[Seite 21↓]

4  Material und Methoden

4.1 Materialien

4.1.1 Klinische Materialien und Zelllinien

Alle Hautbiopsien und Blutproben von den CTCL-Patienten sowie die Blutproben der gesunden Spender wurden mit deren Einverständnis und der Zustimmung der Ethikkomission der Charite für die hier beschriebenen Arbeiten verwendet und von Dr. Sylke Gellrich, Dr. Marcus Muche oder Dr. Tanja Fischer bereitgestellt. Folgende Zelllinien und Klone wurden in dieser Arbeit verwendet.

Tabelle 2: verwendete Zelllinien und –klone

Abkürzung

MHC-Klasse-I

Beschreibung

Literatur

T2

A*0201, B5

TAP- defiziente Zelllinie

Salter et al., 1985

K562

keine

myeloische Zelllinie, NK-sensitive Zielzellen

Lozzio et al., 1975

MyLa

A1, B8

Tumorzelllinie aus CTCL-Patienten

Kaltoft et al., 1992

PN2

A*0201, A26(10), B44(12)(Bw4), B51(5)(Bw4)

Tumor-spezifischer CD8+-T-Zellklon aus CTCL-Patienten WeW

diese Arbeit

L1

Tumor-spezifischer CD8+-T-Zellklon aus CTCL-Patienten WeW

diese Arbeit

Mimo-IrM

A*0201, A11, B8(w6), B51(5)(w4)

CTL-Linie aus einem CTCL-Patienten, spezifisch für die Peptide PVKTKDIKL und PVKTYDIKL

Tumenjargal et al., 2003

CMV-IrM

CTL-Linie aus einem CTCL-Patienten, spezifisch für Peptid NLVPMVATV

Tumenjargal et al., 2003

EBV-IrM

EBV transformierte B-Zelllinie aus einem CTCL-Patienten

Tumenjargal et al., 2003

ELA-Trit

A*0201 u.a.

CD8+-T-Zelllinie aus einem Melanompatienten, spezifisch für Peptid ELAGIGILTV

Trefzer et al., 2004


[Seite 22↓]

4.1.2  Standardmedien, Puffer und Medienzusätze

Medien:

AIM-V-Medium: mit L-Glutamin, 50 µg/ml Streptomycinsulfat, 10 µg/ml Gentamycinsulfat, 0,25% humanes Serumalbumin (Invitrogen, Karlsruhe)

DMEM: mit 4,5 mg/dl Glukose, 25 mM Hepes, Glutamax (Invitrogen, Karlsruhe)

Medium für ELISpot: X-Vivo 15®-Medium (BioWhittaker, Apen)

Peptidbeladungsmedium: DMEM Medium mit 0,1%BSA

Einfriermedium: 10% DMSO (Serva, Heidelberg), 90% FCS (Sigma, Taufkirchen)

Puffer:

PBS ohne Magnesium und Kalzium, PBS w/o (Invitrogen, Karlsruhe)

PBS (Invitrogen, Karlsruhe)

MACS-Puffer für magnetische Zellseparation: PBS w/o mit 2mM EDTA und 0,1%BSA

FASC-Puffer für Durchflusszytometrie: PBS w/o mit 0,01% Natriumazid und 0,1%BSA

Zur Supplementierung verwendeten Reagenzien und Lösungen:

fötales Kälberserum (FCS), (Sigma, Taufkirchen)

2-Mercaptoethanol (Invitrogen, Karlsruhe)

Penicillin-Streptomycin-Lösung (Invitrogen, Karlsruhe)

Rinderserumalbumin (BSA), Fraktion V (Fluka, Taufkirchen)

EDTA (Merck, Bad Soden)

Natriumazid (Sigma, Taufkirchen)

DMSO (PIERCE, Bonn)

4.1.3 Kombinatorische Peptidbibliotheken und synthetische Peptide

Die kombinatorischen Peptidbibliotheken (X9 und OX8) und alle synthetischen Peptide (siehe Abb. 16 und Tabelle 9) wurden von EMC Microcollections(Tübingen)bezogen. Die Synthese waren an fester Phase mit prä-aktivierten Aminosäuren mittels der Fmoc Technik durchgeführt worden (Jung, 1996). Im Fall der Peptidbibliotheken wurden die Aminosäuren vorher gemischt (premix strategy). Anschließend wurde die Qualität der Peptide per Massenspektrometrie analysiert. Die randomisierten kombinatorischen Peptidbibliotheken setzen sich aus Nonapeptiden zusammen, die an einer Sequenzposition eine definierte Aminosäure (O) besitzen, während alle anderen Positionen randomisiert sind (X). Der [Seite 23↓]komplette Satz von Nonapeptidbibliotheken für die Bestimmung von TCR-Epitopen besteht aus einer völlig randomisierten X9-Bibliothek, die 19 AS für 9 Positionen oder theoretisch 199, d.h. etwa 3,23x1011 verschiedene Peptide enthält, und 171 OX8-Subbibliotheken, wobei jede Subbibliothek 198 oder etwa 1,6 x 1010 verschiedene Peptide enthält. Cystein wurde ausgeschlossen, um Probleme mit Oxidierungen oder Dimerisierungen zu vermeiden. Alle synthetischen Peptide und die kombinatorischen Peptidbibliotheken wurden unter Stickstoff in DMSO (PIERCE, Bonn) gelöst (20 mg/ml Stammlösung) und bei –80°C gelagert.

Abbildung 1: Kombinatorische Peptidbibliotheken in X9 - und OX8-Format. O: definierte Sequenzposition, X: randomisierte Sequenzposition mit A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y.

4.1.4 Antikörper

Die Antikörper, die im Rahmen dieser Arbeit verwendet wurden, sind in der Tabelle 3 mit Angabe ihrer Hersteller bzw. Vertreiber aufgelistet.


[Seite 24↓]

Tabelle 3: Liste der Antikörper, die in dieser Arbeit verwendet wurden

Spezifität

Antikörper

Spezies

Isotyp

Fluorochrom

Hersteller

CD3

UCHT1

Maus

IgG1, k

Alexa 405

DRFZ

CD3

SK7

Maus

IgG1, k

APC-Cy7

BD

CD4

TT1

Maus

IgG1, k

Alexa 430

DRFZ

CD8

RPA-T8

Maus

IgG1, k

PE-Cy7

BD

CD8

RPA-T8

Maus

IgG1, k

APC

BD

CD19

SJ25-C1

Maus

IgG1, k

Tri-Color

Caltag

CD30

Bar-H2

Maus

IgG1

FITC

DAKO

CD45RO

UCHL1

Maus

IgG2a

FITC

DAKO

CD45RA

HI100

Maus

IgG2a, k

PE

BD

CD56

B159

Maus

IgG1, k

APC

BD

CD69

FN50

Maus

IgG1, k

APC-Cy7

BD

CD95

DX2

Maus

IgG1, k

APC

BD

CD95L

NOK-1

Maus

IgG1, k

PE

eBioscience

HLA-ABC

W6/32

Maus

IgG2a

PE

DAKO

HLA-DR

L243

Maus

IgG2a

APC

BD

IFNγ

25723.11

Maus

IgG1

FITC

BD

IL-2

5344.111

Maus

IgG1

PE

BD

TCR-Vß2

MPB2D5

Maus

IgG1

FITC

BD

CD62L

DREG-56

Maus

IgG1

APC-Cy7

Caltag

CD28

CD28.2

Maus

IgG1, k

Pe-Cy5

BD

GITR

110416

Maus

IgG1

FITC

R&D Systems

CTLA-4

BNI-3

Maus

IgG2a

Alexa 405

DRFZ

CD71

M-A712

Maus

IgG2a

PE-Cy5

BD

CD25

M-A251

Maus

IgG1

APC

BD

PD-1

J116

Maus

IgG1, k

PE

NatuTec

CD26

L272

Maus

IgG2a

PE

BD

CD27

M-T271

Maus

IgG1, k

FITC

BD

Granzym-B

CB9

Maus

IgG1

FITC

BD

Perforin

δG9

Maus

IgG2b

PE

BD

CD38

HB7

Maus

IgG1

PE

BD

KIR NKAT2

DX27

Maus

IgG2a, k

PE

BD

KIR NKB1

DX9

Maus

IgG1, k

PE

BD

CCR7

3D12

Ratte

IgG2a

PE

BD


[Seite 25↓]

4.2  Zellkulturtechniken

Die Standardzelllinien wurden in DMEM (Invitrogen) und die T-Zelllinien und –klone in AIM-V Medium (Invitrogen) supplementiert mit 10% hitzeinaktiviertem fötalem Kälberserum (FCS), 100 U/ml Penicillin, 0,1 mg/ml Streptomycin, 2 mM Glutamin und 30 µM 2-Mercaptoethanol bei 37°C mit 8% CO2 kultiviert. Die T-Zelllinien und –klone wurden unter Zugabe von 50 bis 100 U/ml IL-2 (Chiron, Ratingen) kultiviert. Die Kulturen wurden je nach Wachstumsverhalten regelmäßig auf frisches Medium überimpft. Die Zentifugationsschritte zum Pelletieren und Waschen der Zellen wurden bei 300 x g 5 min durchgeführt. Es wurden Einwegmaterialien der Firma (BD, Heidelberg) verwendet.

4.2.1 Isolierung von Lymphozyten aus Bluten und Geweben

Den Blutproben wurde Heparin (Biochrom AG, Berlin) zugesetzt, um die Gerinnung zu vermeiden. Die Lymphozyten wurden mit Hilfe eines Ficoll-Dichtegradienten aus dem Blut isoliert. Ein Teil Ficoll Paque (Amersham, Freiburg) wurde mit zwei Teilen Blut vorsichtig überschichtet und 20 min bei 600 x g bei RT ohne Bremse zentrifugiert. Die Lymphozyten aus der Interphase wurden mit mindestens gleichem Volumen PBS gemischt und 5-10 min mit 300 x g zentrifugiert. Für die Isolierung von Lymphozyten aus Geweben wurden diese in PBS mit 0,1% BSA in kleinen Stücken zerschnitten und durch ein Sieb (Sigma, Taufkirchen) gedrückt. Anschliessend wurde die Suspension durch ein Filter (30 µM Myltenyi Biotec, Bergisch Gladbach) passagiert, um eine Einzellzellsuspension zu bekommen.

4.2.2 Cryokonservierung von Zellen

Für langzeitige Lagerung wurden die Zellen bei –140°C eingefroren. Dazu wurden diese in Einfriermedium suspendiert und für eine 1 h auf Eis gelagert. Danach wurden sie für eine Nacht auf –80°C und dann auf –140°C überführt. Zum Auftauen wurden die Zellen schnell im Wasserbad (37°C) aufgewärmt und mit mindestens 10-fachem Volumen PBS verdünnt und zentrifugiert.

4.2.3 Zellseparation mittels magnetischer Beads

Die Zellen wurden zuerst mit fluorochrom-markierten Antikörpern für den gewünschten Selektionsmarker 5 min in 100 µl MACS-Puffer auf Eis im Dunkeln gefärbt. Danach wurden die Zellen in mindestens 10 ml MACS-Puffer aufgenommen bei 4°C zentrifugiert. Dann [Seite 26↓]wurden die Zellen mit anti-FITC oder anti-PE Antikörper je nach Markierung des Primärantikörpers, die an magnetische Beads gekoppelt waren, 10 bis 15 min bei 4°C markiert. Nach dem Waschen wurde die Zellsuspension in 500 bis 1000 µl MACS-Puffer aufgenommen und auf die magnetische Säule (Myltenyi Biotec, Bergisch Gladbach) pipettiert. Die Säule war vorher einmal und nachher dreimal mit 500 bis 1000 µl MACS-Puffer gewaschen. Der Durchlauf wurde als Antigen-negative Fraktion gesammelt. Die auf der Säule verbliebenen Zellen wurden mit 3 bis 4 ml MACS-Puffer mit einem Stempel schnell herausgedrückt und als Antigen-positive Fraktion gesammelt. Die einzelnen Zellfraktionen wurden nachher zur Kontrolle durchflusszytometrisch analysiert.

4.3 Funktionelle T-Zellaktivitätsversuche

4.3.1 Chromfreisetzungsanalysen

Zur Bestimmung der zytolytischen Aktivitäten der CTL wurden die Zielzellen mit radioaktiven Chromium (51Cr) beladen. Dazu wurden 1-2 x106 Zielzellen in 100 µl DMEM mit 10% FCS aufgenommen und mit gleichem Volumen 51Cr-Natriumchromatlösung (NEN, Zaventem, Belgien, 3,7 x 107 Bq/ml) gemischt und bei 37°C für 1h inkubiert. Danach wird die Zellsuspension auf 1 ml mit Medium aufgefüllt und 4-5-mal gewaschen, um überflüssiges 51Cr zu entfernen. Für die Assays wurden in der Regel werden pro Ansatz 5000 Zielzellen in einem Volumen von 100 µl mit den zu testenden Peptiden gemischt und für eine halbe Stunde bei Raumtemperatur inkubiert. Das Beladen mit Peptiden erfolgte im Peptidbeladungsmedium (DMEM mit 0,1% BSA). Danach wurden die CTL zugegeben und die Kulturen 4-5 h im Brutschrank (37°C) inkubiert. Das Endvolumen von 200 µl sollte 10% FCS enthalten. Nach der Inkubation wurden 30 µl des Überstandes auf Fest-Szintillator-Platten überführt und die freigesetzte Radioaktivitätsmenge mit einem ß-Counter (Packard, Dreieich) gemessen. Der Anteil an freigesetztem 51Cr entspricht dem Anteil an lysierten Zielzellen. Die spezifische Lyse wurde nach folgender Formel berechnet:

spezifische lyse

:Radioaktivität im experimentellen Ansatz

:Radioaktivität nach Komplettlyse


[Seite 27↓]

:spontan freigesetze Radioaktivität

Für die Spontanfreisetzung wurden die Zielzellen ohne CTL inkubiert. Die Totalfreisetzung wurde durch Inkubation der Zielzellen mit dem Detergenz Zaponin in Essigsäurelösung (Coulter Electronics, England) bestimmt.

4.3.2 ELISpot-assay

Spezifisch durch Peptide aktivierte T-Zellen können IFNγ sekretieren, was in ELISpot-Assays so nachgewiesen wird, daß ein Rückschluss auf die Zahl der reagierenden T-Zellen möglich ist. Das von der Zelle sekretierte IFNγ wird dabei durch auf die Assayplatte absorbierte spezifische Antikörper aufgefangen. Nach Entfernen der Zellen werden die Zytokine durch Gegenfärben mit einem zweiten IFNγ-spezifischen Antikörper und einem Sekundärreagenz für eine enzymatische Reaktion in Form von Spots sichtbar gemacht. Alle Verdünnungen der Reagenzien wurden in PBS gemacht. Die kurzzeitigen Inkubationen zur Entwicklung der Nachweisreaktion erfolgte in geschlossenem feuchten Kammer. Im einzelnen:

MultiScreen-IP®-96-Kavität-Platten (Millipore, Eschborn) wurden mit anti-Human-IFNγ monoklonalen Antikörpern (Klon 2G1, PIERCE Endogen, Bonn) in einer Konzentration von 0,5 mg/ml in PBS über Nacht bei 4°C inkubiert. Nach zweimaligem Waschen mit PBS wird pro Kavität 50 µl Medium (X-VIVO 15®) zugesetzt. Dann werden die Stimulatorzellen oder Antigen-präsentierenden Zellen (APZ) in 100 µl X-VIVO 15®-Medium (BioWhittaker, Apen) mit den Peptiden (10µg/ml) für halbe Stunde bei Raumtemperatur inkubiert. Danach werden die CTL-Zellen zugegeben und die Platten für 16-20 h im Brutschrank inkubiert. Nach der Inkubation werden die Zellen dreimal mit PBS rausgewaschen. Hinterher wird pro Kavität je 50 µl biotinylierter anti-Human-IFN-γ Antikörper (Klon B133.5, PIERCE Endogen, Bonn) in einer Konzentration von 1 mg/ml in PBS mit 4% BSA zugesetzt. Nach 2 h Inkubation in feuchtem Kammer bei RT wurden nochmals dreimal gewaschen. Pro Kavität wurden 50 µl einer 1:2000 vorverdünnte Streptavidin-AP-Konjugatlösung (Roche, Mannheim) zugesetzt. Nach 1 h Inkubation wurden dreimal gewaschen und am Ende mit 50 µl BCIP/NBT-Substratlösung (MOSS Inc.) inkubiert, bis Spots zu sehen waren (etwa 10 min). Die Platten werden dann getrocknet und die Spots mit einem BIOREADER-3000-ELISpot-Lesegerät ausgezählt.


[Seite 28↓]

4.4  Durchflusszytometrie

Mit Hilfe der Durchflusszytometrie wurden phänotypische und funktionelle Eigenschaften der Lymphozyten untersucht. Mit monoklonalen Antikörpern, an die Fluorochrome gekoppelt sind, kann die Expression von Molekülen auf der Zelloberfläche und in der Zelle untersucht werden. Die Analysen erfolgten für 4-Farbenmessungen an einem FACS-CaliburTM (Beckton Dickinson, Heidelberg) oder für 8-Farbenmessungen an einem FACS-LSR II (Beckton Dickinson, Heidelberg). Zum Sortieren von Zellen wurden ein 8-Farben FACS-DIVA (Beckton Dickinson, Heidelberg) und ein 9-Farben Moflo (Cytomation, Freiburg) verwendet. Für die Auswertung wurden die Software CellQuestTM-Pro (Beckton Dickinson, Heidelberg), FlowJo Software (Versionen 4.2, 6 beta, Tree Star Inc) oder FACS-DIVA Software (Beckton Dickinson, Heidelberg) verwendet. Die verwendeten Antikörper sind in Tabelle3 zusammengefasst.

4.4.1 Phänotypische Analyse von Oberflächenmolekülen

Für die Analyse von Oberflächenmolekülen wurden die Zellen mit FACS-Puffer gewaschen und im selben Puffer wieder aufgenommen. Für jeden Ansatz wurden 1-10 x 105 Zellen mit bis zu 8 verschiedenen Fluorochrom-markierten monoklonalen Antikörpern (0,1-1,0 µg/ml) in einem Volumen von 25 bis 50 µl für 10 min im Dunkeln bei RT inkubiert. Danach wurden die Zellen nochmals gewaschen und durchflusszytometrisch analysiert.

4.4.2 Intrazelluläre Färbungen auf Zytokine

Zum Nachweis von Zytokinen, die nach spezifischer Stimulation exprimiert wurden, wurden die Zellen 5-10 min bei RT in einem isotonem Puffer mit Paraformaldehyd (PFA) (FACSTM Lysing Solution, Becton Dickinson, Heidelberg) fixiert. Danach erfolgte die Inkubation mit FACSTM Permeabilization Solution (Becton Dickinson, Heidelberg) für 10 min im Dunkeln bei RT. Dieser Puffer enthält ebenfalls PFA sowie das Detergenz Zaponin, wodurch die Lipide aus der Zellmembran herausgelöst werden. Anschließend wurden die Zellen mit FACS-Puffer gewaschen und mit den entsprechenden Antikörpern gefärbt und analysiert.

4.4.3 Färbung von Tumor-spezifischen T-Zellen mit DimerX

DimerX (Beckton Deckinson) ist ein Fusionsprotein aus den drei extrazellulären Domänen der schweren Kette des HLA-A2 Moleküls und der VH-Region von Maus-IgG1 (Dal Porto, et al., 1993). Das Fusionsprotein wurde zusammen mit humanem ß2-Mikroglobulin in der J558-Plasmazytomzelllinie der Maus (ATCC TIB-6) exprimiert. Das HLA-A2-IgG1-VH-Fusionsprotein und ß2m sind nicht-kovalent assoziert. Das exprimierte Fusionsprotein wurde aus Zellkulturüberständen durch Affinitätschromatographie an Protein A gereinigt. DimerX kann spezifisch mit Peptiden beladen und so als Nachweisreagenz für T-Zellen mit den korrespendierenden Spezifitäten eingesetzt werden. Hierzu wurden 2 µl DimerX über Nacht bei 26°C mit 1,5 µl in PBS 1:10 vorverdünnten Peptidlösung (20 mg/ml) beladen. Am nächsten Tag wurde das Peptid-beladene DimerX mit Zenon-PE (Molecular Probes) markiert und unmittelbar für die Färbung eingesetzt. Zenon-PE ist ein anti-Maus IgG1-F(ab)-Fragment mit PE als Fluorochrom.

Das frisch eingefrorene, primäre Tumormaterial wurde nach dem Auftauen zweimal mit PBS gewaschen. Danach wurden die Zellen für 5 min bei RT mit Beriglobin A (Aventis) inkubiert, um die Fc-Rezeptoren zu blocken. Danach wurde die mit Zenon-PE markierte DimerX-Färbelösung zugegeben und die Zellen für 30 min bei 4°C inkubiert. Danach wurden die direkt markierten Antikörper für die Oberflächenfärbung auf weitere Marker zugegeben. Nach 15 min wurden die Zellen mit 3-4 ml FACS-Puffer gewaschen und durchflusszytometrisch analysiert.

4.4.4 Sortieren von Zellen per Durchflusszytometrie

Da mit magnetischen Separationstechniken keine saubere Separation der gewünschten Zellpopulationen möglich ist, wurde zusätzlich das durchflusszytometrische Zellsortiergerät FACS-DIVA (Beckton Dickinson) eingesetzt. Diese Arbeiten wurden am Durchflusszytometriezentrum von Thoralf Kaiser und Katharina Raba durchgeführt. Die Zellen wurden nach Färbung mit den entprechenden Antikörpern gewaschen und in PBS aufgenommen. Die Geräte ermöglichen das Sortieren von 4 unterschiedlichen Populationen anhand von bis zu 8 unterschiedlichen phänotypischen Merkmalen.

4.5 Molekulargenetische Arbeitsmethoden

4.5.1 Präparation genomischer DNA

Für die molekulargenetischen Untersuchungen der T-Zelllinien und –klone wurde die genomische DNA aus 1-10 x 105 kultivierten Zellen bzw. 10 Schnitten (jeweils 10 µm) [Seite 30↓]paraffinisierter Hautbiopsien präpariert. Die Zellen wurden mit PBS gewaschen, die Zellsedimente kurz aufgeschüttelt und in Extraktionspuffer (10mM TRIS/HCL pH 8,3; 50 mM KCL; je 0,45% Nonidet P40 und Tween 20) aufgenommen. Anschließend wurden 10 µg/ml Proteinase K hinzugefügt und über Nacht bei 55°C inkubiert. Nach dieser Inkubation wurden die Proben für 15 min auf 95°C erhitzt, womit die Enzymreaktion beendet wurde. Fixierte Hautbiopsien mußten vor der Präparation der genomischen DNA deparaffiniert werden. Die zweimalige Extraktion des Paraffins erfolgte mit 1 ml Xylen und 1 ml Ethanol. Die Proben wurden danach getrocknet und die DNA wie oben beschrieben präpariert.

4.5.2 TCR-γ-PCR

Für die Analyse der TCRγ-Rearrangements der kultivierten T-Zellklone wurde eine Multiplex-Polymerase-Kettenreaktion (PCR) mit spezifischen Oligonukleotiden für die unterschiedlichen Vγ- und Jγ-Gensegmente durchgeführt. Das gleiche Verfahren wird für die Routinediagnostik verwendet, sodass die Ergebnisse untereinander verglichen werden können. Abhängig von dem TCRγ-Rearrangement des dominant expandierten Klons in der Haut wurden für die Analyse der T-Zellklone die Oligonukleotide VG1, VG2, VG9 und JG12-a bzw. JGP12-i (Tabelle 4) verwendet. Die Reaktion wurde jeweils in einem Volumen von 75 µl mit 2,5 mM MgCl2 (Perkin Elmer, Weiterstadt), 1,75 U Taq Polymerase (Perkin Elmer), 200 µM dNTP (Endkonzentration von jeweils ATP, CTP, GTP und TTP; GIBCO BRL), 50 pM je Oligonukleotid (BioTez, Berlin) und 2-10 µl DNA-Extrakt durchgeführt. Für die Amplifikation wurden die Proben zunächst für 4 min bei 94°C denaturiert, anschließend folgten 40 Zyklen von jeweils 1 min bei 94°C, 58°C und 72°C, sowie eine abschliessende Extension für 5 min bei 72°C. Die PCR-Produkte wurden auf einem 2%-igen Agarose-Gel der Größe nach aufgetrennt. Alle Proben, die eine deutliche Bande zwischen 240-260 Basenpaare aufwiesen, wurden in der Heteroduplex-Temperaturgradienten-Gelelektrophorese (HD-TGGE) oder Fragmentlängenanalyse mit einem DNA-Sequenziergerät weiter analysiert.

4.5.3 Heteroduplex-Temperaturgradienten-Gelelektrophorese

Das Hybridisierungsprodukt von zwei unterschiedlichen Oligonukleotiden wird als Heteroduplex bezeichnet. Die Wanderungsgeschwindigkeit solcher Heteroduplices in einem Temperaturgradienten ist im Vergleich zu einem Homoduplex – dem Hybridisierungsprodukt komplementärer Oligonukleotide - verändert, da ihre Thermostabilität verringert ist. Einzelstränge, die nicht hybridisiert sind wandern schneller und nur partiell hybridisierte [Seite 31↓]Oligonukleotide wandern langsamer als die Homoduplices. Diese Eigenschaft kann für die Analyse der klonalen Dominanz in einer Probe durch eine Heteroduplex-Temperaturgradienten-Gelelektrophorese (HD-TGGE) ausgenutzt werden (Muche, et al., 1997). Für die Heteroduplex-Formation wurden die PCR-Produkte für 10 min auf 95°C erhitzt, innerhalb von 20 min auf 55°C abgekühlt und dann in eine Polyacrylamidgel aufgetrennt. Das Produkt von Proben mit klonal expandierten T-Zellen zeigte eine distinkte Bande, oligo- oder polyklonale Produkte zeigten einen Schmier.

4.5.4 Sequenzierung der klonal dominanten PCR-Banden

Die klonalen Banden aus der HD-TGGE wurden aus dem Gel herausgeschnitten und über Nacht in PCR-Puffer extrahiert. Anschliessend wurden die PCR-Produkte bei gleichen Bedingungen mit den Oligonukleotiden JG12-i oder JGP-12i anstelle von JG12a oder JGP12-a (Tabelle 4) reamplifiziert und mit dem Qiagen PCR Purification Kit (Qiagen, Hilden) gereinigt. Die Sequenzierung erfolgte entweder direkt oder nach dem Klonieren der PCR-Produkte mit dem Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Weiterstadt) an einem automatischen DNA-Sequenzierer (Perkin Elmer). Dafür wurden die Oligonukleotide VGseq, JG12-i oder JGP12-i verwendet. Für die Klonierung einzelner Proben wurde AT Cloning Kit (Invitrogen, Fleek, Holland) benutzt. Die Sequenzen wurden mit den veröffentlichten Sequenzen der TCRγ V- und J-Segmente verglichen, um die klontypischen N-Regionen zu identifizieren und zu analysieren.

4.5.5 AT-Klonierung

Bei der DNA-Synthese mit Taq Polymerase hängt am 3’-Ende des PCR-Produktes ein Adenosin über. Diese Eigenschaft kann ausgenutzt werden, um die PCR-Produkte in ein linearisiertes Plasmid mit einem überhängenden Thymidin an den 5’-Enden zu ligieren. Die Ligation wird mit Hilfe der T4–DNA-Ligase durchgeführt. Benachbart zur Insertionsstelle befinden sich Erkennungssequenzen für Restriktionsenzyme. Die Plasmide werden in kompetenten Bakterienzellen kloniert. Nach der Präparation der Plasmid-DNA wird das PCR-Produkt mit Hilfe von Restriktionsenzymen, die nicht im Insert schneiden, herausgeschnitten und sequenziert.


[Seite 32↓]

4.5.6  Isolierung von RNA

RNA wurde mit Ready to go kit (Qiagen, Hilden) aus 3 bis 5 x 106 Zellen nach dem Protokoll des Herstellers isoliert. Alle Gefäße und das Wasser für RNA-Isolierung wurden vorher mit DEPC (Diethylpyrocarbonat, Roth, Karlsruhe) behandelt. Anschließend wurde die RNA vor der cDNA-Synthese mit RNase-freier DNase (Promega) für 30 min bei 37°C behandelt (1 U DNAse pro 1 µg RNA). Nach anschließender Fällung und dem Waschen in 75%-igem Ethanol wurde die RNA in DEPC-Wasser aufgenommen. Die Konzentration der RNA wurde durch Absorptionsmessungen bei 260 nm bestimmt. Die RNA wurde bei –80°C gelagert.

4.5.7 PCR-Primer

Alle Oligonukleotide wurden von Biotez, Berlin bezogen. Die Sequenzen dieser Oligonukleotide sind in Tabelle 4 und 5 gelistet.

Tabelle 4: Primer für TCRγ-PCR-Analyse (Muche, et al., 1997).

Bezeichnung

Sequenz (5’-3’)

Spezifität

Position

VG1

CTCCATCCACTGGTACCT

Vg1,2,3,4,5,5p,6p,7p,8

104-121

VG9

ATTGGTATCGAGAGAGAC

Vg9

121-138

VG2

CACTGGTACKKGCAAGAAAC*

Vg10,11,B,(A)

111-129/117-135

JG12-a

CAACAAGTCTTGTTCCAC

Jg1,2

27-44

JG12-i

TGTTGTTCCACTGCCAAA

Jg1,2

20-37

JGP12-a

CTTGAGCYTAGTCCCTT

JgP1,P2

31-48

JGP12-i

CCTTYWGCAAAYRTCTTGA*

JgP1,P2

16-35

VGseq

AGRCCCCACAGCRTCTTC*

Vg1,2,3,4,5,5p,6p,7p,8

136-153

*K = G oder T; R = A oder G
W = A oder T; Y = C oder T


[Seite 33↓]

Tabelle 5: Liste der verwendeten cDNA-spezifischen Primer

Gen

Leserichtung

Sequenz (5’-3’)

Annealing-temperatur

Amplifikatgröße (bp)

NDRG-1

sense

ATGCAGGATGTAGACCTCGC

58°C

423

antisense

TAGGCGCCTGCTCCTGTTC

Tumorangiogenese Protein

sense

CCAGCAGTACTTTGGTGGACGAG

58°C

392

antisense

GCAGATGCCTGCTCCAGGTAG

Ceramidase

sense

AGCATCATGGCTGGCAGCCTCAC

62°C

335

antisense

GAGAGCAGCAGCATCTGTCATGGC

TGF-ß

sense

GCCCTGGACACCAACTATTGC

58°C

335

antisense

GTGCGCTCCTGCAGGTGCAGC

IL-10

sense

GCACCCACTTCCCAGGCAACCTGCC

58°C

409

antisense

GTTGATGAAGATGTCAAACTCAC

ß-Actin

sense

AGGAGAAGCTGTGCTACGTC

58°C

454

antisense

CTCGTCATACTCCTGCTTGC

4.5.8 cDNA-Synthese

1 µg Gesamt-RNA wurden zunächst mit jeweils 1 µl Oligo-dT-Primer (AAGCTGTGGTAACAACGCAGAGTCGACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN, V ist A, C, oder G, N sind beliebige Nukleotide) bei 70°C für 2 min denaturiert und anschließend auf Eis gestellt. Danach wurde 1 U Reverse Transkriptase (Superscript II, Invitrogen), 4 µl first strand-Puffer, 2 µl dNTP-Mix ( enthält je 10 mM dATP, dGTP, dCTP, dTTP) , 2 µl DTT (20mM/ml) und 2,4 µl MgCl2 (25mM/ml) hinzugefügt und mit DEPC-Wasser auf 20 µl Endvolumen aufgefüllt. Der Reaktionsansatz wurde 10 min bei RT und danach 1 Stunde bei 42°C inkubiert. Anschließend wurde der Ansatz bei 72°C für 10 min denaturiert. Die Lagerung der Produkte erfolgte bei –20°C.

Für die Genexpressionensanalysen wurden die RT-PCR mit mRNA-spezifischen Primern durchgeführt (Tabelle 5). Alle Reagenzien für den PCR-Ansatz wurden von der Firma Invitrogen bezogen. Der PCR-Ansatz z.B. für 50 µl Volumen setzte sich folgendermassen zusammen:


[Seite 34↓]

10xPCR-Puffer

5 µl

dNTP-Mix

2 µl

Sense-Primer (50pM/µl)

0,5 µl

Antisense-Primer (50pM/µl)

0,5 µl

Taq-Polymerase (4U/ml)

0,5 µl

MgCl2 (50 mM)

1,5 µl

cDNA

2 µl

H2O

38 µl

Der PCR-Ansatz wurde nach folgendem PCR-Programm für 30 Zyklen amplifiziert, wobei die Annealingtemperatur abhängig von jeweiligen Primer varierte.

PCR-Protokoll:

2 min

95°C

30 s

95°C

30 s

Annealingtemperatur

45 s

72°C (Rücksprung auf Schritt 2, Zykluswiederholung)

5 min

72°C

Zur Identifikation wurde das RT-PCR-Produkt in einem 2% igen Agarosegel mit Ethidiumbromid in 1xTBE-Puffer (Tris-Borat-EDTA) bei 120 V aufgetrennt und gegebenfalls sequenziert.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
17.03.2005