[Seite 35↓]

5  Experimente und Ergebnisse

5.1 Identifizierung von Tumor-spezifischen T-Zellepitopen

Für die Identifizierung von Tumor-assoziierten T-Zellepitopen werden Tumorzellen und Tumor-spezifische T-Zellen benötigt, wobei je nach Methode unterschiedliche Materialien und Informationen erforderlich sind. Für den biochemischen Ansatz werden sehr große Mengen an reinen Tumorzellen gebraucht, die für kutane Lymphome nicht verfügbar sind, da große Tumoren nur ausserordentlich selten vorkommen und die Tumorzellen nicht in Kultur etabliert und expandiert werden können. Bioinformatische Ansätze setzen die Kenntnis von Tumor-assoziierten Antigenen voraus. Da bei kutanen Lymphomen solche Antigene nicht bekannt sind, lässt sich diese Methode hier nicht anwenden. Für das molekulargenetische Vorgehen mit Klonieren von Expressionsbibliotheken sind langzeitstabile T-Zellklone als Indikatorzellen erforderlich, die bei kutanen Lymphomen nicht zugängig sind. Wegen dieser Einschränkungen wurde für diese Arbeit der vierte Ansatz zur Bestimmung von T-Zellepitopen mittels kombinatorischen Peptidbibliotheken gewählt. Da T-Zellen in ihrer Antigenerkennung sehr degeneriert sind, ergeben die Analysen der Reaktionen von polyklonalen T-Zelllinien auf die randomisierten Peptidgemische keine definierten Reaktionsprofile. Tumor-infiltrierende T-Zellen sind immer polyklonal und nicht notwendigerweise Tumor-spezifisch. Daher müssen für diesen Ansatz monospezifische Klone generiert und die Tumor-Spezifität dieser Klone belegt werden.

5.1.1 Generierung von Tumor-reaktiven CTL-Klonen

Zur Etablierung von Tumor-spezifischen T-Zellklonen wurden CD8+-T-Zellen aus Tumor-infiltrierenden Lymphozyten (TIL) per limiting dilution isoliert und expandiert. Die TIL wurden aus einem Tumor eines Patienten WeW von etwa 12 g isoliert. Nach Abtrennen der Haut- und Fettanteile und Dissoziation der verbliebenen Tumorareale wurde die Suspension durch ein Zellsieb passagiert und nach Waschen 300 x 106 Zellen gewonnen. Die CD8+-T-Zellen wurden per MACS isoliert und mit einer durchschnittlichen Zelldichte von 0,3 Zellen zusammen mit 1,0 Zellen des nicht-fraktionierten Zellgemisches aus dem Tumor, das Tumorzellen als spezifische Stimulatorzellen enthielt, und 1 x 104 bestrahlten autologen PBMC pro Kavität in Zellkulturmedium mit 100 U/ml IL-2 als Wachstumsfaktor und PHA (1µg/ml) als Mitogen ausgesät. Nach 2 Wochen waren in einzelnen Kavitäten Kolonien zu [Seite 36↓]sehen. Die Wahrscheinlichkeit, dass diese Kolonien jeweils einem Klon entsprechen, ergibt sich durch die Poisson-Verteilung als

:Wahrscheinlichkeit für Monoklonalität

u:Frequenz ausgesäter Zellen

Bei einer Aussaatfrequenz von 0,3 Zellen pro Kavität beträgt die Wahrscheinlichkeit für Monoklonalität 86%. Diese Rechnung setzt voraus, dass jede Zelle tatsächlich einen Klon ergibt. Das ist in der Realität besonders bei Versuchen mit Primärmaterialien aus Patienten nicht der Fall, da die Zellen häufig aufgrund von Defekten nicht mehr proliferieren oder sich nicht an die Zellkulturbedingungen adaptieren können. Die Effizienz der Klonierung, d.h. der Prozentsatz an ausgesäten Zellen, die tatsächlich Klone ergeben, ist:

Klonierungseffizienz

:Zahl wachsender Klone

:Zahl ausgesäter Zellen

Im vorliegenden Versuch wurden 1920 Kavitäten beschickt. 68 Kolonien sind ausgewachsen, was einer Klonierungseffizienz von 12% entspricht. Mit der Wahrscheinlichkeit für Monoklonalität von 86% ist zu erwarten, dass 59 dieser 68 Kolonien monoklonal sind, die anderen 9 wären bi- oder oligoklonal. Nach der Expansion wurden die ausgewachsenen Klone per Durchflusszytometrie auf ihre Phänotypen untersucht und erwiesen sich alle als CD8-positiv. Diese 68 Zellklone oder -linien wurden dann auf ihre Tumorspezifität untersucht.


[Seite 37↓]

5.1.2  Charakterisierung der CTCL-Tumorzellen

Zur Bestimmung der Tumorspezifität der CD8+-T-Zellen aus dem Klonierungsversuch ist es erforderlich, dass die Reaktion auf die Tumorzellen spezifisch gemessen werden kann, was wiederum voraussetzt, dass die Tumorzelle definiert werden kann. Aus immunhistologischen Untersuchungen war bekannt, dass die WeW-Tumorzelle einen T-Zellrezeptor der Familie Vβ2 exprimiert. Die Grundlage für diese Zuordnung war, dass Vβ2-positive T-Zellen eine dominante Zellpopulation im Tumor ausmacht. Keine andere T-Zellrezeptor-V-Familie war auffällig. Außerdem wiesen diese Vβ2-positiven Zellen morphologische Besonderheiten auf: Sie waren besonders groß und hatten vielfach abnormale, d.h. hier konvolutierte Zellkerne. Eine durchflusszytometrische Untersuchung der Zellsuspension aus dem Tumor ergab auch hier eine Population im vorwärtigen Streulichtkanal (engl. forward scatter, FSC) stark lichtstreuende d.h. besonders grosse Vβ2-positive Zellen (Abb. 2A). Diese Zellpopulation wurde per Durchflusszytometrie isoliert und einer molekulargenetischen Untersuchung der junktionalen Region der Gene für die T-Zellrezeptor-γ-Kette unterzogen. Hierzu wurde eine PCR mit den TCR-Vγ-familienspezifischen Oligonukleotidprimer VG1, JG12a und JPG12i (Tabelle 4) in einem γ-1 Multiplex-PCR-Ansatz verwendet, wobei alle Mitglieder der Vγ-Familien Vγ1, 2, 3, 4, 5, 5p, 6p, 7p und 8 erfasst werden. Ergänzend wurde ein γ-2 PCR Ansatz für alle Mitglieder der Vγ10, 11, B (A)-Familien mit den Oligonukleotidprimer VG2, JG12a und JPG12i angesetzt. Die TCRγ-PCR-Produkte wurden mit hochauflösender Temperaturgradienten-Gelelektrophorese (TGGE) aufgetrennt. Diese Technik wird auch in der Routinediagnostik für CTCL verwendet (siehe Kap. 3.5.3). Die Fragmentlängenanalyse der isolierten Tumorzellen zeigt, dass diese Zellpopulation bezüglich des TCR-Vγ-Rearrangements monoklonal ist. Die Tumorzellen sind durch ein PCR-Produkt von 251 Basenpaaren gekennzeichnet. Die Sequenzierung ergab die Sequenz des klonspezifischen TCR-Rearrangements der Tumorzelle mit Vγ3 und Jγ2. Die N-Region der TCR-Vγ-Kette war nur 1 Basenpaar (bp) lang. In ähnlicher Weise wurde die klonspezifische Sequenz der TCR-Vß-Kette ermittelt. Das Gen für das TCR-Vß besteht aus Vß2s1, Jßs3 und einer 10 bp langen N-Region. Die Ergebnisse der PCR-Fragmentlängenanalyse für TCR-Vγ der sortierten Tumorzellen ist in Abb. 2B gezeigt. Abb. 2C zeigt die Sequenzen der TCR-Vß- und -Vγ-Rearrangements. Das Rearrangement der TCR-Vγ und der 1 bp-N-Region ist exakt die Sequenz, die in der molekulargenetischen Diagnostik für die Tumorzellen des Patienten bestimmt worden war. Diese sortierten und durch Abgleich mit den Daten der Diagnostik [Seite 38↓]bestätigten Tumorzellen wurden als Ziel- und Stimulatorzellen für die Assays mit den aus Tumor-infiltrierenden Lymphozyten isolierten CD8+-T-Zellklone verwendet.

Abbildung 2: Isolierung von Tumorzellen. A: Die im Streulicht (FSC) gross erscheinende Tumorzellpopulation wurde an FACS-DIVA durchflusszytometrisch isoliert. B: TCR-Vγ-Fragmentlängenanalyse der isolierten Tumorzellen für die TCR-Vγ-Familien 1, 2, 3, 4, 5, 5p, 6p, 7p und 8 (γ-1) sowie 10, 11, B (A) (γ-2). C. Die Sequenzen für die N-Regionen der TCR-Vγ— und von TCR-Vß-Rearrangements der Tumorzellen

5.1.3 Tumorspezifität der klonierten Tumor-infiltrierenden CD8+-T-Zellen

Für den Nachweis der Tumorspezifität der ausgewachsenen CD8+-T-Zellklone wurde zum Zeitpunkt der Tumorentnahme ohne in vitro Kultur eingefrorenes primäres Tumormaterial verwendet, wobei die Tumorzellen anhand ihrer Grösse mit Hilfe der Durchflusszytometrie (FACS-DIVA) isoliert wurden (Abb. 2A). Diese Sortierung nach der Zellgrösse ergab über 90% TCR-Vß2-positive Tumorzellen. Danach wurden die Zellen mit 51Cr beladen und als Zielzellen für die Analyse der zytotoxischen Aktivität und der Tumorspezifität der T-Zellklone verwendet. Von den insgesamt 68 T-Zellklonen zeigten 3 Klone Tumorspezifität von denen 2 (CTL-Klone PN2 und L1) stabil in Kultur expandiert werden konnten (Abb. 3). Damit waren 4,4% von den in vitro ausgewachsen CD8+-T-Zellklonen tumor-reaktiv.


[Seite 39↓]

Abbildung 3: 51Cr-Freisetzungsversuch mit den ausgewachsenen CD8+-T-Zellen aus TIL des Patient WeW. Als Zielzellen wurden Tumorzellen aus denselben Patienten verwendet, die anhand ihrer Größe an der FACS-DIVA isoliert worden waren; E/T-Ratio war 30/1.

Die TCR-Vγ-Fragmentlängenanalysen von den zwei Tumor-spezifischen CTL-Klonen PN2 und L1 zeigten, dass diese jeweils 2 rearrangierte TCR-Vγ-Gene hatten, die bilallelisch rearrangiert waren, obwohl nicht vollständig ausgeschlossen werden kann, dass die Proben jeweils zwei T-Zellklone enthalten.

Abbildung 4: PCR-Fragmentlängenanalyse des CTL-Klons PN2 (A, B) und des CTL-Klons L1 (C, D). Die TCR-Vγ-PCR-Produkte wurden mit den Primern VG1 (A, C) und VG2 (B, D) generiert. Die Sequenzen der Primer und die TCR-Vγ-Familienspezifitäten sind in Tabelle 4 aufgelistet.

Einer der CD8+-T-Zellklone, der aus dem Tumor des Patienten WeW isoliert wurde, aber nicht gegen die Tumorzellen reagierte, exprimierte denselben TCR-Vß2-Phänotyp wie der ursprungliche CD4+-Tumorzellklon aus dem Hauttumor. Das TCR-Vγ-Rearrangement dieses CD8+-T-Zellklons war ebenfalls identisch mit dem der Tumorzelle. Eine Analyse des TCR-[Seite 40↓]Vß-Rearrangements ergab aber eine andere Sequenz für die junktionale Region. Während die Tumorzelle Jß2S3 hatte, war bei den T-Zellen Jß1S1 mit Vß2 rearrangiert. Die N-Regionsequenzen sind ebenso verschieden, wie die nachfolgend gezeigte Sequenzen der junktionalen TCR-Vß-Region belegen.

Jβ2s3 (Jß-Rearrangement der Tumorzelle)

AGCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCG

Jβ1s1 (Jß-Rearrangement des TCR-Vß2-positiven CD8+-T-Zellklons)

GACCAATGACGAGCTGTACTTTGGGCCAGGCACCAGGCTCACCGTGCTAG

Diese Beobachtung zeigt, dass das TCR-Vγ-Rearrangement allein nicht in allen Fällen für die Definition des Tumorzellklons bei CTCL ausreichend ist. Die Wahrscheinlichkeit, dass zwei unabhängige T-Zellklone das gleiche TCR-Vγ-Rearrangement zu haben ist zwar sehr gering, aber dieses Beispiel zeigt, dass es durchaus vorkommen kann.

5.1.4 Die Spezifität des Tumor-reaktiven CTL-Klons PN2

Zur Identifizierung von spezifischen T-Zellepitopen für den Tumor-spezifischen Klon PN2 wurde die Reaktion dieser T-Zellen auf kombinatorische OX8-Peptidbibliothek in 51Cr-Freisetzungsexperimenten untersucht. Als Zielzellen wurden die TAP-defiziente T2-Zelllinie gewählt, die mit dem Patient in der Expression von HLA-A*0201 übereinstimmt und als zweites MHC-Klasse-I-Molekül HLA-B5 exprimiert. Wegen des TAP-Defektes der T2-Zellen können die Peptide aus der zelleigenen Antigenprozessierungsmaschinerie nicht in die HLA-Moleküle gelangen. Als Folge wird HLA-B5 gar nicht, HLA-A*0201 nur schwach auf der Zelloberfläche exprimiert. Die schwache HLA-A*0201 Expression ist darauf zurückzuführen, dass Signalpeptide aus dem endoplasmatischen Retikulum an diese MHC-Moleküle binden können. Nach Inkubation der T2-Zellen mit exogenen Peptiden mit den Bindungsmotiven für HLA-A*0201 steigt die MHC-Expression an, da jetzt peptidfreie aber instabile HLA-A*0201-Molekül die Peptide binden können und stabilisiert werden. Dadurch [Seite 41↓]ist eine hohe Sensitivität beim Testen der kombinatorischen Peptidbibliotheken zu erreichen. Die T2-Zellen wurden eine halbe Stunde bei RT mit den Peptidbibliotheken (100 µg/ml) inkubiert, wobei die komplett randomisierte Bibliothek X9 als negative Kontrolle und das Mitogen ConA (20µg/ml) als positive Kontrolle verwendet wurden.

Abbildung 5: Positional scan mit dem Tumor-spezifischen CTL-Klon PN2. Auf der vertikalen Achse sind Mittelwerte aus Doppelbestimmung von 51Cr-Freisetzungswerten in Prozent angezeigt. Die Buchstaben auf der horizontalen Achse geben die in der jeweiligen OX8-Subbibliothek definierte Aminosäure an. P1 bis P9 bezeichnet die Sequenzposition im Peptid. E/T-Ratio war 30/1.

Die X9-Bibliothek ist komplett randomisiert, d.h. sie enthält alle möglichen Nonapeptide. In der OX8-Subbibliothek ist für die jeweiligen Sequenzposition Pn eine Aminosäure definiert. Ein erhöhter oder erniedrigter Wert für die Zytolyse gegenüber dem für X9 zeigt einen positiven oder negativen Einfluss dieser Aminosäuren auf die Erkennung der Peptide durch die T-Zelle an. Alle Werte über den Wert von X9 (hier 10,5%) werden als positiv bewertet. Für die Position 1 waren die basischen Aminosäuren Lysin und Arginin am stärksten aktiv. Für Position 5 war Tryptophan eindeutig die aktivste Aminosäure. Für die HLA-Ankerpositionen 2 und 9 waren die in den Epitopdatenbanken beschriebenen Ankeraminosäuren Valin, Isoleucin, Leucin und Alanin positiv. Für einige Positionen wie 3, 4, 6, 7 und 8 waren mehrere Aminosäuren zum Teil vergleichbar stark aktiv. Aminosäuren mit geringerer Aktivität als die X9-Bibliothek könnten entweder antagonistische Epitope sein oder keinen Effekt auf die T-Zelle haben (Null-Aminosäure). Daher sollten diese Aminosäuren bei der Erstellung der Epitope vermieden werden. In Tabelle 6 sind die am stärksten aktiven Aminosäuren und die Null-Aminosäuren für die einzelnen Sequenzpositionen zusammengestellt.


[Seite 42↓]

Tabelle 6: Ergebnis des Positional scans mit dem Tumor-spezifischen CTL-Klon PN2 mit kombinatorischen Peptidbibliotheken.

Position

bevorzugte Aminosäuren

Null-Aminosäuren

 

P1

K

R

            

P2

I

V

L

           

P3

N

P

S

  

E

F

G

H

     

P4

W

Y

R

H

F

I

K

L

M

Q

R

S

T

V

P5

W

             

P6

Q

N

   

D

E

F

K

P

R

W

Y

 

P7

Q

M

T

H

 

D

G

K

      

P8

K

M

F

  

W

Y

G

D

I

    

P9

A

L

I

V

          

Aus den Ergebnissen des Positional scans mit den kombinatorischen Peptidbibliotheken können definierte T-Zellepitope auf zwei unterschiedliche Arten abgeleitet werden:

  1. Kombination der aktiven Aminosäuren für die einzelnen Sequenzpositionen, was zu Mimotopen führt.
  2. Datenbanksuche auf Peptide, die zu dem Reaktionsprofil der T-Zelle passen.

Die Datenbanksuche mit den bevorzugten Aminosäuren aus Tabelle 6 ergab keine Kanditatensequenzen für Epitope. Deswegen wurde eine Datenbanksuchmatrix mit den folgenden Eingaben erstellt:

Die damit erstellte Matrix für die Datenbanksuche war

[KR]-[IVL]-{EFGH}-{IKLMQRSTV}-W-{DEFKPRWY}-{DGK}-X-[ALIV]

Eckige Klammern zeigen positive Suchkriterien und geschleifte Klammern negative Suchkriterien an. X steht für „beliebige Aminosäuren“. Mit der Matrix wurde in der [Seite 43↓]Datenbank http://us.expasy.org/tools/scanprosite/ nach möglichen Treffern aus humanen Proteinen gesucht.

Die Matrixsuche erbrachte 236 Treffer. Zusätzlich wurden aus den bevorzugten Aminosäuren 8 Mimotope generiert, die in Tabelle 7 fett markiert sind. Die insgesamt 244 Peptide wurden synthetisiert und für Verifizierungsexperimente eingesetzt. Dazu wurden T2-Zellen mit den Peptiden (10µg/ml) 30 min bei RT inkubiert und zu den T-Zellen zugegeben. Die IFNγ-Produktion wurde im ELISpot-Assay anhand der spot forming units (SFU) quantifiziert. In der Tabelle ist nur die aktiven Peptide - alle 8 Mimotope (fett markiert in der Tabelle) und 91 der potentiellen natürlichen Epitope – dargestellt. Im Abb. 16 sind alle getesteten Peptidsequenzen aufgelistet.

Tabelle 7: Potentielle Epitope für den CTL-Klon PN2. Als MHC-Bindungswerte wurden theoretische Scores für die Bindung der Peptide an HLA-A*0201 Molekül nach dem SYFPEITHI-Algorithmus berechnet und hier dargestellt. Die T-Zellaktivität wurde in spot forming units (SFU) für 1x106 Zellen angegeben. Für die beiden Oktapeptide konnte keine Scores für MHC-Bindung berechnet werden. Die Mimotope sind in fett dargestellt.

Nr.

Sequenz

Score

SFU

 

Nr.

Sequenz

Score

SFU

6

KADWWTNTA

14

3300

 

56

RVNAWQAKA

13

7000

12

KICAWMQLA

13

3000

 

57

RVRAWQRGA

9

5600

13

KINNWLNHA

19

2100

 

124

KALQWVSAI

20

6300

16

KLAGWHRIA

19

3900

 

126

KAPHWTNRI

16

4900

21

KLLGWTHCA

22

5600

 

129

KISNWTAAI

22

1700

22

KLQFWAVTA

18

2700

 

130

KITWWLCAI

21

3800

25

KVIFWSALA

12

1800

 

145

RANHWSAII

15

4800

32

RAKYWLERA

10

3800

 

152

RLQHWLWSI

24

3300

33

RAKYWVERA

10

4900

 

153

RVDFWTSTI

15

3300

34

RALWWAVGA

13

6900

 

254

KILGWAWWL

23

5300

39

RILHWQRAA

15

6000

 

255

KINNWIVQL

26

3100

40

RINYWHLEA

15

3100

 

258

KISGWTQAL

24

6100

45

RLIYWLTFA

19

3800

 

261

KLDYWSFQL

20

3900

46

RLLGWSLPA

19

5600

 

262

KLDYWSSQL

20

300

47

RLTFWTCLA

14

1900

 

267

KLKFWTVDL

23

5300

49

RLVHWCHGA

16

5700

 

269

KLLHWVSLL

27

2800

50

RLVYWLEVA

17

600

 

271

KLNCWGSRL

22

3300

53

RVKGWAPRA

10

2200

 

274

KLPHWTPTL

26

5000

54

RVLGWVAEA

20

6900

 

276

KLRHWQQVL

21

5100


[Seite 44↓]

Nr.

Sequenz

Score

SFU

 

Nr.

Sequenz

Score

SFU

277

KLRNWHHGL

23

2100

 

466

KIIPWNSRV

23

1600

279

KLSEWMESL

25

4400

 

469

KIPGWQAEV

25

4500

288

KVINWQTSL

19

4400

 

472

KITPWSSKV

22

5300

329

RITYWGQRL

16

4800

 

476

KLAFWLLAV

28

2500

331

RLICWQALL

24

6300

 

478

KLKFWTHCV

22

4600

337

RLLYWNRKL

23

2600

 

481

KLLFWVTEV

28

6200

338

RLNFWQHKL

23

3100

 

482

KLLYWNMAV

23

1800

339

RLNFWQQKL

22

1000

 

484

KLPPWNPQV

24

1200

340

RLNWWQHKL

24

3500

 

490

KVAFWLELV

20

5100

341

RLNWWQQKL

23

2800

 

502

RADFWMPAV

15

1800

346

RLRHWVYLL

25

2100

 

503

RAPFWGLRV

14

4900

347

RLSFWQHKL

22

3900

 

504

RAQFWSAYV

15

4800

348

RLSFWQQKL

21

3500

 

507

RASFWLALV

19

5700

349

RLSHWGRRL

20

3600

 

508

RAVFWIEFV

17

2300

350

RLSNWNISL

22

5800

 

509

RIDWWGFRV

18

4600

351

RLSWWQHKL

23

2600

 

510

RIPPWMEVV

20

6800

352

RLSWWQQKL

22

4800

 

511

RIQFWIAAV

24

5300

354

RLVYWLHTL

26

4100

 

512

RISAWQSPV

18

3600

356

RLYYWGLGL

22

2700

 

519

RLNWWSTV

k.A.

4700

357

RVAAWVEAL

21

5000

 

520

RLNWWVSV

k.A.

4600

358

RVAFWIIKL

21

7200

 

521

RLQNWVYNV

25

6700

359

RVCCWTPRL

17

1500

 

522

RLRAWGARV

22

6400

361

RVLDWVPKL

24

1400

 

523

RLRWWQPFV

21

1500

363

RVLFWGRIL

15

6100

 

526

RVCYWTIRV

15

2200

364

RVMGWVSGL

22

4000

 

527

RVIFWSLYV

16

2700

365

RVNGWSLPL

18

6100

 

528

RVLAWMFLV

16

5800

366

RVPAWGRCL

14

1500

 

531

RVLPWQAQV

20

6300

367

RVSWWGSTL

16

4200

 

532

RVLYWIPVV

20

4300

370

RVVPWNVTL

20

6100

 

534

RVSHWMLGV

16

5800

458

KAAYWASQV

16

4100

 

535

RVVGWSNIV

17

6100

459

KAKYWSSNV

13

5300

     

Allgemein steht, dass für die T-Zellaktivität nicht nur die MHC-Ankerpositionen sondern auch andere Aminosäurepositionen des antigenen Peptids, die direkt mit TCR in Kontakt stehen, entscheidend sind. Zum Beispiel das Peptid 523 mit einem guten MHC-Score von über 20 wurde schlechter erkannt als das Peptid 34 mit einem geringeren MHC-Score. Desweiteren wurden zum Teil sehr ähnliche Peptide von Klon PN2 unterschieden.


[Seite 45↓]

5.1.5  Expressionsanalysen für die potentielle WeW-Tumor-spezifische TAA

Um festzustellen welche der Proteine, die potentielle Epitope für PN2 enthalten, wirklich in den Tumorzellen des Patienten WeW exprimiert werden, wurde eine RT-PCR mit cDNA aus den Tumorzellen und spezifischen Primern für die Transkripte der 91 Proteingene durchgeführt. Die Proteinquellen für die aktiven Peptide sind im Anhang dargestellt. Von den insgesamt 91 Proteinen wurden 59 auf ihre Expressionen untersucht. Manche Proteine haben keine Introns und zu einigen davon gibt es Pseudogene mit hohen Homologien zu den mRNA. Als Quelle für die cDNA wurde Tumorzellen des Patienten, die anhand ihrer Grösse per Durchflusszytometrie isoliert wurden, verwendet. Aus den isolierten Zellen wurde zuerst RNA mit Ready to go kit (Qiagen) isoliert und dann mit oligo-dT Primer in cDNA umgeschrieben. Vor der cDNA-Synthese wurden die Proben mit RNAse-freier DNAse (Promega) behandelt, um genomische Kontaminationen zu entfernen. Die Sequenzen für das Design der cDNA-spezifischen Primer wurde aus der Nukleotiddatenbank BLAST übernommen. Die 5’- und 3’-Primer wurden so gewählt, dass sie auf verschiedenen Exons binden. Die Spezifität der Primer wurde durch Sequenzabgleich mit der Humangenomdatenbank geprüft. Die Schmelztemperatur und GC-Gehalt wurden mit dem Programm DNASTAR Version 5.03 (DNASTAR Inc., Madison, USA) abgeschätzt und so eingestellt, dass für alle Primerpaare etwa vergleichbare Schmelztemperaturen gegeben waren. Die PCR-Amplifikatgrössen lagen zwischen 300 und 600 Basenpaaren. Da die PCR nicht für alle Primerkombinationen notwendigerweise optimal eingestellt und die Menge an cDNA begrenzt war, bedeutet ein negatives Ergebnis nicht unbedingt, dass tatsächlich kein Transkript vorliegt. Umgekehrt ist ein positives Ergebnis sicher. Drei der PCR-Ansätze ergaben positive Signale und sind in Abb. 6 dargestellt. Die PCR-Banden wurden aus dem Gel ausgeschnitten und sequenziert (Firma AGOWA). Die Sequenzdaten bestätigten die Ursprungsproteine. Die damit identifizierten Proteine sind: Tumorangiogenese-Protein, Glucosylceramidase und N-myc downstream regulatedgene 1 (NDRG-1). Tumormaterialien von 4 weiteren Patienten, für die ausreichend Tumormaterial verfügbar war, wurden auf die Expression dieser Proteine untersucht. NDRG-1 war in 5 von 5, das Tumorangiogenese-Protein in 4 von 5 und die Ceramidase in 5 von 5 Fällen exprimiert. Diese drei Proteine könnten tatsächlich TAA für CTCL sein und damit die drei aus ihnen abgeleiteten Epitope auch Tumor-assoziierte T-Zellepitope für CTCL.


[Seite 46↓]

Abbildung 6: RT-PCR-Analyse von Tumorzellen des Patienten WeW, die als Zielzellen für den Tumorspezifitätstest mit den 2 Tumor-spezifischen CTL-Klonen benutzt wurden. B: NDRG-1 (423bp); C: Glucosylceramidase precursor (335bp); D: Tumorangiogenese Protein (392bp); A, E: 100 bp DNA-Marker.

5.1.6 Spezifität des Tumor-reaktiven CTL-Klons L1

Das Spezifitätsprofil vom Klon L1 wurde wie das für Klon PN2 mittels Positional Scan mit den kombinatorischen Peptidbibliotheken bestimmt. Klon 1 zeigte eine geringere zytolytische Aktivität in dieser Analyse als Klon PN2. Abb. 7 zeigt die Ergebnisse des Positional Scans. Die Werte für Position 1 waren schwach. Die HLA-Ankermotive Leucin, Methionin und Valin in Positionen 2 waren alle relativ wenig aktiv. In Ankerposition 9 hingegen gaben diese Aminosäuren klar positive Signale. In Position 3 hatten Alanin und Isoleucin bessere stimulatorische Aktivität als Valin, Methionin, Prolin und Glycin. In Position 4 hatten Histidin, Isoleucin, und Lysin scheinbar antagonistische Effekte. Es gab hier keine 51Cr Freigesetzung. Tryptophan war die effektivste Aminosäure in Position 5, während Phenylalanin negativ war. Tryptophan, Tyrosin, Methionin, Leucin waren in Position 6 etwa gleich stark aktiv und Phenylalanin, Isoleucin, Prolin, Valin und Glycin etwa gleich schwach. In Position 7 waren die drei polaren, ungeladenen Aminosäuren Serin, Threonin und Glycin aktiv. Position 8 war stark degeneriert.


[Seite 47↓]

Abbildung 7: Positional Scan mit dem CTL-Klons L1. Die Werte für 51Cr-Freisetzung (vertikale Achse) sind als Mittelwerte aus Doppelbestimmungen dargestellt. Die Buchstaben auf der horizontalen Achse geben die in der jeweiligen OX8-Subbibliothek definierten Aminosäuren an. P1 bis P9 bezeichnen die Sequenzposition im Peptid. E/T-Ratio war 30/1.

Tabelle 8 fasst die aktiven Aminosäuren zusammen. Trotz der insgesamt schwachen Signale konnten aus den bevorzugten Aminosäuren 64 potentielle Epitope durch Kombinatorik abgeleitet werden (Tabelle 9). Für die Erstellung der Epitopkandidaten wurden Aminosäuren mit der Aktivität von 1 bis 2 fachen Standardabweichung über den X9-Wert ausgewählt. Für die HLA-Ankerposition 2 und 9, für die keine eindeutig positiven Aminosäuren gefunden wurden, wurde jeweils Leucin ausgewählt, um die Anzahl der Peptide reduzieren und gute MHC-Bindung zu erreichen.

Tabelle 8: Zusammenfassung der Ergebnisse für das Positional Scan des Klons L1

Position

Ergebnis aus
Positional Scan

MHC-Ankerposition

P1

 

R

Y

     

P2

      

L

 

P3

 

A

I

     

P4

 

F

T

     

P5

 

W

      

P6

 

W

Y

     

P7

 

G

S

     

P8

 

M

P

     

P9

      

L

 


[Seite 48↓]

Neben den Mimotopen wurden Peptide aus natürlichen Proteinquellen gesucht, wobei diese Datenbanksuche im Gegensatz zu Klon PN2 ausschliesslich mit positiven Suchkriterien durchgeführt wurden. Zwei potentielle Epitope wurden gefunden. Eine Peptidsequenz YLVTWPATA aus einer Integrin-4βD-Splice-Variante und eine zweite Peptidsequenz RAMMTMAVL aus der env-Region des humanen endogenen Retrovirus HERV-K10. Die spezifische Splice-Variante von Integrin-4βD konnte im Tumor des Patienten WeWnicht nachgewiesen werden. Die Expression von env aus HERV-K10 erfordert, dass das Virusgenom transkribiert und die zwischen dem LTR und env gelegenen pol- und gag-Regionen herausgespleisst werden (Wang-Johanning, et al., 2003). Die Virus-DNA konnte in Volllänge auf genomischer Ebene in den Tumorzellen des Patienten WeW nachgewiesen werden. Eine detailierte PCR-Analyse mit Primern aus den LTR und gag bzw. env ergab aber, dass das Transkript nicht gespleisst war und daher env nicht als Protein exprimiert sein konnte. Damit ist es nicht möglich, dass das env-Epitop durch Prozessierung des env-Proteins entsteht. Mit diesen RT-PCR-Analysen wurde gezeigt, dass die Quellproteine für die beiden potentiellen natürlichen Epitopen in den Tumorzellen des Patienten WeW nicht vorkommen und damit nicht Ursprung der Epitope sein können.

Für die beiden natürlichen Epitope wurden Mimotope konstruiert und ebenso wie ihre natürliche Korrelate getestet. Durch Einführung von Leucin in die MHC-Ankerposition 9 wurden Peptide mit potentiell guter Bindung an HLA-A*0201 generiert. Ausserdem wurde zu einem der Mimotopen ein potentieller Antagonist mit Histidin in Position 4 generiert (Peptid Nr.69). Die insgesamt 69 synthetischen Peptide (64 Mimotope, 2 potentielle natürliche Epitope mit entsprechenden Mimotopen und 1 Antagonist) wurden sowohl im 51Cr-Freisetzungsversuch als auch auf IFNγ-Produktion (ELISpot) auf ihre Fähigkeit, T-Zellen zu stimulieren, untersucht (Tabelle 9). Die Ergebnisse zeigten deutliche Unterschiede bezüglich der beiden Effektorfunktionen. Um die Werte miteinander vergleichen zu können, wurden diese normalisiert und graphisch dargestellt (Abb. 8). Für 43 der Peptide korrelierte die IFNγ-Synthese mit der zytolytischen Aktivität, d.h. die T-Zellen reagierten in beiden Assays vergleichbar auf die Peptide nur mehr oder weniger stark. Dies war nicht der Fall bei den Peptiden 49, 53, 56 und 63. Trotz hoher zytolytischer Aktivität wurde kein IFNγ induziert. Bei Peptid 55 war maximale Zytolyse bei schwacher IFNγ-Ausschüttung zu sehen. 21 Peptide induzierten IFNγ-Synthese aber keine zytolytische Aktivität. Die Peptide 54 und 50 wurden schwach oder gar nicht erkannt.


[Seite 49↓]

Tabelle 9: Aktivität des CTL-Klons L1. Die Werte für Zytolyse sind in % netto-51Cr-Freisetzung angegeben, d.h. 51Cr-Freisetzungswert ohne Peptid (4,6%) ist abgezogen. Die Werte für IFNγ-Synthese sind in SFU pro 1x106 Zellen angegeben, wobei der Basiswert für IFNγ-Synthese, d.h. ohne Peptid (48 SFU) abgezogen ist. Die natürlichen Epitope sind in fett und der Antagonist in kursiv gezeigt.

Nr.

Sequenz

Zytolyse

SFU

 

Nr.

Sequenz

Zytolyse

SFU

1

RLAFWWGML

0,00

310

 

36

YLITWWGML

10,92

800

2

RLIFWWGML

0,00

640

 

37

YLAFWYGML

0,00

780

3

RLATWWGML

4,70

760

 

38

YLIFWYGML

0,00

460

4

RLITWWGML

0,00

530

 

39

YLATWYGML

8,01

960

5

RLAFWYGML

0,00

620

 

40

YLITWYGML

2,75

280

6

RLIFWYGML

0,00

550

 

41

YLAFWWSML

0,00

770

7

RLATWYGML

9,93

920

 

42

YLIFWWSML

0,00

840

8

RLITWYGML

0,00

530

 

43

YLATWWSML

6,58

730

9

RLAFWWSML

0,00

630

 

44

YLITWWSML

6,26

750

10

RLIFWWSML

0,00

760

 

45

YLAFWYSML

0,00

730

11

RLATWWSML

7,24

770

 

46

YLIFWYSML

5,91

650

12

RLITWWSML

1,33

680

 

47

YLATWYSML

11,14

930

13

RLAFWYSML

0,00

650

 

48

YLITWYSML

4,33

400

14

RLIFWYSML

0,00

690

 

49

YLAFWWGPL

6,24

0

15

RLATWYSML

7,64

890

 

50

YLIFWWGPL

1,31

50

16

RLITWYSML

0,00

590

 

51

YLATWWGPL

9,16

290

17

RLAFWWGPL

0,00

730

 

52

YLITWWGPL

5,10

380

18

RLIFWWGPL

7,76

810

 

53

YLAFWYGPL

2,42

0

19

RLATWWGPL

9,62

990

 

54

YLIFWYGPL

0,00

0

20

RLITWWGPL

6,50

970

 

55

YLATWYGPL

15,51

160

21

RLAFWYGPL

3,90

930

 

56

YLITWYGPL

2,41

0

22

RLIFWYGPL

7,78

520

 

57

YLAFWWSPL

5,96

550

23

RLATWYGPL

13,40

990

 

58

YLIFWWSPL

7,38

750

24

RLITWYGPL

0,00

570

 

59

YLATWWSPL

15,19

1050

25

RLAFWWSPL

2,62

500

 

60

YLITWWSPL

11,21

630

26

RLIFWWSPL

0,75

790

 

61

YLAFWYSPL

3,92

480

27

RLATWWSPL

11,06

660

 

62

YLIFWYSPL

0,60

430

28

RLITWWSPL

7,04

580

 

63

YLATWYSPL

4,66

0

29

RLAFWYSPL

9,70

440

 

64

YLITWYSPL

10,28

600

30

RLIFWYSPL

10,18

650

 

65

YLVTWPATA

3,34

710

31

RLATWYSPL

10,46

500

 

66

YLVTWPATL

8,48

990

32

RLITWYSPL

9,85

220

 

67

RAMMTMAVL

0,00

810

33

YLAFWWGML

8,31

560

 

68

RLMMTMAVL

0,00

620

34

YLIFWWGML

5,61

490

 

69

RVAHWWSPM

0,00

490

35

YLATWWGML

11,36

690

     

Peptid 65 aus der Integrin-4βD-Splice-Variante hat eine schwache, das entsprechende Mimotop (Peptid 66) mit Leucin in Position 9 aber eine deutlich stärkere stimulatorische Kapazität. Das natürliche und das modifizierte Epitop aus der env-Region HERV-K10 waren beide aktiv.


[Seite 50↓]

Der potentielle Antagonist Peptid 69 war tatsächlich negativ in Zytotoxizitätsassays, zeigte aber eine mittlere Aktivität bezüglich der IFNγ-Induktion. Die bei einer Reihe von Peptiden offenbare Segregationvon Zytolyse und IFNγ-Auschüttung läßt sich mit den Sequenzen dieser Peptide korrelieren. Für die Zytolyse war Arginin in Position 1 in Kombination mit Prolin in Position 8 oder Tyrosin in Position 1 in Kombination mit Methionin in Position 8 bevorzugt. Für IFNγ-Produktion hingegen war Tyrosin in Position 1 in Kombination mit Threonin und Prolin in Position 8 besonders aktiv. Threonin in Position 4 korrelierte positiv sowohl mit der Zytolyseaktivität als mit der IFNγ-Synthese.

Abbildung 8: Vergleich der zytolytischen Aktivität (schwarze Säulen) und der IFNγ-Synthese (weisse Säulen) des Klons L1 auf die Mimotope und Epitope. Die Werte aus der Tabelle 8 sind normalisiert, wobei die jeweiligen maximalen Werte in 100% gesetzt wurden. Die Peptide sind entsprechend der Numerierung in der Tabelle aufgelistet.

Die für die beiden Klone PN2 und L1 aktive Peptide weisen Sequenzähnlichkeit auf, was auf Übereinstimmung in den Spezifitätsrepertoire der Klone hindeuten könnte. Dies wurde in weiteren Untersuchungen geprüft. Der Klon PN2 war stabiler als Klon L1, sodass er auf Reaktivität auf L1-Peptide gestestet werden konnte. Dazu wurden T2-Zellen mit L1-Peptiden (10 µg/ml) gepulst und die spezifische Zytolyse durch PN2-T-Zellen anhand 51Cr-Freisetzung gemessen. 14 der für L1 aktiven Epitope wurden auch von PN2 erkannt, wobei allerdings die Messwerte für 5 dieser Peptide relativ schwach waren. Peptide mit Tyrosin in Position 1 wurden vom Klon PN2 gar nicht erkannt, wie es auch aus den Positional Scan-Ergebnissenzu [Seite 51↓]erkennen war. Desweiteren wurde Threonin in Position 4 ebenfalls nicht erkannt. Die negativen Ergebnisse sind in Tabelle 10 nicht dargestellt.

Tabelle 10: Das Reaktionsprofile des Klons PN2 auf L1-Peptide. Die Zytolyse wurde anhand der 51Cr-Freisetzung gemessen und in % angegeben. Der 51Cr-Freisetzungswert ohne Peptid war 1,75%.

Nr.

Peptide

51Cr-Freisetzung (%)

1

R

L

A

F

W

W

G

M

L

35,62

2

R

L

I

F

W

W

G

M

L

9,53

29

R

L

A

F

W

Y

S

P

L

31,13

30

R

L

I

F

W

Y

S

P

L

7,93

9

R

L

A

F

W

W

S

M

L

29,08

10

R

L

I

F

W

W

S

M

L

11,96

25

R

L

A

F

W

W

S

P

L

26,75

26

R

L

I

F

W

W

S

P

L

10,86

13

R

L

A

F

W

Y

S

M

L

25,26

14

R

L

I

F

W

Y

S

M

L

5,47

5

R

L

A

F

W

Y

G

M

L

24,88

6

R

L

I

F

W

Y

G

M

L

3,08

17

R

L

A

F

W

W

G

P

L

19,01

18

R

L

I

F

W

W

G

P

L

3,02

21

R

L

A

F

W

Y

G

P

L

14,51

22

R

L

I

F

W

Y

G

P

L

4,60

69

R

V

A

H

W

W

S

P

M

17,34

Interessanterweise war zu beobachten, dass Alanin in Position 3 immer besser erkannt wurde als Isoleucin. Prolin in Position 8 hatte keinen Einfluss auf die T-Zellreaktion. Die Degeneriertheit der Erkennung von Aminosäuren in Position 8 war ebenfalls im Positional Scan zu beobachten (Abb. 5). Peptide mit Histidin in Position 4 hatten keinen Effekt bei der Stimulierung von Klon L1, wurden aber von Klon PN2 erkannt (Tabelle 10). Insgesamt lässt sich feststellen, dass trotz Ähnlichkeiten in manchen Sequenzen die beiden T-Zellklone L1 und PN2 unterschiedliche Spezifitäten haben und nur einzelne Peptide kreuzerkannt werden.

5.2 Funktionelle Avidität der Tumor-spezifischen T-Zellen

Obwohl eine große Anzahl von Peptiden von PN2-Zellen erkannt wurde, gibt es große Unterschiede in der Zahl der Spots im ELISpot-Assay, d.h. die T-Zellen sprechen je nach [Seite 52↓]Peptid unterschiedlich stark an. Diese Unterschiede können auf unterschiedliche Affinitäten der TCR von PN2 für die verschiedenen MHC-Peptidkomplexe und auf unterschiedliche Schwellenwerte in den individuellen T-Zellen für die Initiation einer Reaktion begründet sein. Unterschiedliche Schwellenwerte einzelner Zellen eines T-Zellklons wiederum können auf Unterschiede in der Dichte der TCR oder der kostimulatorischen Moleküle auf den Oberflächen der Zellen oder auf Expressionsunterschiede der Moleküle der Signaltransduktion oder der Transkriptionsfaktoren bzw. der Aktivierungszustände dieser Moleküle zurückzuführen zu sein. Diese verschiedenen Einflußgrößen können nicht im einzelnen quantativ simultan zu der gemessenen Reaktion einer T-Zelle erfasst werden. Deswegen wird häufig die Potenz der Peptide, T-Zellen zu stimulieren, als sogenannte funktionelle Avidität (FA) bestimmt. Als FA wird die Konzentration an Antigen definiert, bei der die T-Zelle ihre halb-maximale Effektoraktivität wie z.B. Zytolyseaktivität erreicht. Für alle Peptide, auf die PN2 reagierte, wurde die FA in 51Cr-Freisetzungsversuch bei einem Effektor zu Target (E/T) Ratio von 30:1 bestimmt. 51Cr-Freisetzungsassays sind für diese Bestimmungen ausgewählt worden, da sie sensitiver als IFNγ-Assays sind. Die Peptide wurden ab einer Konzentration von 1µg/ml seriell in -Schritten titriert. Als Zielzellen wurden T2-Zellen 30 min mit den Peptiden beladen. Für die Auswertung der Daten wurden alle Konzentrationen in Molaritäten umgerechnet. Abb. 9 zeigt einige repräsentative Beispiele für die Titrationsexperimente zur Bestimmung der FA von PN2 für die verschiedenen Peptide.


[Seite 53↓]

Abbildung 9: 51Cr-Freisetzungsversuch zur Bestimmung der funktionellen Avidität. Die Peptidnummern mit entsprechenden Sequenzen sind im Abb. 16 aufgelistet.

Peptid 258, dessen potentielles natürliches Ursprungprotein in den Tumorzellen nachgewiesen werden konnte, wird schwächer erkannt als die Mimotope 351, 347, 352 und 341. Bei einer Peptidkonzentration von 100 pM wurde immer noch Zytolyse für die Mimotope beobachtet aber nicht für das natürliche Epitop. Zum Berechnen des halbmaximalen Zytolysewertes wurden die Titrationskurven nach Clark (Moyle et al., 1978) wie folgt linearisiert und graphisch dargestellt.

mit

= spezifische Zytolyse

Die linearisierten Regressionsgraden sind in Abb. 10 dargestellt.


[Seite 54↓]

Abbildung 10: Die funktionelle Avidität von CTL-Klon PN2.Auf der X-Achse sind die Werte des natürlichen Logarithmus (ln) der Peptikonzentration (pM), auf der Y-Achse die Werte für Logit (p) dargestellt. Für die linearisierten Titrationskurven wurden die Regressionsgraden berechnet und hier dargestellt.

Die horizontale Achse gibt die Werte für den natürlichen Logarithmus (ln) der Peptidkonzentration (pM) an, die vertikale Achse die Werte für Logit (p). Aus der Formel der Trendlinie für die einzelnen Titrationen können die Konzentrationen berechnet werden, bei der Logit(p) gleich 0 ist. Diese einfach aus der linearen Gleichung (y=ax-b) ermittelte Werte für Logit (p)=0 entsprechen der für halbmaximale Zytolyse benötigten Peptidmengen, da Logit (p)=0 ist, wenn p=0,5 ist. In Tabelle 11 sind die Peptidkonzentrationen für die halbmaximale Zytolysen in nanomolar (nM) angegeben. Je geringer diese Konzentrationen desto höher ist die FA. Für das Peptid mit der schwächsten FA (Peptid 57) wurde eine etwa 3x103-fach höhere Peptidkonzentration für die halbmaximale Zytolyse benötigt als für das potenteste Peptid (Peptid 276). Die mRNA für das Ursprungsprotein dieses Peptids wurde in den Tumorzellen des Patienten nachgewiesen. Die Mimotope 347, 341, 352 waren mit weniger als 10 nM Peptid für halbmaximale Zytolyse von vergleichbarer Avidität. Insgesamt schienen die Mimotope eher hohe FA aufzuweisen. Neben den für Klon PN2 bestimmten Peptide wurden zwei von PN2 kreuzerkannten L1-Peptide vermessen und erwiesen sich für PN2 als relativ schwach potent mit FA von 110 nM für Peptid 1 und mit 1170 nM für Peptid 5.


[Seite 55↓]

Tabelle 11: Die funktionelle Avidität des CTL-Klons PN2. Die Peptidmenge für halbmaximale Zytolyse wurde in nM angegeben. Die Mimotope sind in fett dargestellt. * markiert die L1-Peptide

Nr

Sequenzen

nM

 

Nr

Sequenzen

nM

276

KLRHWQQVL

1,88E+00

 

476

KLAFWLLAV

2,13E+02

347

RLSFWQHKL

6,74E+00

 

520

RLNWWVSV

2,20E+02

341

RLNWWQQKL

8,10E+00

 

350

RLSNWNISL

2,65E+02

352

RLSWWQQKL

8,46E+00

 

339

RLNFWQQKL

3,68E+02

523

RLRWWQPFV

1,39E+01

 

32

RAKYWLERA

3,87E+02

351

RLSWWQHKL

1,44E+01

 

367

RVSWWGSTL

4,30E+02

482

KLLYWNMAV

3,21E+01

 

258

KISGWTQAL

6,05E+02

25

KVIFWSALA

3,29E+01

 

508

RAVFWIEFV

6,19E+02

47

RLTFWTCLA

3,32E+01

 

6

KADWWTNTA

6,69E+02

262

KLDYWSSQL

4,66E+01

 

254

KILGWAWWL

8,02E+02

348

RLSFWQQKL

4,96E+01

 

255

KINNWIVQL

8,30E+02

340

RLNWWQHKL

7,67E+01

 

5*

RLAFWYGML

1,17E+03

22

KLQFWAVTA

9,34E+01

 

16

KLAGWHRIA

1,19E+03

338

RLNFWQHKL

9,63E+01

 

53

RVKGWAPRA

1,51E+03

1*

RLAFWWGML

1,10E+02

 

358

RVAFWIIKL

1,92E+03

124

KALQWVSAI

1,89E+02

 

46

RLLGWSLPA

2,96E+03

126

KAPHWTNRI

1,96E+02

 

57

RVRAWQRGA

6,38E+03

Da Tumor-spezifische T-Zellen i.d.R. körpereigene Antigene erkennen, wird vielfach angenommen, dass ihre Aviditäten im Gegensatz zu den Aviditäten Virus-spezifischer T-Zellen für ihre Antigene gering seien. Um die Werte für die zuvor dargestellten FA des PN2-Klons für die verschiedenen Epitope und Mimotope einordnen und bewerten zu können, wurden die FA für die Cytomegalievirus-spezifische CTL-Linie CMV-IrM und für die Tumor-spezifische CTL-Linie ELA-Trit bestimmt (Tabelle12). Die FA von CMV-IrM für ihr Epitope, das CMV-Peptid NLVPMVATV, wurde mit 133 nM bestimmt. Die FA der Tumor-spezifische Linie ELA-Trit für das ELA-Peptid (ELAGIGILTV) beträgt 100 pM. ELAGIGILTV ist ein Mimotop des natürlichen Epitopes EAAGIGILTV aus dem MART/Melan-A Protein, bei dem die MHC-Bindung durch einen Aminosäureaustausch in der ersten Ankerposition zu Leucine verbessert wurde. Die FA für das natürliche Peptid EAAGIGILTV war mit 4,7 nM deutlich niedriger als die für das Mimotop. Die FA der tumor-spezifische CTL war somit geringer als die FA der virus-spezifischen CTL-Linie. Der CTL-Klon ELA-Trit war aus einem Melanompatienten isoliert worden und lysiert autologe [Seite 56↓]Tumorzelllinie, die MART/Melan-A expremieren (Trefzer et al., 2004), was bedeutet, dass eine FA von 4,7 nM ausreichend für eine tumorizide Aktivität der T-Zellen ist.

Die Effizienz der Antigenerkennung durch die tumor-spezifischen CTL ist, wie mehrfach gezeigt worden war, direkt mit der Effizienz ihrer Tumorerkennung korreliert (Dutoit et al., 2001, Gilboa 1999, Yee et al., 1999). Dutoit und Kollegen konnten zudem zeigen, dass die FA der T-Zellen mit der Stabilität der MHC-Peptid-Multimerbindung an die TCR korreliert (Dutoit et al., 2002), d.h. bei T-Zellen mit höherer FA ist die Bindung der MHC-Peptidkomplex-Multimere an die TCR stabiler und die Dissoziation der Multimere langsamer als bei den T-Zellen mit niedriger FA. Dies konnten wir auch bei unseren beiden CTL-Linien beobachten. Hierzu wurde die Halbwertszeit (t1/2) für die Dissoziation der löslichen tetrameren MHC-Peptidkomplexe von den T-Zellen anhand der Abnahme der MFI (engl. mean fluorescence intensity) der Fluorochrom-markierten MHC-Tetramerpeptidkomplexe ermittelt (diese Messungen wurde von Dr. Katrin Sparbier durchgeführt).

Tabelle 12: Die funktionelle Aviditäten der CTL-Linien CMV-IrM und ELA-Trit wurden mit Chromfreisetzungsversuchen, die Halbwertszeiten der Dissoziation der tetrameren MHC-Peptidkomplexe von den T-Zellen per Durchflußzytometrie bestimmt.

Klon

Peptid

FA [nM]

t1/2 [min]

CMV-IrM

NLVPMVATV

133

5,5

ELA-Trit

ELAGIGILTV

0,1

46

ELA-Trit

EAAGIGILTV

4,7

n.d.

5.3 Charakterisierung der Tumorzellen und der Tumor-infiltrierenden T-Zellen

Die Identifizierung von Tumor-assoziierten T-Zellepitopen und Mimotopen für Patient WeW ermöglicht es zum ersten Mal Tumor-spezifische T-Zellen in den TIL-Populationen von CTCL spezifisch zu analysieren. Gleichzeitig kann, wie zuvor gezeigt, die Tumorzellen selbst anhand der Größe und TCR-Vß2-Expression erkannt werden. Mit diesen spezifischen Nachweisverfahren ist es jetzt möglich, die T-Zellen im Tumor differenziert zu analysieren. Hierzu wurden Multiparameteranalysen per Durchflusszytometrie mit den im Fall von Patient WeW ausreichenden Tumormaterial durchgeführt. Der Vorteil der durchflusszytometrischen Multiparameteranalyse ist die Möglichkeit für jede Zelle mehrere Parameter gleichzeitig zu untersuchen. Zur Definition unterschiedlicher T-Zellsubpopulationen ist eine simultane Analyse von verschiedener Markermolekülen erforderlich. Außerdem ist es für die [Seite 57↓]Charakterisierung rarer Tumor-spezifischer T-Zellen nötig, die Analyse auf der Einzelzellebene durchzuführen, was mit anderen Methoden wie z.B. PCR nicht möglich ist. Der Nachweis spezifischer T-Zellen erfolgte mit Dimer X (BD), einer dimeren Form von HLA-A*0201 als Fusionsprotein mit Immunglobulin. Die Peptidbindungstasche der HLA-Anteile können mit synthetischen Peptiden beladen werden. Mit DimerX konnten Tumor-spezifische CTL direkt in Einzelzellsuspension des Tumors des Patienten WeW durchflusszytometrisch detektiert werden. Die Frequenzen lagen je nach Peptid zwischen 0,89% und 23,7% der CD3+CD8+-Zellen (siehe Tabelle 13 ).

Tabelle 13: Frequenzen von Tumor-spezifischen T-Zellen im Tumor von Patient WeW (Anteil an CD3+CD8+-T-Zellen in Prozent).

Peptid

Sequenz

% der CD3+CD8+-T-Zellen

65

YLVTWPATA

1,95

276

KLRHWQQVL

0,89

341

RLNWWQQKL

9,47

347

RLSFWQHKL

3,47

351

RLSWWQHKL

4,9

358

RVAFWIIKL

23,70

367

RVSWWGSTL

6,23

Diese Peptide sind eine Auswahl der für die WeW-Tumor-spezifischen CTL-Klone L1 (Peptid 65) und PN2 (Peptide 276, 341, 347, 351, 358 und 367) bestimmten Epitope. Sie können im polyklonalen Gemisch der T-Zellen im Tumor, T-Zellklone mit anderen Feinspezifitäten als die der ursprünglichen Klone L1 und PN2 anzeigen. Die große Spannbreite der Frequenzen von T-Zellen mit Spezifitäten für die Peptide ist wahrscheinlich auf diese Unterschiede in den Feinspezifitäten der einzelnen T-Zellen zurückzuführen.

Für die weitergehende Analyse der T-Zellen wurden folgende Marker ausgewählt:

1. Marker für die Differenzierungszustände der Zellen. Hierzu gehören CD45RO, CD45RA, CCR7, CD27, CD28 und CD62L. CD45 ist eine membrangebundene Tyrosinphosphatase, die an der Signaltransduktion der T-Zellen beteiligt ist. Die schwere Isoform CD45RA wird auf naïven oder ruhenden T-Zellen exprimiert während die leichte Isoform CD45ROauf memory oder aktivierten T-Zellen exprimiert wird (Barcley et al., 1993). Die Expression von CD45RA auf Effektorzellen wurde ebenfalls beschrieben. CCR7 ist ein Mitglied der G-protein-coupled-[Seite 58↓]Chemokinrezeptorfamilie, das in der Adhesion und Chemotaxis der Zellen eine Rolle spielt und mit homing in die Lymphknoten korreliert ist (Hasegawa, et al., 2000). CD28wirkt nach Bindung an CD80 und CD86 kostimulatorisch auf die Proliferation der T-Zellen (Schlossman et al., 1995). CD27 hat anscheinend auch eine kostimulatorische Funktion für T- und B-Zellen (Hintzen, et al., 1994). Der molekulare Mechanismus der Kostimulation ist aber noch nicht aufgeklärt. CD70 ist einer der nachgewiesenen Gegenrezeptoren für CD27 (Bowman, et al., 1994). Die CD27/CD70 Interaktion spielt eine Rolle bei der direkten Kommunikation zwischen T-Zellen. CD62L ist ein Homingrezeptor der L-Selektinfamilie in peripheren lymphoiden Geweben. Verschiedene T-Zellsubpopulationen exprimieren unterschiedliche Kombinationen dieser Markern: CCR7-CD45RO+ Zellen wurden als effector memory undCCR7+CD45RO+-Zellen als central memory T-Zellen bezeichnet(Sallusto, et al., 1999).Bei einer alternativen Definitionwerden als effector memory T-Zellen CD45RA+CD62L--Zellen und als central memory T-ZellenCD45RA-CD62L+-Zellen bezeichnet (Maldonado, et al., 2003).

2. Marker für den Aktivierungszustand der T-Zellen: HLA-DR, CD25, CD26, CD69, CD30, CD38 und CD71. CD69 ist ein Kurzzeitaktivierungsmarker, d.h. es wird sehr schnell hochreguliert bleibt aber nur für wenige Stunden exprimiert, und HLA-DR ein Langzeitaktivierungsmarker, d.h. nach Induktion bleibt dieser Marker für Tage auf der Zelloberfläche (Knapp et al., 1989; Schlossman et al., 1995). CD30 ist auf aktivierten T- und B-Zellen exprimiert. Die molekularen Effekte dieser Marker auf die T-Zelle sind nicht klar. CD25 ist eine Untereinheit des hochaffinen IL-2 Rezeptors und wird auf prolifierenden T-Zellen exprimiert (Knapp et al., 1989; Schlossman et al., 1995). Die Exopeptidase CD26 ist als kostimulatorisches Molekül bei der T-Zellaktivierung beschrieben worden (Fleischer, 1994). CD71 ist der Transferinrezeptor und wird auf allen sich teilenden Zellen exprimiert (Schlossman et al., 1995). Für CD38 ist die Funktion unklar. Möglicherweise ist es an der Regulation der Zellaktivierung und Proliferation über Modulatoren des Ca2+-Transports beteiligt.

3. Marker für Effektorfunktion der T-Zellen: Fas/FasL, Granzym und Perforin. Für die antigen-abhängige Zytotoxizität benötigt die zytotoxische T-Zelle Perforin und Granzym. Perforin polymerisiert in der Membran der Zielzelle und bildet dabei Poren. Granzyme sind Serinesterasen, die Apoptose auslösen. Durch Fas und FasL Wechselwirkung wird dagegen antigen-unabhängige Zytotoxizität ausgelöst. Fas induziert nach Bindung an FasL Apoptose der Zellen durch Aktivierung von Caspasen (Ju, et al., 1995).


[Seite 59↓]

4. Marker für NK-Zellen und NK-ähnliche Eigenschaften von T-Zellen: CD56, KIR NKAT2, und KIR NKB1. CD56 ist ein NK-Zellmarker, kommt aber auch auf normalen T-Zellen vor. Es ist ein membrangebundens Gycoprotein, das auch NCAM (engl. neural cell adhesion molecule) genannt wird und an der Zell-Zelladhesion beteiligt ist (Schlossman et al., 1995). KIRs (engl. killing inhibitory receptors) sind auf NK-Zellen und manchen T-Zellen exprimiert und blockieren zytotoxische Aktivität nach Bindung an bestimmten HLA-Molekülen. KIR mit langem zytoplasmatischen Teil inhibieren während KIR mit kurzem zytoplasmatischen Teil die T- und NK-Zellaktivität induzieren können (Parham, 2000).

5. Marker für Suppressor T-Zellen: GITR, CTLA-4 und PD1. Durch die Bindung an CD80/CD86 reguliert CTLA-4 (engl. cytotoxic T lymphocyte-associated protein-4) die T-Zellen negativ (Walunas, et al., 1994). GITR (engl. glucocorticoid induced TNF receptor family related gene) ist ein neues Mitglied der TNFR-Familie, das wahrscheinlich an der Regulation der TCR-vermittelten Apoptose beteiligt ist (Nocentini, et al., 1997). Mitglieder der TNFR-Familien (eng. Tumor necrosis factor receptor) sind Todesrezeptoren (engl death receptors) auf der Zelloberfläche, die durch Bindung an spezifischen Liganden Apoptose in den Zellen auslösen. PD-1 wird auf aktivierten T- und B-Zellen exprimiert und inhibiert die Aktivierung der Zellen (Freeman, et al., 2000).

Tabelle 14 zeigt die Expression dieser Markermoleküle durch T-Zellen, die aus dem Tumor des Patienten WeW direkt isoliert wurden. Tumorzellen bei CTCL sind in der Regel reife CD4+-T-Zellen mit CD45RO+-Phänotyp (Sterry and Mielke, 1989). Bei dem Patient WeW exprimierten fast alle TCR Vß2+-Tumorzellen CD45RO, nicht CD45RA. Die CD8+-T-Zellen waren überwiegend CD45RO+CCR7-, wobei diese per Definition zu den effector memory T-Zellen gehören (Sallusto, et al., 1999). Obwohl der Großteil von CD8+-T-Zellen wie terminal differenzierte Effektorzellen erschien, war die Expression des Langzeitaktivierungsmarkers HLA-DR und des Kurzzeitaktivierungsmarkers CD69 nur bei einem kleinen Teil dieser Zellen zu beobachten. Der Transferrinrezeptor CD71 war im starken Maße von den Tumorzellen aber nicht von den CD8+-T-Zellen exprimiert. Ausserdem exprimierten die Tumorzellen CCR7. CD27 wurde von den meisten Tumorzellen und CD8+-T-Zellen gleichermaßen exprimiert.


[Seite 60↓]

Tabelle 14: Durchflusszytometrische Analyse der Tumorzellen, d.h. große TCR-Vß2+-Zellen, und CD8+-T-Zellen im Tumor des Patienten WeW. Für die einzelnen Marker ist jeweils, der prozentuale Anteil an positiven Zellen wie folgt angezeigt: +++++ 80-100% positive Zellen; ++++ 60-80% positive Zellen; +++ 40-60% positive Zellen; ++ 20-40%; + unter 20% positive Zellen; - keine positive Zellen

 

TCR Vß2+

CD8+-TIL

CD25

-

-

CD26

+

+

CD27

+++++

+++++

CD28

+++

+

CD30

-

-

CD38

 

+

CD45RA

-

+

CD45RO

+++++

++++

CD56

-

+

CD62L

-

+

CD69

-

+

CD71

+++++

-

CCR7

+++++

-

CTLA-4

-

+

Fas (CD95)

-

+++++

FasL

+++++

++

GITR

+

+

Granzym B

-

+

HLA-DR

-

+

KIR NKAT2

-

-

KIR NKB1

  

PD1

-

-

Perforin

-

-

Die Tumorzellen wie auch Tumor-infiltrierenden CD8+-T-Zellen exprimierten FasL, wogegen die normalen T-Zellen, darunter die CD8+-T-Zellen, aber nicht die Tumorzellen den entprechenden Rezeptor Fas (CD95) exprimierten. Die Dotblots der durchflußzytometrischen Analyse der Zellen aus dem Tumor zeigen diese Expression von Fas auf den Tumor-infiltrierenden T-Zellen und FasL auf den Vß2-positiven Tumorzellen wie auch Vß2-negativen T-Zellen (Abb. 11). Dies kann auf „tumor-counterattack“ gegen die Tumor-spezifische Immunantwort hindeuten, wie es auch von anderen Autoren beschrieben wurden (Ni, et al., 2001, Whiteside and Rabinowich, 1998, Zoi-Toli, et al., 2000). Nur ein kleiner Teil der CD8+-T-Zellen tragen die zytotoxischen Effektormoleküle Perforin und Granzym. Sie können also nur zu einem geringen Teil zytotoxische Funktion ausüben. Dies gilt für beide [Seite 61↓]Mechanismen der Zytotoxizität. Die Tumorzellen allerdings könnten durchaus Apoptose in den CD8+-T-Zellen auslösen.

Abbildung 11: Expression von FasL bei den Tumorzellen und Vß2-negativen T-Zellen sowie von Fas-Rezeptor bei Nicht-Tumorzellen vom Patient WeW

Das zuvor beschriebenes Expressionsprofil der Tumor-infiltrierenden CD8+-T-Zellen wurde mit den DimerX, die mit Tumor-assoziierten T-Zellepitopen beladen waren, für Tumor-spezifische T-Zellen bestätigt (Tabelle 15). Die Tumor-spezifischen T-Zellen exprimierten überwiegend CD45RO aber nicht CD45RA und waren zum größten Teil CD62L-negativ. Demzufolge sind sie weder central memory noch effectormemory T-Zellen, wie sie von Maldonado und Kollegen definiert wurden (Maldonado, et al., 2003). Zudem wurden bestätigt, dass die Tumor-spezifischen T-Zellen im Tumor nicht zytotoxisch sind.

Tabelle 15: Phänotyp der Tumor-spezifischen T-Zellen im Tumor: Die Zellen wurden mit DimerX (65, 367, 347, 351, 276, 341, 358) markiert. Für die einzelnen Marker ist jeweils, der prozentuale Anteil an positiven Zellen wie gefolgt angezeigt: +++++ 80-100% positive Zellen; ++++ 60-80% positive Zellen; +++ 40-60% positive Zellen; ++ 20-40% positive Zellen; + unter 20% positive Zellen; - keine positive Zellen

Antigen

T-Zellen (DimerX+)

CCR7

-

CD25

-

CD45RA

+

CD45RO

+++++

CD56

+

CD62L

+

CD71

-

GranzymB

+

Perforin

-


[Seite 62↓]

Dieses Expressionsmuster steht im Gegensatz zu dem, was in gesunden Probanden zu sehen ist (Daten nicht gezeigt). Das Fehlen der Effektormoleküle deutet auf eine gestörte Funktion von Tumor-spezifischen T-Zellen im Tumor hin. Trotzdem wurde eine schwache Expression von CD69 und HLA-DR auf einigen CD8+-T-Zellen gefunden, was darauf hindeutet, daß nicht alle T-Zellen defekt sind. Keine der Antigen-spezifischen T-Zellen exprimierten CD71, d.h. die Zellen proliferieren nicht. Insgesamt ergibt sich der Eindruck, dass die Tumor-spezifischen T-Zellen anerg sind.

Einige frühere Veröffentlichungen berichteten von einer Expression von IL-10 in den Läsionen bei kutanen Lymphomen (Asadullah, et al., 1996). Die Expression nimmt mit Tumorstadien zu, so daß geschlossen wurde, daß die Tumorzellen diese immunsuppressive Zytokine sezernieren und so die Tumor-spezifische T-Zellen unterdrückt. Im Rahmen dieser Arbeit wurde diese Frage aufgegriffen und die Expression von IL-10 in gereinigten Tumorzellen untersucht. Es wurde keine IL-10-Expression gefunden (Abb. 12). Hingegen wurde eine Expression von TGF-ß in den Tumorzellen nachgewiesen. TGF-ß wird von verschiedenen Zelltypen exprimiert und hat immunsuppressive Funktionen. Die Suppression von Synthese der Zytokine wie TNF-α und IFN-γ wurde in der Literatur berichtet (Fischer, et al., 1995). Die Expressionsanalysen dieser beiden Zytokine wurde mittels RT-PCR mit Primern der entspechenden Spezifitäten durchgeführt. Als positive Kontrolle für den IL-10-Nachweis wurde PBMC aus gesundem Spender für 24h mit LPS (100 ng/ml) stimuliert.

Abbildung 12: Expression von TGF-ß aber nicht von IL-10 duch die Tumorzellen. Die Abbildung zeigt die Ergebnisse einer RT-PCR-Analyse auf die mRNA für die Zytokine


[Seite 63↓]

Neben den immunsuppressiven Effekten, die direkt von den Tumorzellen ausgehen, wurde postuliert, dass suppressor T-Zellen, sogenannte regulatorische T-Zellen (Treg) dazu beitragen, die Tumor-spezifische Immunantwort zu unterdrücken. Diesen regulatorischen T-Zellen wird eine Funktion bei der Erhaltung der Autotoleranz zugeordnet. Die der negativen Selektion im Thymus entgangenen, selbst-reaktiven T-Zellen müssen vom Immunsystem in der Peripherie kontrolliert werden, um mögliche Autoimmunreaktionen zu vermeiden. Die Interaktion der inhibitorischen Rezeptoren CTLA-4 mit den entprechenden Gegenrezeptoren der B7-Familie wird als möglicher Mechanismus für die negative Regulation der T-Zellaktivierung beschrieben (Carreno and Collins, 2002). Eine erhöhte Expression von GITR wurde bei CD4+CD25+ regulatorischen T-Zellen beobachtet, wobei deren regulatorische Funktion durch agonistische anti-GITR Antikörper aufgehoben werden kann (McHugh, et al., 2002, Shimizu, et al., 2002). Die oben beschriebenen potentiellen Tumor-assoziierten Antigene beim Patient WeW sind Selbstantigene und unterliegen damit der Autotoleranzregulation. Die Untersuchung der Tumor-infiltrierenden T-Zellen beim Patienten WeW ergab keinen Hinweis auf klassische CD4+CD25+GITR+-T-Zellen. Allerdings wurde eine Population von vorwiegend CD3+CD8+GITR+ und CTLA-4 positiven T-Zellen gefunden (Abb. 13). Diese Zellen wiesen eine intermediäre TCR-Expression auf. Ob sie tatsächlich eine immunsuppressive Funktion ausüben muss weiter untersucht werden. Die geringe Zellzahlen bei kutanen Lymphomen beschränken allerdings die Möglichkeiten für solche Untersuchungen.

Abbildung 13: CD8+ Subpopulation mit Expression von GITR und CTLA-4 im Tumor. Auf dem rechten Bild sind nur CD8+-T-Zellen angezeigt.

Insgesamt zeigen diese Analysen, dass die Tumor-spezifischen CD8+-T-Zellen anerg sind, einen ungewöhnlichen Phänotyp aufweisen und ihnen die zytotoxischen Effektormoleküle [Seite 64↓]fehlten. Die Tumorzellen sind dagegen FasL-positiv und damit gefährlich für die Fas-positiven T-Zellen. Konventionelle Suppressor-T-Zellen waren im Tumor nicht nachweisbar. Die Rolle der ungewöhnlichen CD3+CD8+CTLA-4+GITR+-T-Zellen bleibt ungeklärt.

5.4 Repertoire der Tumor-spezifischen T-Zellen

Frühere Arbeiten mit murinen T-Zellklonen haben gezeigt, dass verschiedene Peptide, die von denselben T-Zellklonen erkannt werden, ihrerseits unterschiedliche Repertoires an T-Zellen ansprechen (Gundlach, et al., 1996). Diese Veröffentlichung stimmt mit Beobachtungen für humane Tumor-spezifische T-Zellen überein, die in Zusammenhang mit vakzinationstherapeutischen Eingriffen bei Melanompatienten durchgeführt wurden. Bei der Untersuchung der Frequenzen von CD8+-T-Zellen mit Spezifität für das MART/Melan-A-Epitop AAGIGILTV bzw. eines Mimotops dieses Epitops, ELAGIGILTV, zeigte sich, dass nach ex vivo Stimulation mit dem Mimotop mehr T-Zellen IFNγ produzieren als mit dem natürlichen Epitop (Trefzer et al., 2004). Diese Beobachtung zeigt, dass mit den Mimotopen andere oder mehr T-Zellen angesprochen werden können als mit den natürlichen Epitopen. Dies deutet auf die Möglichkeit hin, mit dem natürlichen Epitop in vivo geprimten T-Zellen, d.h. durch die Tumorzellen möglicherweise auch anerg gewordene T-Zellen, durch Mimotope effektiver stimulieren zu können. ELISpot-Analysen mit PBMC des Patienten WeW nach der Stimulation mit den Epitopen und Mimotopen, die für Klon L1 (Abb. 14) bzw. für Klon PN2 (Abb. 15) definiert wurden, zeigen, dass nahezu alle Peptide auch hier aktiv sind, also die korrespondierenden T-Zellen auch im peripheren Blut zirkulieren und die Spezifitäten der beiden Klone L1 und PN2 repräsentativ für die Spezifitäten dieser zirkulierenden T-Zellen sind. Gleichzeitig ist deutlich, dass die Peptide sich sehr stark darin unterscheiden, wieviele T-Zellen jeweils stimuliert werden können. Ein Vergleich des Spezifitätsprofils mit den Spezifitätsprofilen, die für die Klone L1 (Abb. 14) und PN2 (Abb. 15) bestimmt wurden, läßt die Unterschiede deutlich werden.

Es gibt eine Reihe von Peptiden, die effektiv die Klone stimulieren aber nicht die T-Zellen aus PBMC und umgekehrt. Peptide 55, 31, 60, 7, 36, 39, und 47 sind Beispiele für den ersten, Peptide 26, 53, 52, 67 und 68 Beispiele für den zweiten Fall. Der PBMC-T-Zellpool enthält also T-Zellen, welche die für die Klone L1 und PN2 definierten Epitope und Mimotope mit anderen Preferenzen erkennen, also unterschiedliche Feinspezifitäten aufweisen. Diese Ergebnisse deuten darauf hin, dass es möglich ist, durch Kombination der unterschiedlichen [Seite 65↓]Peptide, die die gleiche T-Zellspezifität repräsentieren, ein erweitertes T-Zellrepertoire anzusprechen.

Abbildung 14: Repertoireanalyse der L1-peptidspezifischen T-Zellen im peripheren Blut des Patienten WeW per ELISpot. In der vertikalen Achse ist SFU pro 1x106 CD8+-T-Zellen angezeigt. Die Peptidsequenzen sind in Tabelle 9 aufgelistet.

Da zum Nachweis der Tumor-spezifischen T-Zellen in peripheren Bluten ein ELISpot-Assay auf IFNγ verwendet wurde, sind die so nachgewiesenen T-Zellen nicht anerg. Die Kombination verschiedener Peptide zur Stimulation eines T-Zellpools gegen den Tumor könnte damit helfen, das Problem zu umgehen, dass ein Teil der Tumor-spezifischen T-Zellen im Tumor anerg ist, d.h. Mimotope könnten es möglich machen, einen aktiven T-Zellpool für die Bekämpfung des Tumors zu rekrutieren.

Abbildung 15: Repertoireanalyse der PN2-Peptid-spezifschen T-Zellen im peripheren Blut des Patienten WeW per ELISpot. In der vertikalen Achse ist SFU pro 1x106 CD8+-T-Zellen angezeigt. Peptidsequenzen sind in Tabelle 7 aufgelistet.


[Seite 66↓]

Um die Spezifität Mimotop-induzierter T-Zellen weiter zu untersuchen, wurden mit den Mimotopen Peptide Nr. 347 und 352 sowie den potentiellen natürlichen Epitope Peptide Nr. 22, 258, 276 PBMC aus zwei HLA-A*0201 positiven gesunden Spender in vitro induziert. Dazu wurden CD8+-T-Zellen aus PBMC positiv magnetisch isoliert und die CD8--Fraktion mit 10 µg/ml Peptid inkubiert, bestrahlt und den CD8+-T-Zellen als Stimulatorzellen zugemischt. Die Zellen wurden nach 10 bis 14 Tage restimuliert und nach jeder Stimulation in ELISpot-Assays getestet. Bei den Peptiden Nr. 22, 258 und 276 konnte nach zwei Stimulationen keine spezifische T-Zellen nachgewiesen werden. Im Gegensatz dazu konnte bei den Mimotopen Nr. 347 und 352 spezifische T-Zelllinien etabliert werden. Die PBMC waren vorher in ELISpot-assays mit negativen Ergebnissen auf die Peptide Nr. 22, 258, 276, 338, 339, 340, 341, 347, 348, 351 und 352 getestet worden. In diesen Induktionsversuchen konnte also nur mit Mimotopen eine spezifische T-Zellreaktion induziert werden. Für den Vergleich der Spezifitätsrepertoire der T-Zelllinien wurden diese bei einer E/T-Ratio von 20:1 in Chromfreisetzungsversuchen getestet. Dabei wurde T2-Zelllinie mit je 10µg/ml Peptid beladen und als Zielzellen eingesetzt. Abb. 16 zeigt die normaliserten Werte der spezifischen Chromfreisetzungswerte für die einzelnen Peptide. Die mit den Peptiden 347 und 352 induzierten T-Zelllinien erkannen auch alle anderen Mimotope (Peptide Nr. 338, 339, 340, 341, 348 und 351). Die potentiellen natürlichen Epitope 22, 258 und 276 wurden von T-Zelllinie aus Spender A erkannt aber nicht von der Linie aus Spender B. Insgesamt sind sich die Spezifitätsprofile der beiden mit unterschiedlichen Mimotopen induzierten T-Zelllinien aus Spender A sehr ähnlich, während die T-Zelllinien aus Spender B deutlich davon abweicht. Das Profil des Klons PN2 ist gegenüber den Profilen der T-Zelllinien des Spenders A sehr eingeschränkt aber vollständig von den Profilen der Mimotop-induzierten Linien abgedeckt. Insgesamt erwiesen sich die Mimotope in diesen Versuchen als potente Induktoren von T-Zellreaktionen mit breiten Spezifitätsprofilen.


[Seite 67↓]

Abbildung 16: Vergleich der Spezifitätsrepertoires der Mimotop-induzierten T-Zelllinien und des CTL-Klons PN2. Die mit 1 bis 4 numerierten Spalten zeigen die Aktivität der T-Zellen in Zytotoxizitätsanalysen mit T2-Zellen als Zielzellen: Spalte 1-mit Peptid 347 induzierte T-Zelllinie aus Spender A; Spalte 2-mit Peptid 352 induzierte T-Zelllinie aus Spender A; Spalte 3-Klon PN2; Spalte 4-mit Peptid 347 induzierte T-Zelllinie aus Spender B. Zytolysedaten sind entsprechend der Zahl der reaktiven T-Zelllinie farblich wie folgt dargestellt: rot - von allen 4 T-Zelllinien erkannt; grün - von 3 T-Zelllinien erkannt, blau - von 2 T-Zelllinien erkannt; gelb - von einer T-Zelllinie erkannt. Die spezifischen Chromfreisetzungswerte sind auf 100% normalisiert (maximaler Chromfreisetzungswert > 30%). Die T-Zellreaktionen sind mit steigender Farbintensität (0-33%, 34-66%, 67-100%) in Abstufen dargestellt.

5.5 Induktion von Tumor-reaktiven T-Zellen in vivo durch Mimotopenvakzination

Wie in früheren Arbeiten gezeigt und hier bestätigt wurde, sind T-Zellen bei der Reaktion auf spezifische Epitope stark degeneriert, d.h. sie erkennen eine Vielzahl verschiedener Peptide. Damit ist es möglich, Mimotope zu generieren und für Vakzintherapien einzusetzen, die so ausgewählt sind, dass sie die gewünschte Immunantwort optimal induzieren. Es stellt sich aber die Frage, ob solche optimierte Epitope auch in Patienten Tumor-spezifische Immunantwort auslösen. Diese Frage konnte leider nicht mit den in dieser Arbeit bisher beschriebenen Peptiden bearbeitet werden, da der Patient WeW für eine Vakzintherapie nicht geeignet war. Für einen anderen T-Zellklon waren allerdings ebenfalls Mimotope mittels kombinatorischen Peptidbibliotheken generiert werden. Dieser CTL-Klon war spezifisch für die CTCL-Tumorzelllinie MyLa. Die für diesen Klon definierten Mimotope waren HLA-B8 restringiert und einem weit verbreiteten Tumor-assoziierten Antigen ähnlich, wie durch das Vorhandensein von Peptid-spezifischen T-Zellen in 80% (13/16) der untersuchten CTCL-Patienten gezeigt werden konnten (Linnemann, et al., 2001). Zwei HLA-B8-positive CTCL-Patienten wurden zur Vakzination mit den Mimotopen ausgewählt. Die Vakzinationsstudie wurde mit Einverständnis der Patienten sowie mit Genehmigung der Ethikkomission der Charite durchgeführt. Die Patienten wurden von Dr. Sylke Gellrich betreut. Patient 1 (75 Jahre, männlich) hatte klassisches MF – die Tumorläsionen waren an Armen, Beinen und seitlich am Bauch lokalisiert. Die Diagnose für Patient 2 (59 Jahre, weiblich) war pleiomorphes grosszelliges CD30+-T-Zelllymphom. Die Tumorknoten waren an den oberen Bereich der unteren Extremitäten lokalisiert. Die Patienten hatten vor der Vakzination keine nachweisbaren Mimotop-spezifischen T-Zellen im peripheren Blut. Die Mimotope PVKTYDIKL und PVKTKDIKL (je 100µg) wurden alle 4 Wochen zusammen mit Tuberkulin und Tetanus toxoid zur Stimulation von T-Helferzellen intradermal abseits der Tumorläsionen injiziert. Die durch die Helferantigene Tuberkulin und Tetanustoxoid aktivierten CD4+-T-Zellen können die Mimotop-spezifischen CD8+-T-Zellen mit IL-2 und evtl. andere Kostimulationen z.B. über CD27/CD70-Interaktion unterstützen. Die aktivierten [Seite 69↓]CD4+-T-Zellen können zusätzlich die Aktivierung und Reifung von DC auslösen (Lanzavecchia, 1998), sodass die Peptidantigene von den APZ besser präsentiert und durch kostimulatorische Faktoren unterstützt werden können. Patient 1 hatte 3 und Patient 2 10 Injektion bekommen.

Beide Patienten zeigten komplette Remission nach einer initialen Tumorregression bereits nach der 1. Vakzination. Patient 1 hatte nach der 1. Vakzination Nachtfieber mit Schüttelfrost, Entzündungsreaktionen im Tumor und Juckreiz. Danach traten keine solche Nebenreaktionen mehr auf. 3 Monate nach der 3. Vakzination sind neue Tumorknoten aufgetaucht und der Patient entschied sich für éine Standardtherapie. Beim Patient 2 wurde eine substantielle Tumorreduktion nach der 3. Vakzination beobachtet. 3 Wochen später traten neue Knoten auf, die nach der 6.Vakzination wieder verschwanden. Der Patient war dann bis nach der 10. Vakzination tumorfrei. Leider traten 4 Wochen später wieder neue Tumorknoten am Thorax, Rücken und Oberarm auf. Im späteren leukämischen Endstadium erschienen Tumorzellen in peripheren Blut. Der Patient erhielt dann eine Chemotherapie.

Zur Untersuchung der immunologischen Effekte der Mimotopvakzination wurden Mimotop-reaktive T-Zellen jeweils an den Tagen 0, 1, 2, 3, 4, 7 und 14 relativ zu den Vakzination durchflusszytometrisch bestimmt (Abb. 17, 18, 19). Hierzu wurden PBMC von den Patienten mit den Mimotopen inkubiert und die T-Zellen, die daraufhin IFNγ exprimieren, spezifisch auf das intrazelluläre IFNγ angefärbt und per Durchflusszytometrie ausgezählt. Die Mimotop-spezifischen T-Zellen exprimierten den frühen Aktivierungsmarker CD69 und waren in der Lage ex vivo nach Peptidstimulation IFNγ zu produzieren. Abb. 17 zeigtdieintrazelluläre Färbung von Antigen-spezifischen T-Zellen im peripheren Blut des Patienten 2 nach der 8. Mimotopvakzination. Der Patient war neben HLA-B8- auch HLA-A*0201-positiv, sodass das Peptid NLVPMVATV aus dem immediate early protein pp65 von CMV (Cytomegalovirus) als positive Kontrolle genommen werden konnte. Die Frequenzen der T-Zellen für das CMV-Epitop schwankten zwischen 4% bis 15% der CD8+CD3+-T-Zellen im Blut.


[Seite 70↓]

Abbildung 17: IntrazelluläreAnalyse der IFNγ-Induktion in Antigen-spezifischen T-Zellen per Durchflusszytometrie aus dem peripheren Blut des Patienten 2 nach der 8. Mimotopvakzination. Hier wurden nur die CD3+CD8+-Zellen dargestellt. Als negative Kontrolle wurde PBMC ohne Peptid und als positive Kontrolle wurde PBMC mit PMA/Ionomycin (hier nicht gezeigt) oder mit dem CMV-Epitop NLVPMVATV inkubiert.

Die Frequenzen der Mimotop-spezifischen T-Zellen im peripheren Blut erreichten nach der Vakzination bei Patient 2 maximal 0,5% und bei Patient 1 maximal 0,2% der CD3+CD8+-Zellen. Abb. 18 zeigt die Frequenzen der Mimotop-spezifischen T-Zellen im peripheren Blut des Patienten 1 für die 3 Vakzinationszyklen und Abb. 19 die Verläufe im Fall von Patient 2. In beiden Fällen, aber besonders bei dem längeren Verlauf von Patient 2 zu sehen, wurde die maximale T-Zellreaktion früh während der Vakzinationstherapie erreicht. Später schwächte die Reaktion ab, blieb aber immer deutlich nachweisbar. Das Immunmonitoring von in vivo induzierten spezifischen T-Zellen zeigte Repertoireunterschiede bezüglich von der beiden Mimotop-induzierten T-Zellen. Die anfängliche T-Zellantwort bei Patient 2 auf das Peptid PVKTYDIKL war sofort nach der ersten Vakzination zu sehen, was zu kurz für eine primäre T-Zellantwort ist und darauf hindeutet, dass das Peptid eine sekundäre Immunantwort [Seite 71↓]stimuliert. Bei Peptid PVKTKDIKL hingegen war eine signifikante Reaktion erst nach wiederholter Vakzination zu sehen und stieg über die ersten Zyklen stetig an.

Abbildung 18: Frequenzanalyse von mimotop-spezifischen T-Zellen in Patient 1 nach der Vakzination. Verlauf der Entwicklung der T-Zellreaktion während der drei Vaktinationszyklen. Die Pfeile oberhalb der Zeitachse weist auf die Vakzinationszyklen, die unterhalb der Achse auf die Zeitpunkte für das Immunmonitoring.

Das Peptid PVKTKDIKL paßt exakt zum HLA-B8-spezifischen Epitopmotiv während Peptid PVKTYDIKL in der Sequenzposition 5 ein Tyrosin statt des kanonischen Lysins trägt. Bei Patient 2 ist ein ähnlicher Verlauf der Reaktionskinetik Mimotop-spezifischer T-Zellen zu erkennen.


[Seite 72↓]

Abbildung 19: Frequenzanalyse der Mimotop-spezifischen T-Zellen in Patient 2 unter Vakzination. Wie in Abbildung 18 geben die Pfeile oberhalb und unterhalb der Zeitachse die Zeitpunkte für die Vakzination und für die Blutentnahme für das Immunmonitoring an.

5.6 Tumorreaktivität Mimotop-induzierter T-Zellen

Obwohl die Vakzination mit den beiden Mimotopen PVKTYDIKL und PVKTKDIKL in den Patienten Mimotop-spezifische T-Zellen induzieren, ist nicht klar, ob diese T-Zellen tatsächlich die Tumorzellen des Patienten erkennen und zerstören können. Um die Tumorspezifität und tumorizide Kapazität der Mimotop-spezifischen T-Zellen zu untersuchen, wurden Mimotop-reaktive T-Zellen aus dem Patienten 2 während einer Tumor-freien Phase unter Vakzination und während des leukämischen Endstadiums der Krankheit aus peripherem Blut isoliert und in vitro in IL-2-haltigem Medium durch regelmäßige Stimulation mit den Mimotopen expandiert. Die Zytotoxizität dieser Zellen wurden in 51Cr-Freisetzungversuchen gegen autologe EBV-tranformierte B-Zellen mit den jeweiligen Mimotopen getestet. Beide T-Zelllinien lysierten die EBV-tranformierten B-Zellen in Abhängigkeit von den Mimotopen, wie in Abb. 20a für die frühere Linie und in Abb. 20b für die spätere Linie gezeigt ist. In beiden Fällen wurden die Mimotope von den CTL-Linien erkannt. Diese Mimotop-spezifische CTL lysierten auch die CTCL-Tumorzelllinie MyLa, die von einem anderen Patient stammte und ursprünglich für die Bestimmung der Mimotope verwendet wurden. Potentielle NK-Aktivitäten der CTL-Linien wurden durch Kontrolle mit der NK-sensitiven K562-Zelllinie ausgeschlossen.


[Seite 73↓]

Abbildung 20:51Cr-Freisetzungsversuch mit Mimotop-spezifischen CTL, die während der Vakzination (a) oder während des leukämischen Endstadiums (b) bzw. mit CTL, die gegen das CMV-Epitop (c) gerichtet sind. Dargestellt sind die Effektor-zu-Target-Titrationen. Zielzellen waren EBV-transformierte B-Zellen des Patienten oder heterogene MyLa-Tumorzellen oder NK-sensitive K562-Zellen. Offene Dreiecke: EBV-transformierte B-Zellen; gefüllte Dreiecke: diese Zellen in Gegenwart von Mimotop PVKTKDIKL; gefüllte Karos: diese Zellen in Gegenwart von Mimotop PVKTYDIKL; gefüllte Quadraten: MyLa-Tumorzellen; offene Quadrate: EBV-transformierte B-Zellen mit dem CMV-Epitop; gefüllte Kreise: K562-Zellen.

Als Kontrolle wurde aus Patient 2 eine CTL-Linie mit Spezifität für das Epitop NLVPMVATV aus dem immediate early Proteinpp65 von CMV generiert. Diese Linie lysierte die autologen EBV-transformierten B-Zellen in Abhängigkeit vom CMV-Peptid aber nicht die CTCL-Tumorzelllinie MyLa (Abb. 20c).

Aufgrund fehlender Marker konnten die Tumorzellen des Patienten nicht isoliert werden, sodass für den Nachweis der Tumorspezifität der CTL auf den molekulargenetischen Nachweis der Tumorzellen in PBMC zurückgegriffen werden musste. Die PCR-Analyse des TCRγ-Rearrangements des Tumors, hatte als Tumorklon-spezifische Signatur Amplifikate von 241 bp und 250 bp für die beiden Allele ergeben (Abb. 21A). Diese Signatur war während des leukämischen Endstadiums im peripheren Blut nachweisbar. Die Stärke dieses Tumor-spezifischen Signals wurde als Maß für die tumorizide Wirkung der CTL vor und nach Inkubation der PBMC mit diesen Zellen vermessen. Abb. 21A zeigt die Signatur des Tumor-spezifische TCRγ-Rearrangements, Abb. 21B die entsprechende Signatur für die Mimotop-spezifische CTL-Linie. Eine Mischung dieser beiden Zellpopulationen ergibt eine Kombination beider PCR-Profile (Abb. 21C). Nach Inkubation dieses Gemisches bei 37°C ist das Tumorklon-spezifisches PCR-Amplifikat um etwa 83% reduziert (Abb. 21D, 22A), während das CTL-spezifische Amplifikat konstant bleibt. Alle Proben waren nach der Inkubation mit Benzonase (Sigma) 30 min bei 37°C behandelt worden, um die DNA aus den toten Zellen zu entfernen. Als Kontrolle wurden PBMC mit den Tumorzellen zusammen mit der CMV-spezifischen CTL-Linie inkubiert. Die Klon-spezifische Signatur dieser CTL-Linie [Seite 74↓]ist in Abb. 21E, das PCR-Profile des Gemisches von PBMC mit den Tumorzellen und CMV-spezifischen CTL vor Inkubation in Abb. 21F und nach Inkubation in Abb. 21G gezeigt. Hier bleibt das Tumor-spezifische Signal konstant. Die Tumorzellen wurden also nicht lysiert. Nach Zugabe des Epitops für die CTL(NLVPMVATV) verschwindet das Tumor-spezifische PCR-Produkt weitgehend, was zeigt, dass die Tumorzellen durchaus von den CMV-spezifischen T-Zellen lysiert werden können, wenn das richtige Antigen präsentiert wird.

Abbildung 21: Tumorizide Kapazität von Mimotop-spezifischen CTL aus Patient 2. Fragmentlängenanalyse der Tumorzellen (A), Mimotop-spezifischen CTL (B), virus-spezifschen CTL (E), Tumorzellen vor der Inkubation zusammen mit Mimotop-spezifschen CTL (C) und mit Virus-spezifischen CTL (F), Tumorzellen nach der Inkubation mit Mimotop-spezifischen CTL (D), mit Virus-spezifschen CTL (G) und mit Virus-spezifischen CTL in Gegenwart vom CMV-Peptid (H). Das rote Pfeil ist ein Kalibrierungsmarker, d.h. ein Oligonukleotid mit 245 bp.


[Seite 75↓]

Die Abb. 22A, B stellen die Flächen der in Abb. 21 gezeigten Profile der Tumor-spezifischen PCR-Produkte dar. Die Signalstärken wurden bezüglich der in den Assays eingesetzten DNA-Mengen kontrolliert und abgeglichen. Diese Experimente zeigen eindeutig, dass die Mimotop-spezifischen CTL im peripheren Blut des Patienten Tumor-spezifisch und potentiell tumorizid sind. Interessant ist, dass solche CTL im peripheren Blut des Patienten sowohl zum Zeitpunkt der kompletten Remission nach der 6. Vakzination als auch im leukämischen Endstadium nachgewiesen werden konnten, d.h. die Tumorprogression ist nicht mit einer Deletion der Tumor-spezifischen CTL assoziert. Weiterhin lassen sich die Tumorzellen auch im späten aggressiven Stadium des Krankheitsverlaufs spezifisch lysieren. Sie präsentieren also nach wie vor das Antigen, exprimierten MHC-Klasse-I-Moleküle und sind sensitiv gegenüber dem lytischen Mechanismus der CTL. Die Tumorprogression ist daher wahrscheinlich auf eine Immunsuppression der CTL zurückzuführen, die durch Kultivierung in IL-2 haltigem Medium revertiert werden kann.

Abbildung 22: Spezifische Lyse der Tumorzellen im peripheren Blut des Patienten 2 durch Mimotop-spezifische CTL oder als Kontrolle CMV-spezifische CTL. Die Referenzwerte (in Prozent) für das Tumor-spezifische Signal mit Mimotop-spezifischen CTL (A) und mit Virus-spezifische CTL (B) vor der Inkubation (0°C) und nach der 4 h Inkubation (37°C), bzw. nach 4h bei 37°C in Gegenwart des CMV-Epitops (37°C mit Peptid).


[Seite 76↓]


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
17.03.2005