[Seite 29↓]

2  Material und Methoden

2.1 Zellkulturen

Alle Zellkulturmedien, fötales Kälberserum (FKS), Dulbecco´s Phosphat gepufferte Salzlösung (PBS) ohne Ca++/Mg++ als Standardpuffer, sowie sonstige Zusatzlösungen wurden, wenn nicht anders angegeben, von der Biochrom KG, Berlin bezogen. Kollagenase/ Dispase, Desoxyribonuclease (DNAse) E.C.3.1.21.1. und Endothelzell-Wachstumsfaktor (ECGF) wurden von Böhringer/Mannheim, Kollagenase und Rinderserumalbumin (BSA) von SERVA, Heidelberg bezogen.

Die Primärkulturen wurden von Wistar-Ratten, die von Charles River, Deutschland geliefert worden, gewonnen. Die Narkotisierung der Tiere erfolgte mit Narkoseether der Hoechst AG, Frankfurt/Main.

Die für die Zellkulturen verwendeten sterilen Plastikartikel waren von Falcon, der Firma Becton Dickinson, Heidelberg oder der Nunc GmbH, Wiesbaden.

2.1.1 Primärkulturen der zerebralen Kapillarendothelzellen

Die Präparation der zerebralen Endothelzellen wurde wie von Freyer et al. [1999] beschrieben durchgeführt.

Die Präparation der zerebralen Kapillarendothelzellen erfolgte von 3 Wochen alten Wistar-Ratten nach modifizierten Methoden von Bowman et al.[1981] und Abbott et al. [1992]. Nach dem Entfernen der Meningen und oberflächlichen Blutgefäße von den Kortizes, erfolgte die mechanische Zerkleinerung der Hemisphären. Das Homogenat wurde in DMEM mit 1,1 U/ml Kollagenase aufgenommen und bei 37 °C für 1 h inkubiert und anschließend mit kalter 25 %iger BSA Lösung 1:1 aufgefüllt und bei 2800 rpm und 4 °C für 20 min zentrifugiert. Das Pellet wurde in DMEM mit 0,1 % Kollagenase/Dispase resuspendiert und bei 37 °C für 30 min inkubiert. Nach der Zentrifugation bei 1800 rpm, wurde das Pellet in DMEM mit 0,05 % DNAse resuspendiert und für 1 min inkubiert. Nach dem Waschen mit DMEM wurde die Zellsuspension in Wachstumsmedium (DMEM mit 20 % FCS; 100 U/ml Penicillin; 100 µg/ml Streptomycin; 1,2 mM N-Acetyl-L-Alanyl-L-Glutamin; 100 U/l Heparin; 20 mg/l Endothelzell-Wachstumsfaktor (ECGF); 110mg/l Natrium-Pyruvat (Sigma, St. Louis, MO) und L-Valin ersetzt durch D-Valin zur Unterdrückung der Astrozytenproliferation
[Abbott et al., 1992] aufgenommen. Anschließend wurde die Zellsuspension in
[Seite 30↓]Kollagen-G-beschichteten Zellkulturplatten (mit 24 Vertiefungen) ausgesät.

Das Medium wurde täglich gewechselt. Nach 6-8 Tagen bildeten die Kulturen einen konfluenten Monolayer und wurden für die Experimente verwendet.

2.1.2 Die Zell-Linie L929

Für die Durchführung des Bioassays zur Bestimmung des freien TNF-α war die routinemäßige Haltung der murinen Fibroblasten-Zell-Linie L929, die durch Dr. Scholz von der Schering AG Berlin uns freundlicherweise zur Verfügung gestellt wurde, notwendig.

Die Zellen wurden in 275 cm2 Kulturflaschen mit 45-50 ml Medium kultiviert. Das Wachstumsmedium hatte folgende Zusammensetzung:

RPMI 1640 (Kat. Nr. F1215) mit

Die Zellen wurden 2-mal pro Woche mit einer Trypsin/ EDTA -Lösung passagiert.

2.2 Die Stimulation der Zellkulturen

2.2.1 Materialien

Zellwände von S. pneumoniae (PCW)

Die PCW wurden von Dr. W. Bürger, sowie später von Dr. R. Schumann im Institut für Mikrobiologie der Charité, nach einer modifizierten Methode von Tuomanen et al. [1985] präpariert und uns als Suspension in pyrogenfreier NaCl-Lösung zur Verfügung gestellt. Die Modifikation erfolgte nach Weber et al. [1995].

Bakterien eines unbekapselten Stammes (PnR-527, Jena) von S. pneum. wurden über Nacht auf Columbia Agar Platten kultiviert, anschließend in pyrogenfreier NaCl-Lösung suspendiert und bei 100 °C für 20 min inaktiviert. Die inaktivierten Bakterien wurden durch eine Ultraschallbehandlung (2 x 7 min/150 W) desintegriert. Nach mehreren Waschschritten wurde die Suspension auf eine optische Dichte von 0,66 bei 620 nm eingestellt, die mit 107 colony forming units (cfu)/ml korreliert. Deshalb erfolgen alle Konzentrationsangaben für die PCW in cfu/ml. Die Suspension mit einem pH-Wert von 7,4 enthielt weniger als 1 % intakte Zellen, [Seite 31↓]weist keine nachweisbaren Konzentrationen von DNA/RNA (< 0,1 ng/ml) und Protein
(<1 µg/ml) auf.

Medium

Die Stimulation der Zellkulturen erfolgte in serumfreien VLE RPMI 1640 Medium (Biochrom KG), dem Penicillin/Streptomycin (100 E/ 100 µg/ml) zugesetzt wurde.

Die folgenden Peptide wurden alle von Sigma St. Louis, MO bezogen. Der SP Antagonist SR140333 wurde uns freundlicherweise von Monsieur Xavier Emonds-Alt von Sanofi Recherche in Montpellier/ Frankreich zur Verfügung gestellt.

Calcitonin Gene Related Peptide (CGRP) rat 1-37

Ratten Synthetisches CGRP wurde in einer 10 µM Stammlösung in 0,9 %iger NaCl-Lösung (Braun, Melsungen) angesetzt und in Aliquots zu je 50 µl bei –20 °C gelagert.

Calcitonin- Gene- Related Peptide Fragment 8-37 (CGRP 8-37)

Human Synthetisches CGRP8-37 wurde in einer 100 µM Stammlösung in 0,9 %iger NaCl-Lösung angesetzt und in Aliquots zu je 100 µl bei –20 °C gelagert.

Substanz P (SP)

Synthetisches SP wurde in einer 1 mM Stammlösung in 0,9 %iger NaCl-Lösung angesetzt und in Aliquots zu je 50 µl bei –20 °C gelagert.

Substanz P Fragment 1-4

Synthetisches SP Fragment 1-4 wurde in einer 2 mM Stammlösung in 0,9 %iger NaCl-Lösung angesetzt und in Aliquots zu je 50 µl bei –20 °C gelagert. In den Experimenten wurden Endkonzentrationen von 200 nM und 2000 nM eingesetzt.

SR140333

Eine 1 mM Stammlösung wurde in Dimethylsulfoxid (DMSO)(Sigma) gelöst und in Aliquots zu je 100 µl bei –20 °C gelagert.

Für alle genannten Peptide wurden die eingesetzten Endkonzentrationen jeweils vor Beginn der Experimente frisch angesetzt.


[Seite 32↓]

2.2.2  Durchführung der Stimulation

Für die Durchführung der Experimente erfolgte die Stimulation der zerebralen Endothelzellen in Kulturplatten mit 24 Vertiefungen.

Nach dem Entfernen des Wachstumsmediums wurden 400 µl serumfreies RPMI 1640 aufgetragen und, wenn nicht anders angegeben, das Standardvolumen von 20 µl PCW, dass entspricht 5 x 105 lebenden Pneumokokken/ml bzw. 500 x 103 cfu/ml, zugesetzt; für die Zellkontrollen jeweils weitere 20 µl des serumfreien RPMI Medium. Bei allen durchgeführten Experimenten wurden jeweils 1-2 Proben mit der Standardkonzentration PCW als Positivkontrolle und 1-2 Proben als Negativkontrolle mitgeführt. Die Inkubation erfolgte bei 37°C im Inkubator mit 5 % CO2 und 95 % Luftfeuchtigkeit.

Zusätzliche Stimulanzien wie CGRP, SP, SP1-4, sowie die Antagonisten CGRP8-37 und SR140333 - in ihren verschieden angegebenen Konzentrationen - wurden gleichzeitig mit PCW und dem Kontrollmedium zugegeben.

Für die RNA-Isolation wurden die stimulierten Zellen nach 4 h geerntet, wenn nicht anders angegeben.

Zur Untersuchung der Freisetzung von TNF-α, IL-1β, IL-6, IL-10 und MIP-2 wurden die Überstände der stimulierten Zellen nach 4 h und 8 h und für die Bestimmung von AM(1-50) zusätzlich nach 0 h und 12 h abgenommen und bis zur Messung bei –70 °C aufbewahrt.

2.3 RNA Isolation

2.3.1 Materialien

Die RNA-Isolation erfolgte mit Hilfe des RNaid®Plus Kit (Bio 101, dianova, Hamburg)

Die RNA-Extraktion wurde modifiziert nach Chomczynski & Sacchi [1987] unter Verwendung von Lösungen des Kits (wenn Firma nicht anders angegeben).

Folgende Lösungen und Substanzen des Kits (Bio 101) wurden verwendet:


[Seite 33↓]

Der Puffer wurde nach Angaben des Herstellers mit flüssigen Phenol (Sigma-Aldrich, Deisenhofen) ad 100 ml aufgefüllt und als gebrauchsfertiges Phenolsäuregemisch bei 4 °C gelagert.

Diese Lösung wurde mit absolutem Ethanol (Merck, Darmstadt) nach Anweisung des Herstellers zu einer Gebrauchswaschlösung verdünnt.

Weitere verwendete Materialien:

2.3.2 Durchführung der RNA-Isolation

Bei allen Arbeitsschritten wurde darauf geachtet, dass möglichst wenig RNAse-Kontamination auftritt. Maßnahmen waren: das Tragen von neuen puderfreien Handschuhen (Hartmann, Heidenheim), sterile Pipettenspitzen (Eppendorf, Hamburg), gesonderte RNA-Pipetten (Eppendorf), schnelles Überführen der Proben in flüssigen Stickstoff vor Lagerung bei –70 °C.

Die RNA-Isolation wurde wie folgt durchgeführt:

1. Zellernte

Nach dem Abnehmen der Überstände von den stimulierten Zellen und der Lagerung der Überstände für spätere Proteinbestimmungen bei –70 °C, erfolgte die Zugabe von 800 µl Zelllysislösung je Vertiefung der Zellkulturplatte. Die lysierten Zellen wurden gut resuspendiert und das komplette Volumen in 2 ml-Röhrchen überführt, in flüssigem Stickstoff schnell eingefroren und bis zur RNA Isolation bei –70 °C gelagert.

2. RNA-Isolation

Die Proben wurden auf Eis aufgetaut und gut durchmischt. Anschließend erfolgte die Zugabe des Phenolsäuregemisch im Verhältnis 1:1 zum Probenvolumen (800 µl) und die Zugabe von 400µl Chloroform-Isoamylalkohol 24:1 (50 % des Phenolsäuregemisch-volumen).
[Seite 34↓]Alles wurde gut durchmischt bis das Probengemisch homogen weißlich trüb war und für
10 min auf Eis gelagert wurde.

Es folgte das Zentrifugieren der Proben in vorgekühlter Zentrifuge (Hettich, Tuttlingen) bei
4 °C und 14000 rpm für 20 min. (Durch die Zentrifugation setzten sich am Boden in der Chloroform- und Phenolphase die Proteine und Lipide etc. ab. Die Interphase enthielt leichte Proteine und DNA und in der Oberphase befand sich die RNA.)

Während der Zentrifugation wurde die RNAMATRIX® gut durchmischt und jeweils 10 µl in neue 0,5 ml-Röhrchen überführt.

3. RNA Bindung an RNA Matrix

Von der oberen Phase wurden vorsichtig ¾ ca. 600 µl abpipettiert, in die vorbereiteten RNA-Matrix-Röhrchen überführt, gut durchmischt - bis die Suspension homogen erschien. Die Proben wurden bei RT für 10 min stehen gelassen und zwischenzeitlich alle 2 min mit der Mikrozentrifuge (Fisher Scientific, Co.) anzentrifugiert, danach wiederholt bei 8000 rpm für 30 sec zentrifugiert und die Überstände dekantiert.

4. RNA- Reinigung

Die Reinigung der RNA erfolgte durch Zugabe von je 100 µl RNA-Waschgebrauchslösung zur Probe. Die Probe wurde solange durchmischt, bis sich das Pellet homogen in der Waschlösung verteilte. Wiederholt wurde bei 8000 rpm für 30 sec zentrifugiert und der Überstand verworfen. Der Waschvorgang wurde insgesamt 3-mal durchgeführt.

Nach dem letzten Waschvorgang wurde der Überstand mit der Pipette gründlich abgezogen und die Proben mit offenem Deckel für ca. 45 min stehen gelassen, damit sich der Alkohol verflüchtigen und das RNA-Pellet trocknen konnte.

5. RNA von Matrix lösen

Auf das getrocknete Pellet wurden 10 µl DEPC-Wasser (RNAse Inhibitor) zugegeben und die Suspension gut durchmischt, bis sie homogen weißlich trüb war. Die Suspension wurde bei 55 °C auf vorgeheizten Thermal-Cycler (Perkin Elmer Cetus, USA) für 10 min inkubiert. Während der Inkubation wurden SpinX-Spezialfilterröhren mit 2 µl DEPC-Wasser benetzt und auf Eis gestellt.

Nach der Inkubation wurden die Proben bei 10000 rpm und RT für 2 min in Hettich-Zentrifuge zentrifugiert. Der Überstand wurde mit der Pipette in vorbereitete
[Seite 35↓]SpinX-Spezialfilterröhrchen überführt, bei 3000 rpm für 2 min in der Mikrozentrifuge anzentrifugiert und danach auf Eis gestellt.

Um die Ausbeute an RNA zu erhöhen, wurde der Vorgang (5.) wiederholt.

6. Abschlusszentrifugation

Abschließend wurden die SpinX-Spezialfilterröhrchen, bei 5000 rpm und 4 °C für 5 min zentrifugiert, die Filter entnommen. Die RNA wurde entweder bei –70 °C gelagert oder gleich für die cDNA-Synthese genutzt.

7. Überprüfung der RNA-Extraktion durch Agarose Gel Elektrophorese

Die RNA-Isolation wurde mit Hilfe eines 1 %igen Agarosegels überprüft. Das Agarosegel wurde wie folgt mit 1 x TBE-Puffer (Rezeptur des TBE-Puffers siehe Auswertung) hergestellt:

  1. Pro 100 ml Agarose (Sigma) wurden 5µg Ethidiumbromid (Sigma) zugegeben.
  2. Das Gel wurde handwarm in die Gelkassetten, die zuvor mit DEPC-Wasser ausgewaschen wurden, gegossen und trocknen gelassen.
  3. 2 µl RNA-Probe wurden mit 3 µl Ficoll (Sigma) und 10 µl H2O gemischt und jeweils in die Probentaschen aufgetragen. Zusätzlich wurde eine 100 bp DNA Leiter 1,0 µg/µl (GIBCOBRL, Deutschland) mitgeführt.
  4. Das Gel wurde bei 70 V für 40 min in einer 150 ml-Gelkassette mit 1 x TBE-Puffer gefüllt und laufen gelassen.
  5. Die Auswertung der rRNA erfolgte mit dem UV-Transilluminationssystem (Fisher Scientific) und wurde mit einer Sony-Kamera fotografisch dokumentiert.

Fotometrische Messung der RNA

In Vorbereitung auf die cDNA-Synthese wurde der Gehalt an RNA gemessen. Für diesen Zweck wurden die RNA Proben 1:40 verdünnt und am Fotometer bei 260 nm gemessen.

Der Gesamt RNA Gehalt wurde nach folgender Formel berechnet:

x µg RNA/µl = OD 260nm * 40 (Verdünnungsfaktor) * 0,04 (RNA Faktor)

Anschließend wurde die RNA für die cDNA-Herstellung auf eine Konzentration von 0,5 µg eingestellt.


[Seite 36↓]

2.4  Reverse Transkription der mRNA in cDNA

Die cDNA-Synthese erfolgte in modifizierter Form nach Murphy et al. [1993].

2.4.1 Materialien

Folgende Lösungen wurden verwendet und bei –20 °C gelagert:

  1. 5 x First Strand Buffer
  2. „Moloney- Murine Leukemia Virus Reverse Trankriptase“ (M-MLV RT) 200 U/µl
  3. DTT 1 mM
  4. dNTP Mix 10 mM
  5. RNasin® Ribonuklease Inhibitor 2500 Units (Promega, Deutschland)
  6. pd(T)12-18 OligoDT Primer (Pharmacia Biotech, Freiburg, Deutschland)
  7. destilliertes Wasser, pyrogenfrei (Braun, Melsungen)

(Substanzen 1-4 wurden von GIBCOBRL, Deutschland bezogen.)

2.4.2 Durchführung

Die RNA wurde in 0,5 ml-Eppendorfröhrchen überführt, bei 85 °C für 5 min im Thermal-Cycler erhitzt (DEPC sollte verdampfen, da es die Reverse-Transkriptase hemmt) und anschließend auf Eis gestellt.

In der Zwischenzeit wurde der Gesamtmix hergestellt. Pro Probe wurde ein 40 µl Ansatz angesetzt. Zur Herstellung des Ansatzes siehe Tab. Nr.1, 3. Spalte. Der Mix wurde in jede RNA-Probe (0,5µg) pipettiert und mit destilliertem H2O ad 40µl aufgefüllt. (Mit dem Volumen des destilliertem H2O musste ggf. variiert werden.)


[Seite 37↓]

Tab. 1: Gesamtmix für cDNA-Synthese

Reagenzien

-RT Ansatz in µl

(20µl Mix/ 0,5 µg RNA)

+RT Ansatz in µl

(40µl Mix/ 0,5 µg RNA)

5x First Strand Buffer

4

8

dNTP (10mM)

2

4

RNasin ® 2500U

0,5

1

pd(T)12-18 Primer 0,2mg/ml

1

2

M-MLVRT (200 U/µl)

-

2

DTT (1mM)

0,5

1

destilliertes H2O

9,5

ad 40

Das cDNA-Synthese-Gemisch wurde gut gemischt und im Thermal-Cycler bei 21 °C für 10 min inkubiert. Anschließend wurde gleich mit Hilfe der Programmeinstellung am Thermal-Cycler die Reverse-Transkription bei 42 °C für 45 min und bei 99 °C für 5 min durchgeführt. Nach Abschluss der cDNA-Synthese wurden die Proben kurz zentrifugiert und bis zur Durchführung der RT-PCR bei –20 °C gelagert.

Als Negativkontrollen in der PCR dienten die Minus-Reverse Transkription (-RT).

Der Ansatz erfolgte wie bei der cDNA Synthese, jedoch wurde im Gesamtmix die

M-MLVRT durch destilliertes H2O ersetzt. Für diese Proben wurden 0,5 µg RNA in einem

20 µl Ansatz (Tab.1, Spalte 2) pro Probe eingesetzt.

2.5 Reverse Transkriptase (RT)-PCR

Die semiquantitative RT-PCR erfolgte in modifizierter Form nach der Methode von Siegling et al. [1994]. Von Prof. Volk (Immunologie der Charité) wurde uns freundlicherweise das rattenspezifische Kontrollfragment (KF), welches u.a. Standard DNA für β-Actin, IL-1β,
IL-6, IL-10, TNF-α sowie MIP-2 enthält, zur Verfügung gestellt.


[Seite 38↓]

2.5.1  Materialien

  1. Folgende Materialien wurden für sämtliche PCR genutzt, wenn nicht anders angegeben.
  2. Thermal-Cycler (Perkin Elmer Cetus, 1992 )
  3. 0,5 ml-Eppendorfröhrchen
  4. Pipetten und Pipettenspitzen (Eppendorf)
  5. AmpliTaq® DNA Polymerase (5 Units/µl); 10 x PCR Puffer II; MgCL2 25 mM (Perkin Elmer, Deutschland)
  6. 10 mM Desoxynucleosidtriphosphate (dNTP) (Diese Stammlösung wurde aus einem dNTP Satz 100 mM [dATP, dCTP, dGTP, dTTP je 25 mM] von Pharmacia, Deutschland hergestellt und in 100 µl Aliquots bei – 20 °C gelagert.)
  7. Sense Primer und die mit Cy-Thiolation am 5‘-Ende markierten Antisense Primer (Pharmacia)
  8. destilliertes Wasser (pyrogenfrei) (Braun) als Verdünnungsflüssigkeit
  9. Mineralöl für Molekularbiologie (Perkin Elmer)

2.5.2 Semiquantitative β–Actin PCR

Zur Überprüfung der cDNA-Synthese und zur Einstellung eines gleichen cDNA-Eingangsvolumen der Proben in der PCR diente die β-Actin PCR. β-Actin wird von einem „Housekeeping gene“ in allen Zellen unabhängig vom Aktivierungszustand der Zelle exprimiert und eignet sich daher cDNA quantitativ zu erfassen. Das rattenspezifische KF enthält β-Actin cDNA mit einer Länge von 601 Basenpaaren (bp). β-Actin der hergestellten cDNA der Proben haben eine Länge von 762 (bp). Das Prinzip der kompetitiven PCR besteht darin, dass β-Actin cDNA (Ziel-DNA) und Standard β-Actin KF (Standard-DNA) um die Primer konkurrieren. Die PCR wurde so oft wiederholt, bis ein Verhältnis von 1:1 zwischen der Ziel-cDNA und der β-Actin-DNA des KF erreicht wurde.

Die β-Actin-PCR wurde wie folgt durchgeführt.

Zuerst wurde 1 µl cDNA (Probe) in die PCR-Röhrchen pipettiert. Anschließend wurde 1 µl aus der KF-Stocklösung (Standard DNA) in Zehnerschritten 1:105 verdünnt und der „Mastermix“ für ein PCR-Gesamtvolumen von 25 µl/Probe angesetzt. (Für den Ansatz des Mastermixes siehe Tab. 2, Spalte 2.)


[Seite 39↓]

Aus dem Mastermix wurden 24 µl pro 1 µl cDNA Probe hinzupipettiert, gut durchmischt sowie 1Tropfen Öl je Probe hinzugefügt.

Die PCR wurde im Thermal-Cycler unter folgenden Bedingungen durchgeführt. Zuerst findet eine Denaturierung bei 95 °C für 5 min statt. Für die für die folgende PCR-Schleife gilt 1. bei 95 °C für 1 min (Denaturierung) 2. bei 68 °C für 1 min (Anlagerung der Primer); 3. bei 72 °C für 1 min (Verlängerung der Primer). Die PCR-Schleife umfasst 28 Zyklen und abschließend wird die Synthese bei 72 °C für 10 min vervollständigt.

Tab. 2: Mastermix für 25µl PCR Ansatz

Reagenzien für PCR Mastermix

Ansatz je PCR Probe in µl

β -Actin PCR

Zytokin PCR

destilliertes Wasser

17,9

17,8

10 x PCR Puffer II

2,5

2,5

MgCl 2,5 mM

1,5

1,5

Desoxynucleosidtriphosphate (dNTP) 10mM

1

1

Sense Primer 10µM

0,5

0,5

Cy5 Antisense Primer 10µM

0,5

0,5

[Kontrollfragment ] 10 -5 (verdünnt 1:10 5 )

1

1

Taq Polymerase 5 Units/µl

0,1

0,2

Die Auswertung der PCR Produkte erfolgte wie unter Abschnitt 2.6. beschrieben.

2.5.3 Semiquantitative Zytokin PCR

Nachdem die cDNA auf ein gleiches Eingangsvolumen im Verhältnis 1:1 zum KF eingestellt wurde, erfolgte die Zytokin-PCR (Ansatz siehe Tab. 2, Spalte 3). Die Zytokin-PCR ist in der Durchführung der β-Actin-PCR sehr ähnlich. Sie unterscheidet sich nur durch die konstante Zugabe der jeweils gleichen cDNA-Menge pro Ko-Amplifikation mit dem KF. Für jede Zytokin-PCR wurden mehrere dezimale Verdünnungsstufen des KF eingesetzt. Dabei stellten serielle Verdünnungen des KF sicher, dass die Ko-Amplifikation im linearen Bereich stattfand.

Alle PCR (β-Actin, Zytokin, Rezeptoren usw.) wurden unter gleichen Reaktionsbedingungen durchgeführt. Nur die Anlagerungstemperatur (Annealing Temperature) und Zyklenanzahl wurde für die jeweilige PCR und deren Primer optimal eingestellt (siehe Abschnitt 2.5.2.). In den folgenden Tabellen (3 und 4 ) werden deshalb nur die Annealing Temperature (AT) und die Zyklenanzahl angegeben.


[Seite 40↓]

Die Primer wurden nach den von Siegling et al. [1994] beschriebenen Sequenzen (Tab. 3) gewählt und in den jeweiligen PCR eingesetzt.

Mit der semiquantitativen PCR Methode sind TNF-α, IL-1β, IL-6, IL-10 und MIP-2 bestimmt worden (siehe auch Tab. 3).

Tab.3: Primersequenzen und PCR-Bedingungen

cDNA

Primersequenzen (Siegling et al.,1994)

AT;

Zyklen

PCR Produkte

in Basenpaaren (bp)

Sense Primer

5´→3´

Antisense Primer

5´→3´

Proben cDNA

KF

TNF-α

CGAGTGACAAGCCCGTAGCC

GGATGAACACGCCAGTCGCC

65°C; 38

468

339

IL-1β

CCAGGATGAGGACCCAAGCA

TCCCGACCATTGCTGTTTCC

60°C; 38

519

379

IL-6

CTTCCAGCCAGTTGCCTTCT

GAGAGCATTGGAAGTTGGGG

64°C; 40

496

379

IL-10

TGCCTTCAGTCAAGTGAAGACT

AAACTCATTCATGGCCTTGTA

60°C; 40

346

421

MIP-2

CTGGTCCTGCTCCTCCTGCT

TTTGATTCTGCCCGTTGAGG

60°C; 38

316

218

2.5.4 PCR ohne kompetitives Kontrollfragment

Für den Nachweis der cDNA der CGRP1-Rezeptoren (CRLR und RDC-1), des Adrenomedullins (AM) und des L-1-Adrenomedullinrezeptors (ADM-R) (siehe auch Abschnitte 1.8.1. und 1.8.3.) wurden keine Ko-Amplifikationen mit einem Kontrollfragment durchgeführt. Die durch β-Actin-PCR eingestellte cDNA-Konzentration wurde in der jeweiligen PCR eingesetzt (siehe auch unter 2.5.2.).

Der PCR-Ansatz erfolgte wie bei der Zytokin-PCR (Tab. 2, Spalte 3), jedoch ohne Zugabe von KF und mit einer höheren Primerkonzentration von 50 µM (Endkozentration 1µM). Die Sense Primer und Cy5 markierten Antisense Primer sind von der Firma Biosource Europe S.A. (Nievelles, Belgien) synthetisiert worden.

In Tabelle 4 werden für die untersuchten cDNAs Annealing Temperature (AT), Zyklenanzahl, cDNA-Basenpaarenlängen (bp); Primer Sequenzen und Referenzen angegeben. (weitere PCR-Reaktionsbedingungen siehe unter 2.5.2.)


[Seite 41↓]

Tab. 4: Primersequenzen und PCR-Bedingungen für PCR ohne KF

cDNA

(AT; Zyklen)

cDNA Länge (bp)

Primersequenzen

Sense Cy5 Antisense

Referenzen

CRLR

(62°C; 40)

501

1299-1320

5´TTACAGCCCATCAGGTAAAGA 3´

1781-1801

5´AGTGCATGAGAATGTGCATGA 3´

Chang et al., 1993;

Flühmann et al., 1997

RDC-1

(60 °C; 40)

239

839-861

5´GATCATCTTCTCCTACGTGGTGG 3´

1055-1078

5´AAGATGAAGGCCTTCATCAGCTCG 3´

Mirtella et al., n.p.

Autelitano, 1998

L1 (ADM-R)

(57 °C; 40)

630

771-791

5´ATCCCACTGCCTGAGGTGGTA 3´

1380-1401

5´GGTGAGGTGTTCGGAGGCAGA 3´

Kapas et al., 1995

Autelitano, 1998

AM

(60 °C; 40)

541

279-302

5´GTGGGCGCTAAGTCGTGGGAAGAG 3´

796-819

5´ATTGTCTCAGTCCGCTCAGGGTGC 3´

Wang et al., 1995; Nagata et al, 1999

Zur Auswertung siehe unter 2.6.

Qualitätssicherung der PCR:

Zur Sicherung der Qualität der PCR wurden die PCR-Gesamtmixe (ohne cDNA und KF),
1-mal nur KF,1-mal nur cDNA, sowie Minus-RT Proben mit jeder PCR mitgeführt.

2.6 Auswertung der PCR Produkte

2.6.1 Material und Methode

Nach der PCR wurden die Produkte von der Ölphase getrennt und mit einer 3 % Dextran blue/50 % Glyzerollösung (Sigma) vermischt und anschließend jeweils 10 µl aus dem Gemisch auf eine kleine Gelkassette mit einen 5%igen, nicht denaturierten Polyacrylamidgel in 1 x TBE Puffer am Sequenzer (ALFexpress, Pharmacia) aufgetragen.

Die Gele liefen in 2 l 1 x TBE Puffer unter folgenden Bedingungen:

Spannung: 900 V; Stromstärke: 50 mA; Leistung: 35 W; Laufzeit: ∅ 100 min.


[Seite 42↓]

Materialien und Lösungen

Alle Substanzen wurden von der Firma Roth, Karlsruhe bezogen, wenn nicht anders angegeben.

Rezeptur für ein 5 % Polyacrylamidgel (40 ml)

 

  • 54,0 g Tris Ultra Qualität (Tris(hydroxymethyl)aminomethan)
  • 27,5 gBorsäure
  • 20,0 ml 0,5 M EDTA (Ditnatriumsalz Dihydrat) Titrierkomplex (pH 8,0)
  • ad 1000 ml mit destilliertes H2O

Das Gel trocknete für jeweils 40-60 min in der Kassette, bevor die Proben aufgetragen wurden.

Die Auswertung erfolgte nach Auftrennung der PCR-Produkte in dem 5 %igem Polyacrylamidgel (s.o.). Dabei wurden die CY5-markierten Banden mit Hilfe eines Fluoreszenz-Laser-Detektors des DNA-Sequenzers (ALFexpress; Pharmacia Biotech) erfasst und mit Hilfe der ALF-express™Software (Pharmacia) analysiert und quantifiziert.

Die Angabe des Gehaltes an Zytokin-cDNA in der Probe erfolgte in Units. 1 Unit entsprach dabei der Menge an KF, die mittels PCR bei den gegebenen Reaktionsverhältnissen eine im vorliegenden Auswertungssystem gerade noch messbare Bande erzeugte. Bei einem gleichen Mengenverhältnis zwischen dem KF und der cDNA wurde die cDNA in Units entsprechend der dezimalen Verdünnungsstufe des KF berechnet.

Für die Auswertung der PCR-Produkte, die ohne KF Ko-Amplifikation durchgeführt worden sind (siehe unter 2.5.4.), entsprach die analysierte Länge (Peak Area) der Bande der Menge an cDNA.


[Seite 43↓]

Die Reihe 1 in Abb. 2 stellt eine noch unverdünnte cDNA-Probe dar. Die Menge der cDNA (Peak Area 3248) ist größer als die des KF (Peak Area: 2171). Nachfolgend mussten die Proben cDNA weiter verdünnt werden, um ein Verhältnis 1:1 zwischen KF-cDNA und der Ziel-DNA wie in Reihe 2 zu erhalten. Die 2. Reihe zeigt das Verhältnis 1:1 zwischen dem β-Actin-Gehalt des KF und der Proben cDNA. Die „Peak Area“ entspricht der Menge der cDNA und die „Run Time“ der Basenpaarenlänge (Die β-Actin cDNA des KF ist kürzer als das der Proben cDNA (siehe unter 2.5.2.).) Diese Probe (2) wurde in jeder Zytokin-PCR 1:3 vorverdünnt eingesetzt.

Abb. 2: Bildbeispiel für β-Actin Auswertung mit Hilfe der ALF-express™ Software

Bei der Auswertung mit dem ALFexpress Sequenzer war es nicht möglich die Basenpaarenlänge der PCR Produkte zu bestimmen, deshalb wurden zur Kontrolle der gesuchten DNA Banden die Proben auf einem 1 %igem Ethidiumbromid-Agarosegel zusammen mit einer 100 bp DNA Leiter (GIBCOBRL) aufgetragen. (siehe auch unter 2.3.2.)

2.7 Die Bestimmung von TNF-α mit TNF-α-Bioassay

Die Menge an freiem, biologisch wirksamen TNF-α wurde im Bioassay bestimmt. Grundlage des Bioassays ist die toxische Wirkung von TNF-α auf die Fibroblasten-Zell-Linie L929 der Maus [Flick & Gifford, 1984]. Die Zellen wurden - wie unter Punkt 2.1.2. erläutert - kultiviert. Die Durchführung des TNF-α Bioassay erfolgte wie von Freyer et al. [1999] beschrieben. Die L929-Zellen wurden mit den Zellkultur- Überständen in Anwesenheit von 1 [Seite 44↓]µg/ml Actinomycin D für 20 h inkubiert. Die Zellviabilität wurde durch die Aufnahme von Kristallviolett in den lebenden Zellen bestimmt, welche spektrophotometrisch bei 595 nm mit einem MR5000 ELISA-Reader (Dynatech, Denkendorf) quantifiziert wurde. Als Standard, in equivalenten Konzentrationen, diente rekombinantes TNF-α der Ratte, das uns von
Dr. P. Scholz von der Schering AG, Berlin zur Verfügung gestellt wurde.

2.8 Quantitative Bestimmungen der Zytokine mit dem ELISA

Die quantitative Bestimmung der Zytokine (IL-1ß; IL-6; IL-10) und MIP-2 in den Überständen der Proben (nach 8 h Stimulation) erfolgte mit Hilfe der ELISAs von Biosource Deutschland GmbH (Ratingen). Die Durchführung der ELISA erfolgte nach der beiliegenden Vorschrift des Herstellers.

2.9 Quantitative Bestimmung von SP und SP1-7 mit dem RIA

Sämtliche RIAs wurden während meines Laboraufenthaltes im Oktober 1998 bei Prof. Nyberg, Division of Biological Dependence on Drug Research, Departmemt of Pharmacology, University of Uppsala in Schweden durchgeführt.

Von den gleichen Überständen, von denen schon die Zytokine bestimmt worden waren, erfolgte mit Hilfe der RIA die Messung von SP und SP1-7. Da die Überstände einen relativ geringen Proteingehalt hatten, konnte auf eine Reinigung der Proben verzichtet werden. Der RIA beruht auf dem von Berson und Yalow [1968] beschriebenen Prinzip.

2.9.1 Materialien und Methodik

Alle Materialien, Antikörper, Substanzen wurden mir freundlicherweise im Gastlabor zur Verfügung gestellt.

Die Tracer (Indikatoren) sind Substanz P Analoge Tyr8-SP (Penisula, USA), Tyr1-SP1–7 die nach der Standard Chloramin-T Methode mit 125I-Na markiert im Labor hergestellt wurden. Die Antikörper wurden ebenfalls im Labor hergestellt. Die allgemeine Prozedur der Antikörperherstellung wurde von Persson et al. [1992] (Mitarbeiter des Labors) publiziert.


[Seite 45↓]

Antikörper

Die SP-Antikörper wurden von einer Stammkonzentration 1:100 auf eine Gebrauchslösung von 1:80 000 mit Gelpuffer verdünnt.

Der SP1-7 Antikörper wurde für den Test 1:220 000 mit Gelpuffer verdünnt.

SP/ SP 1-7 Standard

Aus den synthetischen Peptiden SP und SP 1-7 (Penisula, USA) wurden Stocklösungen
von 9 x 10-5 M angesetzt. 10 µl dieser Lösung wurden jeweils mit 990 µl MeOH/HCL 1:1, auf 9 x 10-7 M verdünnt und dienten als Stammlösung für den Standard. Insgesamt wurden 9 Standardkonzentrationen zwischen 9 x 10-8 M bis 9 x 10-12 M gewählt.

Folgende Lösungen und Puffer wurden frisch angesetzt:

 

  • 50 ml MeOH
  • 5 ml 1M HCL
  • 45 ml destilliertes H2O

 

  • 0,10 g Gelatine
  • 0,93 g EDTA
  • 0,82 g NaCl
  • 75 ml destilliertes H2O
  • 25 ml Na Phosphat Puffer 0,2 M (pH 7,4)z.B. 500 ml

  • 405 ml 0,2 M Na2HPO42H2O + 95 ml 0,2 M NaH2PO4H2O

Der Gelpuffer wurde erst bei 60 °C vollständig gelöst und anschließend auf Eis auf RT abgekühlt. Danach erfolgte die Zugabe von:

Nachdem sich BSA komplett gelöst hatte, wurde der Gelpuffer auf einen pH- Wert von 7,4 mit einer 5-10 M NaOH-Lösung eingestellt und bei 4 °C gelagert.

  1. 0,5 g Aktivkohle (Sigma) + 100 ml 50 mM Na-Phosphat-Puffer
  2. 0,05 g Dextran 70T (Pharmacia) + 100 ml 50 mM Na-Phosphat-Puffer

Beide Lösungen wurden getrennt angesetzt, komplett gelöst und anschließend wurde die Lösung 2 in die Lösung 1 gegeben und bei 4 °C gelagert.

Der RIA wurde nach folgendem Protokoll angesetzt:

Tab. 5:RIA-Ansatz-Protokoll

  

1.Tag

1.Tag

1.Tag

2.Tag

Röhrchen Inhalt

Röhrchen Nr.

25µl

100µl

100µl

200µl

Totalaktivität

1-3

MeOH/HCL

Gelpuffer

Indikator (Tracer)

4500-5000 cpm/100µl

destilliertes H2O

Nullstandardaktivität (Bezugswert)

4-6

MeOH/HCL

Antikörper

Indikator (Tracer)

Kohlelösung

Standard 9-1

7-33

Standardproben

Antikörper

Indikator (Tracer)

Kohlelösung

Blank

34-36

MeOH/HCL

Gelpuffer

Indikator (Tracer)

Kohlelösung

Proben

37-?

Proben

Antikörper

Indikator (Tracer)

Kohlelösung

Bemerkungen:

1. Der Antikörper und der Indikator (Tracer) wurden mit Gelpuffer auf die gewünschte Konzentration verdünnt. Der Indikator (Tracer) sollte dabei einen Wert zwischen 4500-5000 cpm /100µl haben. Die Proben wurden über Nacht bei 4 °C inkubiert. Am 2. Tag erfolgte die Zugabe von 200 µl Kohlelösung (Ausnahme Totalaktivität). Es folgt eine Inkubation für 10 min auf Eis mit anschließender Zentrifugation für 1 min in der Beckman-Mikrozentrifuge®. Danach erfolgte das Überpipettieren von 300 µl der oberen Phase in neue Röhrchen und die Messung des gebundenen radioaktiv markierten Indikators (Tracer) am Gammacounter (Beckman).

Die Konzentrationen der Proben wurden anhand der Standardkurve ermittelt.


[Seite 47↓]

2.10  Bestimmung von Adrenomedullin(1-50) Enzym immunoabsorbet assay (EIA)

Aus den Zellkulturüberständen wurde die Menge an freigesetztem AM(1-50) bestimmt. Es wurde ein „Enzym immunoabsorbet assay“ (EIA) von der Firma Phoenix Pharmaceutical (USA) verwendet. Die Durchführung des EIA erfolgte nach dem Protokoll des Herstellers.

2.11 Angewendete statistische Verfahren

Die Daten sind angegeben worden als Mittelwert ± Standardfehler der Mittelwerte (SEM). Mit dem Kolmogoroff-Smirnoff-Test für die Güte der Anpassung wurde die Normalverteilung der Messwerte überprüft. Bei normalverteilten Messwerten wurde der ungepaarte t-Test nach Student zum Vergleich der Mittelwerte verwendet. Zur Berechnung wurde das Statistikprogramm SPSS 7.5 für Windows 95(SPSS, Chicago, IL) genutzt. Nur Werte mit p<0.05 wurden als statistisch signifikant betrachtet.

2.12 Darstellung der Ergebnisse

2.12.1 Darstellung der Ergebnisse über den Einfluss von CGRP/CGRP8-37 und SP/ SR140 333 auf die Zytokin mRNA-Expression und Freisetzung

Für die Darstellung der Ergebnisse gilt, wenn nicht anders angegeben:

  1. PCW wurde in allen Experimenten immer in einer Standardkonzentration von 5x105 cfu/ml eingesetzt, deshalb erfolgt in den Abbildungen kein weiterer Hinweis auf die Konzentrationsangabe von PCW.
  2. Die Ergebnisse werden in den Abbildungen 4-21 zur Darstellung der mRNA-Expression und Proteinfreisetzung wegen der großen Schwankungen von Experiment zu Experiment und zur besseren Übersicht in Prozent angegeben. Dabei stellen die Werte der mit PCW-stimulierten Gruppe 100 % dar, alle weiteren Werte werden darauf bezogen. Eine Ausnahme besteht jeweils in dem Vergleich der mit PCW+CGRP 10 nM und PCW+CGRP 10 nM+CGRP8-37 1 µM- stimulierten Gruppe sowie PCW+SP 10 nM und PCW+SP 10 nM+SR140333 1µM, wobei hier die Werte der PCW+CGRP 10 nM bzw. PCW+SP10 nM stimulierten Gruppen 100 % darstellen. [Seite 48↓]
  3. Die Kontrollgruppen sind jeweils gegenüber den PCW-stimulierten Gruppen statistisch hoch signifikant verschieden (p<0,001), sodass hier auf eine besondere Kennzeichnung in den Abbildungen verzichtet worden ist.

Im Anhang des Ergebnisteils ist die Zusammenstellung aller Ergebnisse in tabellarischer Form aufgelistet. Dort sind auch die Konzentrationen in Units für die mRNA-Expression sowie die Proteinkonzentration in pg/ml bzw. ng/ml für die Zytokin-Freisetzung soweit wie möglich angegeben.

2.12.2 Darstellung der Ergebnisse der CRLR- und AM mRNA Expression

  1. Die Darstellung des Zeitverlaufs der CRLR mRNA und AM mRNA-Expression unter Einwirkung von PCW sind in Prozent angegeben und auf die Kontrolle (=100 %) bezogen worden.
  2. Der Vergleich zwischen der Zugabe von CGRP und der PCW-Stimulation wurde wie bei der Zytokin-Expression durchgeführt. Die Angaben erfolgten in Prozent und wurden jeweils auf den Referenzwert PCW (=100 %) bezogen.
  3. Eine Ausnahme erfolgte bei der Darstellung des Vergleiches zwischen den mit PCW+CGRP 10 nM und den mit PCW+CGRP 10 nM+CGRP8-37 1 µM stimulierten Gruppen. Hierbei wurden die Werte auf 100 % der mit PCW+CGRP10nM-stimulierten Gruppen bezogen. (weitere Einzelheiten siehe auch unter 2.12.1.)


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
02.09.2004