien der Gele

 

Dateiformat: IMG, TIF

Origin, Microcal Software, Inc., Northampton, USA

 

- graphisches Auswerten der Kinetikversuche

 

- Fitten der Graphen

 

- Ermitteln der kobs-Werte

 

- Statistik, t-Test

 

Dateiformat: ORG

Kinetic Calc

 

- photometrisches Messen der 96-Loch-Platten

 

- Ausgabe der Messdaten

 

Dateiformat: PRN


[Seite 19↓]

Microsoft Powerpoint, Microsoft Corporation

 

- Zusammenstellen des Bildmaterials

 

- Beschriften der Bilder

 

Dateiformat: PPT

Oligo, National Biosciences, Inc., Plymouth, USA

 

- Erstellen von Primer- und Templatesequenzen

 

Dateiformat: SEQ

DNASIS, Hitachi Software Engineering Co. Ltd., Yokohama, Japan

 

- Erstellen von Primer- und Templatesequenzen

 

Dateiformat: SEQ

EMBL, Datenbank (DKFZ Karlsruhe)

2.1.6 Tumorzellen

Für die Behandlung von Tumorzellen in Monolayer-Zellkultur mit dem stabilisierten Ribozym wurde die Zellinie RCC 95/96, ein Nierenzellkarzinom, ausgewählt. Diese Zellinie ist im eigenen Labor etabliert worden. Die Kultivierung der Zellen erfolgte in Leibovitz`s L-15 und Ham`s F-10 Medium.

Zusätze im Leibovitz`s L-15 Medium:

10 % FCS, 1 mM L-Glutamin, 1x MEM-Vitamine,

1 µg/ml Transferrin; 0,1 % Glukose, 80 IE/l Insulin, 20.000 kIE/l Trasylol

Zusätze im Ham`s F-10 Medium:

1 mM L-Glutamin; 0,9 mM CaCl2 (damit insgesamt 1,2 mM enthalten, normocalcämisch)


[Seite 20↓]

2.1.7  Ribozyme

Das Hammerhead-Ribozym RbO (Abb. 3) ist eines von drei im eigenen Labor entwickelten Ribozymen. Es katalysiert die Spaltung der PTHrP-mRNA.

Abb. 3: Hammerhead-Ribozym RbO.

Das Ribozym RbO stellte den Ursprung für die Entwicklung eines metabolisch stabilen Ribozyms dar. Es wurde, wie auch die anderen reinen RNA-Ribozyme (RbM, Rb8/12, Rb5/10 und Rb4/8), durch In-vitro-Transkription hergestellt.

Sämtliche Ribozyme mit DNA-Modifikationen synthetisierte Dr. Sabine Müller vom Institut für Chemie / Fachinstitut für Organische und Bioorganische Chemie der Humboldt-Universität zu Berlin. Die Synthese erfolgte am Syntheseapparat „Gene Assembler Special“ (Pharmacia, Freiburg).

Um Fehler bei der In-vitro-Transkription des Ribozyms Rb5/10 auszuschließen, wurde dieses zusätzlich am Syntheseapparat synthetisiert.

In der folgenden Tabelle 1 sind alle in dieser Arbeit verwendeten Ribozyme aufgeführt.


[Seite 21↓]

Tabelle 1: Ribozymsequenzen

Die in Großbuchstaben dargestellten Basen entsprechen Ribonukleotiden. Austauschmodifikationen mit Desoxyribonukleotiden sind durch kleine Buchstaben angezeigt. Unterstreichungen weisen auf eine veränderte Base gegenüber dem Ribozym RbO hin. Ein Strich (-) kennzeichnet das Fehlen der entsprechenden Base des Ribozyms RbO. Modifizierungen mit Fluorescein und Phosphorothioaten sind durch F bzw. S ausgewiesen.


[Seite 22↓]

2.1.8  Antisense-Oligonukleotid

Zusätzlich zu den stabilisierten Ribozymen wurden die Zellen mit einem DNA-Antisense-Oligonukleotid (ASO8/12) behandelt. Mit dessen Hilfe sollte überprüft werden, ob durch die alleinige Bindung des Oligonukleotids an die Zielsequenz der PTHrP-mRNA eine Verminderung der Genexpression des PTHrP bewirkt wird. Das ASO8/12 umfasst 21 Basen und entspricht in seiner Sequenz den Flanken des Ribozyms RbO.

Zwischen die beiden Sequenzen der Ribozymflanken wurde ein Guanin eingeschoben, da sich die Flanken des Ribozyms mit dem Abstand einer Base an die PTHrP-mRNA anlagern. Für die metabolische Stabilität sorgen am 5‘- und 3‘- Ende je zwei Phosphorothioatmodifizierungen.

2.2 Methoden

2.2.1 Zellkultur

Die Kultivierung der Zellen als Monolayer erfolgte in 75 cm2-Kulturflaschen in 15 ml Leibovitz´s L‑15 Medium bei 5 % CO2, 37 °C und 98 % Luftfeuchtigkeit. Die Zellen wurden je nach Konfluenz bis zu zweimal pro Woche passagiert. Hierfür wurde das Medium abgesaugt um die Zellen dann mit 3 ml PBS zu waschen. Nach dem Abziehen des PBS erfolgte die Trypsinierung der Zellen. Dazu wurden diese ca. 10 Minuten mit 3 ml einer trypsinhaltigen Lösung (2.1.2.5) bei 37 °C im Brutschrank inkubiert. Nachdem sich die Zellen von der Oberfläche der Kulturflasche abgelöst hatten, wurde die enzymatische Aktivität des Trypsins durch die Zugabe von 3 ml Medium inhibiert. Mittels steriler Pipetten unterschiedlicher Größe fand daraufhin eine Vereinzelung der Zellen in der Zellsuspension statt. Schließlich wurde die Zellsuspension bis auf ein Zehntel abgesaugt. Für die weitere Inkubation der Zellen wurde die Zellkulturflasche mit 15 ml L-15 Medium gefüllt.


[Seite 23↓]

2.2.2  Herstellung der Substrat-RNA und der reinen RNA-Ribozyme

Sowohl die Substrat-RNA als auch die reinen RNA-Ribozyme wurden mittels der T7-RNA-Polymerase (Boehringer, Mannheim) durch In-vitro-Transkription hergestellt.

2.2.2.1 Polymerase Kettenreaktion (PCR)

Für eine In-vitro-Transkription mit der T7-RNA-Polymerase sind dsDNA-Templates notwendig, die am 5'-Ende eine T7-Promotorsequenz aufweisen.

Die dsDNA-Templates für die Substrat-RNA und die Ribozyme RbO, RbM und Rb8/12 wurden durch PCR amplifiziert. Die dafür benötigten upstream und downstream Primer lieferte ROTH (Karlsruhe) und TIB-MOLBIOL (Berlin). Im Falle der Ribozyme dienten as-ss-DNA-Templates, die ebenfalls von ROTH hergestellt wurden, als Vorlage für die PCR.

Ausgangsprodukt für das 252 Basenpaare umfassende ds-DNA-Template der Substrat-RNA bildete eine 413 Basenpaare lange Sequenz, die einem Ausschnitt des Exon III und IV der PTHrP-mRNA entspricht. Sowohl Exon III als auch Exon IV sind in allen mRNA-Typen des alternativen Spleißens enthalten. Die verwendete Sequenz war ein PCR-Produkt, das aus RT-PCR-Untersuchungen von A. Bunge (1997) im eigenen Labor hervorging.


[Seite 24↓]

Tabelle 2: Sequenzen der verwendeten PCR-Primer und DNA-Templates

 

Sequenz

Primer Up (T7-Promoter)

5‘ attaatacgactcactatag 3‘

Primer Down Substrat-RNA

5‘ ctccgaggtagctctgat 3‘

Primer Down RbO

5‘ acaaggggaagtttcgtc 3‘

Primer Down RbM

5‘ acaaggggaagtctcgtc 3‘

Primer Down Rb8/12

5‘ acaaggggaagtttcgct 3‘

dsDNA-Template
Substrat-RNA (413 nt)

5‘ ccgggcttgcctttctttttcttcccaggtgtc
ttgagcggctgctctttgtacgtctccaccttgtt
agtttcctgagttaggtatctgccctcatcatcag
acccaaatcggacggggtggttctttgtgttggga
gagggcttggagttaggggacacctccgaggtagc
tctgatttcagctgtgtggatttctgcgatcagat
ggtgaaggaagaatcgtcgccgtaaatcttggatg
gacttccccttgtcatggaggagctgatgttcaga
cacagctcttttgaggcggcggctgagaccctcca
ccgagcgcccgcaggagggcaccgcgtagctcagc
aggaacaccgcgacgctccactgctgaaccagtct
ccgctgcatcctatagtgagtcgtattaat 3‘

dsDNA-Template
Substrat-RNA (252 nt)

5‘ ctccgaggtagctctgatttcagctgtgtggat
ttctgcgatcagatggtgaaggaagaatcgtcgcc
gtaaatcttggatggacttccccttgtcatggagg
agctgatgttcagacacagctcttttgaggcggcg
gctgagaccctccaccgagcgcccgcaggagggca
ccgcgtagctcagcaggaacaccgcgacgctccac
tgctgaaccagtctccgctgcatcctatagtgagt
cgtattaat 3‘

as-ssDNA-Template RbO

5‘ acaaggggaagtttcgtcctcacggactcat
cagcatccaagctatagtgagtcgtattaat 3‘

as-ssDNA-Template RbM

5‘ acaaggggaagtctcgtcctcacggactcat
tagcatccaagctatagtgagtcgtattaat 3‘

as-ssDNA-Template Rb8/12

5‘ acaaggggaagtttcgctcacgctcat
cagcatccaagctatagtgagtcgtattaat 3‘

Die PCR wurde in einem Trio-Thermoblock (Biometra, Göttingen) durchgeführt. In Tabelle 3 ist der einfache Reaktionsansatz aufgeführt.

Da alle DNA-Templates am 3‘-OH-Ende die 20 Basenpaare lange T7-Promotor-Sequenz besaßen, konnte in allen PCR-Ansätzen der gleiche upstream Primer verwendet werden.

Die PCR-Programme umfassten 30 Zyklen und unterschieden sich lediglich durch die Annealing-Temperatur. Sie betrug für die Substrat-RNA 55 °C und für die Ribozyme 52 °C. In einem ersten Schritt wurde der Ansatz vier Minuten lang bei 94 °C denaturiert. Die folgenden 30 Zyklen enthielten einen 45 Sekunden dauernden Denaturierungsschritt bei 94 °C, einen eine Minute dauernden Schritt mit der Annealing-Temperatur und einen eine Minute langen Extensionsschritt bei 72 °C. [Seite 25↓]Nach abschließender vierminütiger Extension wurde der Ansatz auf 4 °C gekühlt. Die weitere Lagerung der Reaktionsgefäße erfolgte bei -20 °C.

Tabelle 3: PCR-Reaktionsansatz

Volumen

Reagenz

Endkonzentration

2 µl

dNTP-Mix (je 10 mM)

0,2 mM dATP, dCTP, dGTP, dTTP

10 µl

10x Reaktionspuffer

1x (0,1 ml Tris-HCl, 1,5 mM MgCl2,

50mM KCl, pH 8,3 (20 °C))

1 µl

Taq-DNA-Polymerase

1 U / 100 µl

2 µl

Primer-Mix

1,0 µM downstream und upstream Primer

variabel

Template-DNA

< 1 ng / 100 µl

auf 100 µl

Aqua bidest.

 

2.2.2.2  Kontrolle, Reinigung und Fällung des PCR-Ansatzes

Proben aus jedem PCR-Ansatz wurden zur Kontrolle des entstandenen PCR-Produkts zu gleichen Teilen mit einem DNA-Auftragspuffer (2.1.2.6) versetzt und in einem 1,5 %igen bzw. 2,5 %igem Agarosegel aufgetragen. Die Banden des entstandenen PCR-Produkts ließen sich im Gel auf einem UV-Transluminator sichtbar machen.

Zur Vorbereitung der PCR-Produkte auf ihre Verwendung in der In-vitro-Transkription war ein zweimaliges Ausschütteln des Ansatzes mit einem Volumen Phenol-Chloroform-Isoamylalkohol (25:24:1) und eines mit einem Volumen Chloroform-Isoamylalkohol (24:1) notwendig. Die in der abgezogenen wässrigen Oberphase enthaltene DNA wurde mit einem Zehntel Volumen 3 M Natriumacetat pH 5,2 und mit zwei Volumen eiskaltem 100 %igem Ethanol innerhalb von 30 Minuten bei -70 °C gefällt. Im Folgenden wurde die Fällung 15 Minuten lang in einer Kühlzentrifuge bei maximaler Drehzahl zentrifugiert. Nach dem Waschen des entstandenen Pellets mit eiskaltem 70 %igem Ethanol wurde dieses bei Raumtemperatur getrocknet und in RNase-freiem Aqua bidest. aufgenommen.


[Seite 26↓]

2.2.2.3  Zweitstrangsynthese

Die Herstellung der dsDNA-Templates der Ribozyme Rb4/8 und Rb5/10 aus ssDNA-Templates und einer Primersequenz erfolgte mit Hilfe des Klenow-Enzyms. Das Enzym katalysiert die Anlagerung von Desoxyribonukleosidtriphosphaten (dNTP) an das 3‘-OH-Ende einer Primer/Template-DNA. Die notwendigen ssDNA-Templates und der Primer wurden von ROTH bezogen
(Tabelle 4).

Tabelle 4: DNA-Templates und Primer-DNA der Klenow-Enzym-Reaktion.

 

Sequenz

as-ssDNA-Template Rb4/8

5‘ ggggaagtttcgctcacgctcatca
gcatcctatagtgagtcgtattaat 3‘

as-ssDNA-Template Rb5/10

5‘ aaggggaagtttcgctcacgctcat
cagcatccctatagtgagtcgtattaat 3‘

Primer

5‘ attaatacgactc 3‘

Der einfache Reaktionsansatz enthielt ein Volumen von 20 µl (Tabelle 5):

Tabelle 5: Reaktionsansatz zur Zweitstrangsynthese

Volumen

Reagenz

Endkonzentration

2,0 µl

10x Reaktionspuffer

1x (50 mM Tris-HCl, 10 mM MgCl2, 100 mM NaCl,

0,1 mM Dithioerythritol pH 7,5 (37 °C))

1,0 µl

dNTP

0,2 mM dATP, dCTP, dGTP, dTTP

7,5 µl

as-ssDNA-Template

37,5 µM

7,5 µl

Primer

37,5 µM

2,0 µl

Klenow-Enzym

1 U / 5 µl

Er inkubierte über 60 Minuten bei 37 °C im Trio Thermoblock (Biometra, Göttingen). Zur Reinigung wurde der Ansatz nach der Reaktion wie die PCR-Ansätze behandelt (s. 2.2.2.2).


[Seite 27↓]

2.2.2.4  In-vitro-Transkription

Die In-vitro-Transkription fand in einem Reaktionsansatz mit einem Volumen von 40 µl statt. Die enthaltenen Reagenzen sind in der Tabelle 6 aufgeführt.

Tabelle 6: Reaktionsansatz zur In-vitro-Transkription

Volumen

Reagenz

Endkonzentration

4 µl

10x Reaktionspuffer

1x (40 mM Tris-HCl, 6,0 mM MgCl2, 10 mM Dihiothreitol, 2,0 mM Spermidin, pH 8 [20 °C])

4 µl

NTP-Mix

1,0 mM ATP, CTP, GTP und 0,2 mM UTP

0,5 µl

α P 32 -UTP

3.000 Ci/mmol, 10 mCi/ml

1 µl

RNase-Inhibitor

10-50 U / 40 µl

2 µl

T7-RNA-Polymerase

1 U/µl

20 µg

Template-DNA

 

auf 40 µl

Aqua bidest.

 

Der Ansatz inkubierte drei Stunden lang bei 37 °C. Gestoppt wurde die Reaktion durch die Zugabe von einem Volumen eines RNA-Auftragspuffers (2.1.2.7). Dann erfolgte die Denaturierung der transkribierten RNA durch Erhitzung der Lösung über 90 Sekunden bei 90 °C. Nach dem raschen Abkühlen der Reaktionsgefäße auf Eis wurde der komplette Ansatz in einem 10 %igen denaturierenden Polyacrylamid-Gel (PAA-Gel) aufgetrennt. Durch die Exposition und die Schwärzung eines Röntgenfilms auf dem Gel ließen sich die Banden des Transkriptionsprodukts lokalisieren. Diese wurden mit einem sterilen Skalpell aus dem Gel ausgeschnitten und in 1,5 ml Eppendorfgefäßen mit 375 µl eines RNA-Elutionspuffers (2.1.2.4) versetzt. Die Gefäße inkubierten bei 37 °C über Nacht schüttelnd in einem Thermoblock. Nach viertelstündigem Zentrifugieren mit Maximaldrehzahl in einer Eppendorf-Tischzentrifuge wurde der Überstand abgezogen und mit einem halben Volumen 7 M Ammoniumacetat und 2,5 Volumen eiskaltem 100 %igen Ethanol bei -70 °C innerhalb von 30 Minuten gefällt. Dem Zentrifugieren der Fällung folgte die Messung der Aktivität des mit 70 %igem Ethanol gewaschenen und getrockneten Pellets einem Szintillationszähler. Aus der Aktivität ließ sich die Stoffmenge der gefällten RNA wie folgt errechnen:


[Seite 28↓]

Mit RNase-freiem Aqua bidest. wurde die Konzentration der Ribozyme auf ca. 8 µM und die der Substrat-RNA auf ca. 3 µM eingestellt. Nach dem vollständigen Lösen der Pellets und kurzer Zentrifugation wurde ein definiertes Volumen abgenommen, erneut am Szintillationszähler gemessen und die Konzentrationen der Ribozymlösungen auf 4 µM und die der Substratlösung auf 1,5 µM verdünnt.

2.2.3 5‘-Endmarkierung

Zur radioaktiven Markierung des modifizierten Ribozyms RbS wurde das DNA 5‘-End Labeling System (Promega, Mannheim) benutzt. Die darin enthaltene T4 Polynukleotidkinase (PNK) katalysiert die Übertragung der γ-Phosphatgruppe des ATP auf das dephosphorylierte 5‘-Hydroxy-Ende eines RNA- oder DNA-Templates.

Die im einfachen Reaktionsansatz enthaltenen Reagenzen sind in Tabelle 7 aufgeführt.

Tabelle 7: Reaktionsansatz zur 5‘-Endmarkierung

Volumen

Reagenz

Endkonzentration

5 µl

10x Reaktionspuffer

1x (70 mM Tris-HCl, 10 mM MgCl2,

5,0 mM Dithiothreit, pH 7,6)

1 µl

γ -P 32 ATP

4.500 Ci/mmol, 10 mCi/ml

2,5 µl

(= 10 pmol)

Ribozym

10 pmol/50 µl = 0,2 µmol

1 µl

T4 PNK

0,2-0,4 U/µl

auf 50 µl

Aqua bidest.

 


[Seite 29↓]

Der Ansatz inkubierte 20 Minuten lang bei 37 °C. Die folgende Kontrolle der Markierung und Reinigung des markierten Ribozyms über Gelelektrophorese im PAA-Gel erfolgte wie im vorhergehenden Abschnitt beschrieben.

2.2.4 Ribozymkinetik

Für die Stabilisierung des Hammerhead-Ribozyms waren verschiedene Modifikationen geplant. Diese Veränderungen wurden schrittweise durchgeführt, um ihren Einfluss auf die katalytische Aktivität des Ribozyms besser bestimmen zu können.

Die unterschiedlichen Modifikationen des Ribozyms RbO wurden in zellfreien Kinetik-Versuchen miteinander verglichen. In Anlehnung an Arbeiten von Hendry und McCall (1992, 1995a und b) erfolgten diese Versuche unter single-turnover Bedingungen. Hierbei katalysierte das Ribozym, das im eineinhalbfachem Überschuss zum Substrat vorlag, die Spaltung der Substrat-RNA.

2.2.4.1  Versuchsdurchführung

Die Substratspaltung fand in einem Volumen von 24 µl statt (Tabelle 8).

Tabelle 8: Reaktionsansatz zur Substratspaltung

Volumen

stock-Konzentration

Reagenz

Endkonzentration

8 µl

1,5 µM

Substrat-RNA

0,5 µM

6 µl

4,0 µM

Ribozym

1,0 µM

2 µl

600 mM

Tris-HCl-Puffer

50 mM

8 µl

30 mM

Magnesiumchlorid

10 mM


[Seite 30↓]

Der Reaktionsansatz wurde ohne die Zugabe von Magnesiumchlorid zusammenpipettiert, über 90 Sekunden bei 90 °C erhitzt und auf die Reaktionstemperatur von 37 °C abgekühlt. Nach fünfzehnminütiger Vorinkubation bei 37 °C erfolgte die Initialisierung der Reaktion durch die Zugabe des Magnesiumchlorids. Daraufhin wurden zu festgelegten Zeiten Aliquots von 2 µl entnommen und darin die Reaktion mit fünf Volumen Stopppuffer (2.1.2.3) gestoppt. Die Proben lagerten bis zur weiteren Verwendung bei -20 °C. Schließlich wurden alle Proben in einem 10 %igen denaturierenden PAA-Gel aufgetrennt. Das Gel trocknete nach dem Laufen zwei Stunden lang bei 72 °C auf einem Vakuum-Geltrockner. Die Auswertung der getrockneten Gele erfolgte an einem Phosphordensitometer mit Hilfe der Molecular Analyst Software (BioRad).

2.2.4.2 Modifizierung der Versuchsbedingungen

Für das Ribozym Rb8/12 wurde die Beeinflussbarkeit der katalytischen Aktivität durch den pH‑Wert, die Reaktionstemperatur, die Magnesiumkonzentration und durch den Zusatz eines Facilitator-DNA-Oligonukleotids untersucht.

Zunächst wurden in den Reaktionsansätzen einer Versuchsreihe pH-Werte von 6,0, 7,0, 7,5, 8,0, 8,5 und 9,5 durch ein Puffergemisch aus Bis-Tris-Propan und Tris-HCl eingestellt.

In weiteren Versuchen ließ sich durch die Inkubation bei verschiedenen Temperaturen (25°, 37°, 45 °C) die Abhängigkeit der katalytischen Aktivität von der Reaktionstemperatur analysieren.

Um den Einfluss der Magnesiumkonzentration auf die Reaktion zu ermitteln, wurden die Konzentration in vier Versuchen auf Werte von 2, 10, 50 und 200 mM angepasst.

Eine Facilitator-DNA ist ein ssDNA-Oligonukleotid, dessen Sequenz es ihm ermöglicht, sich direkt benachbart zum 3‘-OH-Ende des Ribozyms an die Substrat-RNA anzulagern. Dies bewirkt eine [Seite 30↓]Stabilisierung des Ribozym-Substrat-RNA-Komplexes (Nesbitt und Goodchild, 1994). Die Sequenz für die verwendete Facilitator-DNA lautet: 5‘catggaggagct 3‘.

Im Reaktionsansatz lag die Facilitator-DNA in einer Konzentration von 1 µM vor.

Des Weiteren wurde für das stabilisierte Ribozym RbS die Beeinflussung der Aktivität durch ein kationisches Lipid getestet. Das Lipid 6 aus dem PerFect Transfection Kit (Invitrogen) war in einem Reaktionsansatz in einer Konzentration von 170 µg/ml enthalten.

2.2.4.3 Versuchsauswertung

Zur Auswertung der Versuche wurden die getrockneten, radioaktiven Gele in den Belichtungskassetten des Phosphordensitometers fixiert. Darin exponierten sie Bildplatten. Die Expositionszeit[Seite 31↓]richtete sich nach der Stärke der radioaktiven Markierung. Sie lag zwischen einer Stunde und drei Tagen. Das Lesen der Bildplatten erfolgte am Phosphordensitometer. Dabei wurde durch die Molecular Analyst Software eine Lesedatei (IMG) erstellt. Mit deren Hilfe konnten die densitometrischen Werte für Substrat-, Produkt- und Ribozymbanden quantifiziert und bildhaft dargestellt werden. Für die Übergabe der Bilddaten an die Microsoft Powerpoint Software war eine Konvertierung des Dateiformat notwendig (TIF). Der densitometrische Wert für die 3‘‑Produktbande musste rechnerisch ermittelt werden, da sich diese Bande im Vergleich zu den anderen schwieriger vom Hintergrund abgrenzen ließ. Die durch die Quantifizierung erhaltenen Werte wurden zur Bestimmung der prozentualen Produktentstehung genutzt.

Für jeden Zeitwert (ein Zeitwert entspricht im Gel einer Bahn) wurde die prozentuale Produktentstehung errechnet. Sie ergibt sich aus dem Verhältnis zwischen dem bis dahin entstanden Produkt (Summe der Produktbanden) und dem insgesamt eingesetzten Substrat (Summe aus beiden Produktbanden und verbleibender Substratbande). In einem Koordinatensystem gegenüber der Reaktionszeit aufgetragen, ergab sich für die Produktentstehung eine Wachstumskurve. Diese ließ sich mit Hilfe der Software Origin anpassen. Grundlage für die Kurvenanpassung bildete die folgende exponentielle Funktion (Hendry et al. 1992):

Die Variable P t entspricht dem prozentualen Anteil des entstandenen Produkts zum Zeitpunkt t. P gleicht der maximalen Produktentstehung im Unendlichen. P Δ ist die Differenz aus der maximalen Produktentstehung und der Produktbildung zum Zeitpunkt Null. Alle drei Werte sind prozentuale Anteile in Bezug auf das gesamte Substrat. Die Reaktionszeit wird mit t dargestellt.

Der k obs -Wert [min -1] ist eine Konstante erster Ordnung für diese Reaktion. Er beschreibt die initiale und somit maximale Spaltungsrate in dieser Reaktion. In dieser Arbeit bildete er die Grundlage für die Einschätzung der Aktivität der Ribozyme.

Im Anschluss an die Auswertung der Versuche am Phosphordensitometer wurden zur direkten, nicht digitalen Dokumentation mit Hilfe der getrockneten Gele in Röntgenkassetten Röntgenfilme geschwärzt.


[Seite 32↓]

2.2.4.4  Vergleich der DNA-modifizierten Ribozyme

Für einen Vergleich der Ribozyme mit DNA-Modifizierungen wurden Änderungen in der Versuchsdurchführung und -auswertung vorgenommen. Die Reaktionsansätze besaßen ein Volumen von 15 µl. In diesen waren das Ribozym in einer Konzentration von 500 nM und das Substrat von 300 nM enthalten. Die Entnahme von Aliquots erfolgte jeweils nach 10 und 120 Minuten. Abgesehen von diesen Änderungen folgte die Versuchsdurchführung den oben genannten Schritten. Bei der Auswertung der densitometrisch ermittelten Werte für die Produktentstehung wurde eine vereinfachte Form der exponentiellen Wachstumsfunktion benutzt.

Die Funktion

verläuft durch den Ursprung des Koordinatensystems. Sie geht damit von der Annahme aus, dass zum Zeitpunkt P0 (t = 0) keine Produktbildung vorliegt. Der so ermittelte Wert k weicht von dem kobs-Wert ab, genügt jedoch für einen Vergleich der Ribozyme. Zudem lässt sich die maximale Produktbildung P bestimmen.

2.2.5 Stabilitätstest

Um die metabolische Stabilität gegenüber Exo- und Endonukleasen zu untersuchen, wurden das unmodifizierte Ribozym RbO und das Ribozym RbS 1 %igem Kälberserum (FCS) ausgesetzt.

Die Konzentration der Ribozyme in den Versuchsansätzen betrug 1 µM. Im Gesamtvolumen von 20 µl wurden 2 %ige FCS- und 2 µM Ribozymstammlösung zu gleichen Teilen gemischt und bei 37 °C inkubiert. Während des Versuchs wurden zu definierten Zeiten Proben a 2 µl entnommen. Diese wurden mit 5 Volumen Stopppuffer (2.1.2) versetzt und lagerten zunächst bei ‑20 °C, um den weiteren Abbau der Ribozyme zu stoppen. Die Proben wurden in einem 20%igen denaturierenden PAA-Gel aufgetrennt. Nach der Exposition eines Röntgenfilms auf dem Gel erfolgte dessen Auswertung an einem Densitometer. Dabei wurde der Ribozymabbau mit Hilfe der Molecular Analyst Software (BioRad) quantifiziert und die Halbwertzeit der Ribozyme berechnet.


[Seite 33↓]

2.2.6  Transfektion

Für die Wirkung des stabilisierten Ribozyms in vivo ist dessen erfolgreiche Transfizierung in die Zellen notwendig. Die Transfektion sollte mit Hilfe eines kationischen Lipids erfolgen. Es wurden in Transfektionsversuchen acht verschiedene Lipide des PerFect Transfection Kit (Invitrogen) zusammen mit dem Ribozym RbF getestet.

Das Ribozym RbF ist am 3‘-OH-Ende mit Fluorescein markiert. Nach Anregung mit kurzwelligem Licht (490 nm) emittierte Fluorescein Licht einer Wellenlänge von 515 nm und ist somit unter dem Mikroskop sichtbar.

In Vorbereitung der Transfektion wurden die Zellen der Zellinie RCC 95/96 nach der Passage in den Kulturflaschen in einer Fuchs-Rosenthal-Kammer gezählt. Dann erfolgte die Aussaat der Zellen in 8-Kammer-Objektträger. In jede Kammer wurden ca. 20.000 Zellen in 300 µl Leibovitz´s L-15 Medium gegeben. Nach Inkubation der Zellen über Nacht waren die Objektträger subkonfluent bewachsen. Um die Zellen unter serumfreien Bedingungen zu transfizieren, wurden die Kammern dreimal mit 300 µl serumfreiem Ham`s F-10 gewaschen. Danach inkubierten die Zellen mit 300 µl modifizierten Ham`s F-10.

Die Herstellung des modifizierten Ham`s F10 erfolgte eine halbe Stunde vor Beginn der Transfektion. Zunächst wurden Lipid und Ribozym getrennt in je 150 µl Ham`s F-10 aufgenommen. Die Lipidkonzentration im Medium betrug 24 µg/ml. Das Ribozym wurde im Massenverhältnis 1 : 6 zum Lipid im Medium gelöst und lag somit in einer Konzentration von 4 µg/ml vor. Nach viertelstündiger Inkubation der beiden Teillösungen bei Raumtemperatur wurden diese vereinigt und inkubierten eine weitere Viertelstunde. Das Ribozym besaß nun in diesem Medium eine Konzentration von 166 nM. Vor der Behandlung der Zellen mit dem modifizierten Medium wurde es auf 37 °C erwärmt.

Die Transfektionszeit betrug 60 Minuten. Danach wurden die Objektträger fünf Minuten lang in 1x PBS gewaschen. Die Fixierung der Zellen erfolgte durch 10minütige Inkubation der Objektträger in einer Lösung aus 3,7 % Formaldehyd in 1x PBS. Um die Zellen unter dem Mikroskop besser lokalisieren zu können, wurden die Zellkerne mit 100 µl verdünnter Propidiumjodidlösung gefärbt (10 µl 95 %ige Propidiumjodidlösung in 10 ml 1x PBS). Anschließend waren die Objektträger wiederholt in 1x PBS zu waschen. Dann konnten die Kammerwände entfernt werden. Schließlich wurden die Objektträger mit Hilfe von Hep2-Mounting Medium und einem Deckgläschen eingedeckelt. Die Begutachtung der Zellen erfolgte an einem konfokalen Mikroskop.


[Seite 34↓]

2.2.7  Behandlung der Zellen

Die Zellen des Nierenzellkarzinoms RCC 95/96 wurden in Zellkultur mit den stabilisierten Ribozymen RbS, RbSSc und dem Antisense-Oligonukleotid (ASO8/12) behandelt. Für diese Behandlung war folgende Vorbereitung der Zellen notwendig: Nach der Passage in der Kulturflasche wurden die Zellen in einer Fuchs-Rosenthal-Kammer gezählt und in 24-Loch-Platten (Nunc) ausgesät. Die Aussaat von 200.000 Zellen in 2 ml Leibovitz´s L-15 Medium je Loch erwies sich dabei als optimal, da so nach der Inkubation über Nacht bei 37 °C eine konfluente Bewachsung vorlag. Am nächsten Tag wurde das L-15 Medium abgesaugt und jedes Loch dreimal mit 2 ml Ham`s F-10 gewaschen. Dann erfolgte die Inkubation der Zellen bei 37 °C mit 250 µl modifizierten Ham`s F-10. Dabei wurden die Zellen in jeweils drei Löchern gleich behandelt. Die Herstellung des mit den Ribozymen modifizierten Ham`s F-10 ist im Abschnitt 2.2.6 beschrieben.

Das Antisense-Oligonukleotid ist für die Behandlung der Zellen in unterschiedlichen Konzentrationen (1 bis 10 µM) im Ham`s F-10 verdünnt worden. Das mit dem ASO8/12 modifizierte Medium enthielt kein kationisches Lipid.

Nach 60minütiger Inkubation wurden aus jedem Loch zwei Proben von 100 µl des Behandlungsmediums entnommen und in eine vorbehandelte (s. 2.2.8) 96-Loch-Platte (Nunc) aufgetragen. Um ein Antrocknen der Zellen zu verhindern, erfolgte sofort das Auffüllen der Löcher mit 2 ml unmodifiziertem Ham`s F10. Nach dem Absaugen der Löcher fand eine erneute Inkubation der Zellen mit 250 µl unmodifiziertem Ham`s F-10 statt. Wiederum nach 60 Minuten wurden zwei 100 µl‑Proben je Loch entnommen und in die 96-Loch-Platte pipettiert.

Insgesamt ergaben sich für beide Entnahmezeiten und für jede unterschiedliche Behandlung jeweils sechs Proben aus den Zellüberständen. Die in den sechs Proben durch ELISA ermittelten Werte für die PTHrP-Sekretion wurden in der Auswertung gemittelt. Somit resultierten für jede Behandlung zwei Werte. Der erste Wert entsprach der PTHrP-Menge, die während der 60minütigen Behandlung durch die Zellen sezerniert wurde und der zweite Wert der Menge an PTHrP, die in den 60 Minuten nach der Behandlung sezerniert wurde.

.


[Seite 35↓]

2.2.8  Enzyme-linked-Immuno-Sorbent-Assay (ELISA)

Der Prüfstein für die Wirksamkeit des stabilisierten Ribozyms bei der Behandlung von Zellen in Zellkultur war die Sekretion des PTHrP in das Kultivierungsmedium. Diese sollte sich durch erfolgreiche Spaltung der PTHrP-mRNA mittels Ribozym messbar vermindern. Für den quantitativen Nachweis des PTHrP in den Zellkulturüberständen wurde ein one-site-ELISA genutzt.

2.2.8.1 Prinzip des one-site-ELISA

Beim one-site-ELISA wird ein über unspezifische Bindungen an eine Mikrotiterplatte gebundenes Antigen durch einen monoklonalen Primärantikörper detektiert. An diesen wird ein biotinylierter Sekundärantikörper gekoppelt. Die Biotin-Streptavidin-Bindung koppelt den zweiten Antikörper mit einem Streptavidin-Peroxydase-Konjugat. Eine Erhöhung der Sensitivität des ELISA lässt sich durch das Einfügen eines weiteren biotinylierten Antikörpers (Tertiärantikörper) erzielen (Abb. 4).

Abb. 4: Prinzip des one-site-ELISA.


[Seite 36↓]

2.2.8.2  Durchführung des one-site-ELISA

In Vorbereitung des one-site-ELISA wurden verschiedene Lösungen hergestellt.

Carbonatpufferlösung pH 10,5:

Natriumcarbonat 0,25 M

Natriumazid 0,5 %

Blocklösung:

2 % BSA in 1x PBS

Waschlösung:

1 Liter 1x PBS mit 0,5 ml Tween 20

Verdünnungslösung für

Antikörper und SA-POX:

Waschlösungmit 1 % BSA

1. Antikörperlösung:

monoklonaler Primärantikörper (Maus)

1:2000 verdünnt

2. Antikörperlösung:

biotinyl. anti-Maus-IgG (Kaninchen)

1:2000 verdünnt

3. Antikörperlösung:

biotinyl. anti-Kaninchen-IgG (Ziege)

1:2000 verdünnt

SA-POX-Lösung:

Streptavidin-Peroxidase-Konjugat

1:5000 verdünnt

Citrat-Phosphatpufferlösung pH 5,0:

Citronensäure 0,15 M

Dinatriumhydrogenphosphat 0,15 M

Substratlösung:

10, 5 ml Citrat-Phosphatpufferlösung

105 µl TMB 10mg/ml

3,5 µl Wasserstoffperoxid 30 %

Bevor die Zellüberstände in die 96-Loch-Platte (ELISA-Platte) gegeben wurden, erfolgte eine Vorbehandlung der Löcher mit 20 µl Carbonatpuffer. Das so entstandene alkalische Milieu ermöglichte dem Peptid PTHrP eine bessere Bindung an die Gefäßwand.

Zusätzlich zu den Zellüberständen wurde auf jeder ELISA-Platte eine Eichreihe aufgetragen. Das PTHrP 1-86 (BACHEM, Heidelberg) nahm darin Konzentrationen von 5 nM bis 50 pM an. Die mit den Zellüberständen und der Eichreihe beschickten Platten inkubierten über Nacht bei 4 °C.

Am folgenden Tag wurden die Platten abgesaugt und auf saugfähigen und fusselfreien Papiertü-chern ausgeklopft. In jedes Loch wurden 200 µl der Blocklösung gegeben. Um die Immunreaktion zu beschleunigen, wurden alle Lösungen auf 37 °C vorgewärmt. Mit der Blocklösung inkubierten die Platten schwimmend in einem Wasserbad bei 37 °C. Zwischen allen Inkubationsschritten, die eben-[Seite 37↓]falls bei 37 °C stattfanden, war ein dreimaliges Waschen der ELISA-Platten mit der Waschlösung notwendig. Diese Waschschritte erfolgten mit Hilfe eines Mikrotiterplattenwaschers. Um Reste der Waschlösung zu entfernen, wurden die Platten nach dem Waschen auf Papier ausgeklopft.

Nach der 45minütigen Inkubation der Platten mit der Blocklösung und dem anschließenden Waschen fand eine Beladung der Löcher mit der ersten Antikörperlösung statt. Es wurden pro Loch 100 µl Lösung pipettiert. Die Inkubationszeit betrug zwei Stunden. Die sich anschließenden Inkubationen mit je 100 µl der zweiten und dritten Antikörperlösung sowie der SA-POX-Lösung dauerten jeweils eine Stunde. Nach dem dreimaligen Waschen wurden die Platten mit Citrat-Phosphatpuffer behandelt. Ein weiterer Waschschritt folgte nicht. Die Citrat-Phosphat-pufferlösung wurde durch Ausklopfen entfernt und die einzelnen Löcher mit 100 µl Substratlösung beschickt.

Die entstehende Farbreaktion ließ sich durch Zugabe von 1 %iger Schwefelsäure stoppen. Es folgte die Messung der Extinktion der ELISA-Platten am Mikrotiterplattenphotometer. Mit Hilfe der Kinetic Calc Software wurden die Messwerte ausgewertet.

2.2.9 Statistik

Die Mittelwerte und die Standardabweichungen für die kobs-Werte der Ribozyme RbO und RbS wurden aus mindestens drei Versuchen errechnet. Aussagen über die signifikante Verschiedenheit der Werte konnten mittels Student´s t-Test für unabhängige Stichproben getroffen werden.

Die Extinktionswerte, die nach der Behandlung der Zellen in den Überständen gemessenen wurden, sind für mindestens vier gleiche Behandlungen nach Abzug eines Leerwertes gemittelt worden. Mit dem Student´s t-Test für unabhängige Stichproben wurde analysiert, ob die Ergebnisse zur Kontrollbehandlung signifikant verschieden sind.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
01.09.2004