|
| [page 13↓] |
This study is primarily based on the Cuban and Antillean species of the genus Pleurothallis (sensu Luer 1986b). For palynological and phytogeographical studies, however, taxa from other pleurothallid genera were added to provide a broader view on these orchids. Pleurothallis ekmanii Schltr., Pleurothallis excentrica (Luer) Luer (bas. Octomeria excentrica Luer) and Pleurothallis ‘flabelliformis’ nom. prov. (bas. Octomeria prostrata H. Stenzel), three species of uncertain phylogenetic position, were treated under the generic name Pleurothallis, which, unfortunately, made the employment of an unpublished name unavoidable.
Material was collected in Cuba, Jamaica, the Dominican Republic, and Puerto Rico during the years 1997 - 2001. The vast majority of the samples was gathered during a 6-month stay in Cuba in 1998 (Tab. 1), another in 1999, and a third one of 3 months in 2000 in Jamaica and Puerto Rico. Initially, localities which should be visited were chosen from herbarium data and from information found in literature. Additional suggestions came from Dr. M. A. Díaz (HAJB), Dr. H. Dietrich (JE) and Dr. A. Urquiola Cruz (HPPR) resulting from former field trips within the Flora de Cuba Project (hereafter FCP).
The majority of the more than 1300 vouchers collected belongs to the family Orchidaceae, with almost 500 representing taxa of the subtribe Pleurothallidinae. Collecting and transfer of the material took place in accordance with Cuban law and CITES criteria. In general, collecting of entire populations was avoided. In concordance with the rules of the FCP, herbarium material belonging to Pleurothallis will be split between HAJB and JE. [page 14↓]Holotypes and vouchers consisting of single specimens will be deposited in HAJB in any case. Material in spirit, CARNOY as well as silica dried samples belong to the personal collections of the author. All material that does not belong to Pleurothallis will be housed in HAJB.
Tab. 1. Survey of the field work in Cuba.
|
Province |
Area |
Date |
collections |
|
PR |
Sierra del Rosario |
III-1998 |
400-414 |
|
PR |
El Moncada; Pan de Guajaibón; Cajálbana |
IV-1998 |
415-429 |
|
Ho |
Sierra de Nipe |
IV-1998 |
430-493 |
|
Ho |
Sierra de Moa: Reserva de Jaguaní |
V-1998 |
494-503 |
|
Ho |
Sierra del Cristal: Río Levisa |
V-1998 |
504-547 |
|
Ho |
Sierra de Moa,:between El Piloto and El Toldo |
VI-1998 |
558-601 |
|
Ci, SS |
Sierra de Escambray |
VII-1998 |
602-618 |
|
Gr |
Sierra Maestra: Victorino |
VIII-1998 |
619-640 |
|
Gr, SC |
Sierra Maestra: Turquino Massif |
VIII-1998 |
641-663 |
|
SC |
Santiago de Cuba: Gran Piedra |
VIII-1998 |
664-680 |
|
PR |
Sierra del Infierno |
III-1999 |
710-716 |
|
PR |
Mantua: La Cana |
III-1999 |
716-721 |
|
Ho |
Sierra de Nipe |
IV-1999 |
722-743 |
|
Ho |
Sierra del Cristal |
IV-1999 |
744-778 |
|
Gr, SC |
Sierra Maestra: Turquino Massif |
IV-1999 |
780-839 |
|
Gu |
Palenque; Piedra La Vela |
IV,V1999 |
839-849 |
|
Gu |
Yateras: Pico Galán |
V-1999 |
850-874 |
|
Gu |
Yateras: Bernardo |
V-1999 |
875-876 |
|
Gu |
Sierra de Imías: Los Calderos |
V-1999 |
877-880 |
|
Gu |
Sierra de Imías: La Yamagua |
V-1999 |
881-916 |
|
PR |
Sierra de Quemado: El Moncada |
VI-2001 |
1100-1112, 1139-1166, 1211-1249 |
|
PR |
Sierra de Cajálbana, S slope |
VI-2001 |
1113-1138 |
|
Guanahacabibes: Cabo Corrientes |
VI-2001 |
1167-1174, 1210 |
|
|
PR |
Guanahacabibes: road to Cabo San Antonio |
VI-2001 |
1175-1209, 1323 |
|
PR |
Pan de Guajaibón |
VI-2001 |
1250-1299 |
|
PR |
Sierra de Cajálbana, N slope |
VI-2001 |
1300-1322 |
Besides these personal collections, material of the following herbaria was examined: AJBC, BSC, HAC, HAJB, HPPR, JE, B, BM, BR, DUKE, G, GH (AMES), GOET, IJ, K (including K-L), NY, S, UPRRP, and W. Xerocopies or scanned images of material of the following herbaria was included, too: B-W (IDC-copies), GH (AMES), M, S.
Plants were dried in a portable press in the field. To preserve the details of the delicate and fragile generative organs, part of the material was conserved in spirit.
As far as possible, each voucher was completed by information on
Mature flowers for palynological studies were separately dried in paper envelopes.
Slide images were taken of the natural environment and the collected plants.
Samples for molecular analyses were taken from fruits as well as from young and mature leaves. They were externally cleaned with ethanol (70%), cut into pieces to facilitate dehydration and stored in perforated paper envelopes in silica gel. In the first run (1998) desiccated material was stored only at (subtropical) room temperature. Later, material was maintained under cool conditions as soon as the pieces were dry. Even small intervals of time (from one month on!) under subtropical conditions led to severe deterioration concerning quality and amount of extractable DNA.
Descriptions and drawings
Descriptions were made including all material examined. Since the majority of the species could be collected in flowering condition, flower sections were carried out based mostly on personal spirit collections of the author. In most cases type material was not dissected, for many of the unique historical collections by Jacquin, Wright or Schlechter, are poor in generative material. Dry herbarium material was rehydrated in boiling water. Spirit material was dissected without further preparation. Pencil drawings were later copied with ink and scanned at high resolution. Scanned images were then arranged in position and size and provided with scales. All drawings are done by the author.
Reproductive biology
Phenological information was gathered from observations in the field and from herbarium material.
Ecological and phytogeographical patterns
General phytogeography
– Data of distribution was collected from herbarium sheets in the herbaria mentioned above and was completed by information from the following sources: Ackerman 1995, 1997; Adams 1971, 1972, & pers. comm.; Ames & Correll 1952; Carnevali & al. 2001; Correll 1965; Dix & Dix 2000; Dietrich s. p.8; Dod 1974, 1984b, 1986b, 1989b; Foldats 1970; Dressler 1993b; Garay & Sweet 1974; Gloudon & Tobisch [page 16↓]1995; Hamer 2001; Luer 1975a, 1975b, 1990, 1998b, 1998c, 1999a, 1999b, 2000; MacLeish & al. 1995; Nir 2000; Stehlé 1939; Williams 1951; Williams & Allen 1946; Williams & al. 1980. Additional information from the NYBG West Indian Orchidaceae Specimens database (http://www.nybg.org/bsci/hcol/wior/orchidchecklist.html) and the MBG W3TROPICOS database (http://mobot.mobot.org/W3T/Search/vast.html) was taken into consideration.
This analysis is aimed at the comparison of the Greater Antilles islands with adjacent Lesser Antilles and continental areas. It includes all species of Pleurothallis found in the Greater Antilles. Variables are: West Cuba, Central Cuba, East Cuba, Jamaica, Hispaniola, Puerto Rico, Lesser Antilles, Central America, and South America.
Vertical distribution – Data of the vertical distribution of Cuban Pleurothallis species was gathered from personal observations and herbarium material. Occurrence of taxa was recorded in altitudinal belts of 100 m. Gaps within the vertical distribution were interpolated, which did not alter the graph qualitatively.
Geology – The distribution of the Cuban species of Pleurothallis in vegetation on three distinct types of rock (limestone, magmatic or volcanic rock, serpentine) was analysed. Petrologic (type of rock) data was obtained from personal observations and information on herbarium sheets. These facts were compared with Borhidi (1996), Samek (1973). Serpentine, though representing only one of the ultrabasic rock types is used in the broader sense of the latter hereafter. In the case of volcanic rock, the data may comprise actually a variety of types, which could not be differentiated. In fact, this category is more a negative circumscription: in no case it does contain stands, neither on ultrabasic rock nor on limestone. These stands are limited to the Sierra Maestra chain.
Veget
ation types
– Data concerning vegetation types are based on personal observations and information on herbarium sheets. These were compared with Samek (1973), Borhidi (1996), and Capote & Berazaín (1984). Assigning epiphytes to the vegetation types suggested by these authors turned out to be problematic occasionally. First, herbarium data is very scarce. Pleurothallis is distributed almost exclusively in colline to montane areas, where vertically and horizontally interlocked vegetation types can change within a few meters. Information from herbarium sheets, apart from their second hand character, are often too general. Second, classification of vegetation types may differ substantially between authors. Three problems occurred:1) types were partially incomparable because of inconsistent methods used by the authors and due to inaccurate descriptions, 2) there were cases of general misapplication of terms, and 3) some types turned out to be useless in classifying epiphytes (Pleurothallidinae). The latter was detected only in the course of the present study and will be discussed in detail later.
In the present study vegetation types sensu (Borhidi 1996) were used, however, with [page 17↓]some changes. Considering the differences that exist in the usage of even such common terms as “elfin” and “montane” (Capote & Berazaín 1984; Borhidi 1996) it seems reasonable to define the terms used in this study.
Computing and representation of the data in diagrams
Dendrograms – Data was set up in matrices in which species were coded as present (1) or absent (0). Species represented by single collections (Pleurothallis appendiculata, P. ghiesbreghtiana, P. aristata) or questionable classification (P. murex was described from sterile material) are not included in the matrices that were used to show correlations. To assess and show groupings of variables, Maximum Parsimony (MP) analyses were conducted. Dendrograms were initially rooted with a hypothetical outgroup with all species coded absent (Lundberg rooting), which was abandoned in a second run (see p. 78). Computation was carried out with the PHYLIP package (Felsenstein, J. 1989: PHYLIP (Phylogeny Inference Package) version 3.5c). This algorithm follows largely PAE (parsimony analysis of endemicity) introduced by Rosen & Smith (1988). See Trejo-Torres & Ackerman (2001) for a detailed discussion of this method.
3-dimen sional diagrams – Most ecological variables, e.g. types of rock, vegetation, and vertical amplitude, were examined as to their correlation with overall horizontal distribution of the taxa. Although the same data was statistically evaluated, too, 3-dimensional diagrams were chosen for presentation, because of the intriguing and lucid way they convey information. In order to present the diagram in a clearly arranged manner, species [page 19↓]were classified according to their occurrence in n locations (i.e. frequency) in the Caribbean (6 locations: West Cuba, Central Cuba, East Cuba, Jamaica, Hispaniola, Puerto Rico) and adjacent areas (GA-SA: Lesser Antilles, Central America, South America). The latter, because of its vast area, does not represent a 7th location. Thus, species of distribution outside the Greater Antilles, may or may not be present in all 6 inner Antillean localities. Again, in order to avoid overloading the diagrams, ecological amplitudes were classified, too, usually in three units representing the growing amplitude. Hence, horizontal distribution is growing on the x-axis from left to right and the ecological amplitude from the foreground towards the background (see Fig. 56 e.g.).
Statistics (correlation) – As just mentioned, an association between horizontal distribution and the ecological amplitude was examined. Species were grouped according to the number of areas they occur in (see previous paragraph for a definition). All correlations were performed with the SPSS 10.0 package, rs represents the Spearman’s rank correlation coefficient (Sokahl & Rohlf 1995), N the number of species, P is the significance value. The significance criterion for all tests was set at alpha=0.05, therefore P-values smaller than P=0.05 are considered as significant.
Palynology
The material included in the study of pollen morphology comprises ~100 samples of 72 pleurothallid and 2 other orchidaceous species (Tab. 2). The latter were used in the molecular study by (Pridgeon & al. 2001) as outgroup taxa. All but three Cuban species (Pleurothallis caymanensis, P. oricola, P. nummularia) currently treated as Pleurothallis could be included. With the exception of Brachionidium parvum and Pleurothallis aristata, from Puerto Rico, all Cuban taxa were represented by one local voucher at least. The Cuban endemic Pleurothallis grisebachiana, a widespread species variable in size and flower coloration, is represented by 10 samples from 9 different localities (Fig. 45), to test the degree of variation in pollen morphology. The same applies to Pleurothallis mucronata (Fig. 46) and P. ekmanii (Fig. 47) three Cuban localities each), P. ghiesbreghtiana (three samples from Central America, and one each from Cuba, Jamaica and Puerto Rico) and Pleurothallis ruscifolia (Jacq.) R. Br. (5 samples). The only subgenus of Pleurothallis that is endemic in the Antilles (~10 species, Luer 2000), subg. Antilla Luer, is represented by 7 species with 3 being restricted to Cuba.
Antillean material from closely related genera (Brachionidium, Lepanthes, Lepanthopsis, Platystele, Stelis, Trichosalpinx, Zootrophion) as well as from presumed sister or outgroup taxa in previous cladistic studies of Pleurothallidinae, Arpophyllum (Neyland & al. 1995, Pridgeon & al. 2001) and Dilomilis (Pridgeon & al. 2001) was included for comparative purposes.
|
| [page 20↓] |
All dry specimens were rehydrated for 1-5 min in hot water. All spirit material (Stenzel 482, Stenzel 765, Stenzel 1298) was dissected directly. Pollinia were removed, mounted on double tape and dried at room temperature. Pollinia were finally gold sputtered 100 s at 30 mA and a distance of 6 cm from the electrode.
Pollinia were examined with a JEOL SM 6300 SEM at the Palynological Laboratory of the Natural History Museum Stockholm and at the Museum of Natural History Berlin. Working data is as follows: Acceleration voltage 15 kV, probe current 3x10-11 A, distance 8-12 mm. Since the upper half of the pollinium tends to be more stable (Schill & Pfeiffer 1977) and generally free of elastoviscin (Stenzel 2000), data of this area was used for comparison. Caudicular regions were documented as well. If not indicated otherwise, photos show the entire pollinarium and details on the side of the upper pollinium which faces the tapetum. Pollen terminology, if adequate, was applied according to Punt & al. (1994). For description of additional terms see glossary (p. 170).
|
|
Tab. 2: Plant material used for palynological studies (species present in Cuba in bold type).
[page 23↓]Genetics
Plant material used in this study is listed in Tab. 3. All but 2 of the 39 Pleurothallis species (Pleurothallis appendiculata, P. murex) currently known to occur in Cuba could be included, i.e. the range is limited geographically. One of the 33 species successfully sampled could not be recollected in Cuba, i.e. material from other islands had to be employed (Pleurothallis aristata from Puerto Rico). Two species are represented by two accessions each. P. trichophora with material from East and Central Cuba which marks the phytogeographical limits of this plant, and P. ghiesbreghtiana with one voucher from West Cuba and the other from Puerto Rico.
Tab. 3: Plant materials used in molecular studies.
|
Species |
Voucher |
Country* & Locality** |
|
|
Pleurothallis aristata Hooker |
Stenzel 996 |
PR |
Mun. Río Grande, El Yunque, trail from Caimitillos to Mt. Britton |
|
Pleurothallis bissei Luer |
Stenzel 730 |
CU |
Ho: Sierra de Nipe, Woodfred, along N bank of creek |
|
Pleurothallis brighamii S. Wats. |
Stenzel 740 |
CU |
Ho: Sierra de Nipe, behind EIIM station and Sabina trail |
|
Pleurothallis corniculata (Sw.) Lindl. |
Stenzel 889 |
CU |
Gu: Sierra de Imías, La Yamagua |
|
Pleurothallis domingensis Cogn. |
Stenzel 662 |
CU |
SC: Sierra Maestra, Turquino Massif, Pico Real |
|
Pleurothallis ekmanii Schltr. |
Stenzel 762 |
CU |
Ho: Sierra del Cristal, S slope of Pico Cristal, trail to summit |
|
Pleurothallis excentrica (Luer) Luer |
Stenzel 752 |
CU |
Ho: Sierra del Cristal, S slope of Pico Cristal, along upper Río Levisa |
|
Pleurothallis ‘flabelliformis’ H. Stenzel |
Stenzel 745 |
CU |
Ho: Sierra del Cristal, S slope of Pico Cristal, along upper Río Levisa |
|
Pleurothallis gemina H. Stenzel |
Stenzel 452 |
CU |
Ho: Sierra de Nipe, La Mensura, north slope |
|
Pleurothallis ghiesbreghtiana A. Rich. & Galeotti |
Stenzel 967 |
PR |
Maricao, Bo. Maricao Afuera, Maricao Forest Reserve |
|
Pleurothallis ghiesbreghtiana A. Rich. & Galeotti |
Stenzel 1298 |
CU |
PR: Pan de Guajaibón, summit |
|
Pleurothallis grisebachiana Cogn. |
Stenzel 619 |
CU |
Gr: Sierra Maestra, Victorino, mogote at road |
|
Pleurothallis helenae Fawc. & Rendle |
Stenzel 766 |
CU |
Ho: Sierra del Cristal, Pico Cristal, elfin forest on peak |
|
Pleurothallis llamachoi Luer |
Stenzel 545 |
CU |
Ho: Sierra del Cristal, lower Río Levisa, gallery forest |
|
Pleurothallis longilabris Lindl. |
Stenzel 895 |
CU |
Gu: Sierra de Imías, La Yamagua, centre of valley above creek |
|
Pleurothallis mucronata Lindl. ex. Cogn. |
Stenzel 478 |
CU |
Ho: Sierra de Nipe, Cayo Las Mujeres, W slope |
|
Pleurothallis nummularia Rchb. f. |
Stenzel 896 |
CU |
Gu: Sierra de Imías, La Yamagua, centre of valley above creek |
|
Pleurothallis obliquipetala Acuña & C. Schweinf. |
Stenzel 789 |
CU |
Gr: Sierra Maestra, Turquino Massif, below La Aguada de Joaquín |
|
Pleurothallis obovata (Lindl.) Lindl. |
Stenzel 840 |
CU |
Gu: Palenque, Mogote de Buena Vista, along crest |
|
Pleurothallis odontotepala Rchb. f. |
Stenzel 784 |
CU |
Gr: Turquino Massif, trail from Alto de Naranjo to La Aguada de Joaquín |
|
Pleurothallis papulifolia Luer |
Stenzel 483 |
CU |
Ho: Sierra de Nipe, Woodfred, along N side of creek |
|
Pleurothallis prostrata Lindl. |
Stenzel 856 |
CU |
Gu: Yateras, W slope of Pico Galán |
|
Pleurothallis pruinosa Lindl. |
Stenzel 890 |
CU |
Gu: Sierra de Imías, La Yamagua, Monte Oscuro |
|
Pleurothallis racemiflora (Sw.) Lindl. |
Stenzel 783 |
CU |
Gr: Sierra Maestra, Turquino Massif, below La Aguada de Joaquín |
|
Pleurothallis rubroviridis Lindl. |
Stenzel 893 |
CU |
Gu: Guantánamo, Sierra de Imías, La Yamagua |
|
Pleurothallis ruscifolia (Jacq.) R. Br. |
Stenzel 635 |
CU |
Gr: Sierra Maestra, Bayamo, Victorino, peak of El Gigante |
|
Pleurothallis sertularioides (Sw.) Spreng. |
Stenzel 843 |
CU |
Gu: Palenque, Mogote de Buena Vista, along crest |
|
Pleurothallis shaferi Ames |
Stenzel 453 |
CU |
Ho: Sierra de Nipe, La Mensura, N slope |
|
Pleurothallis testaefolia (Sw.) Lindl. |
Stenzel 656 |
CU |
SS: Sierra Maestra, Turquino Massif, below La Aguada de Joaquin |
|
Pleurothallis tribuloides (Sw.) Lindl. |
Stenzel 634 |
CU |
Gu: Sierra Maestra, Victorino, El Gigante |
|
Pleurothallis trichophora Lindl. |
Stenzel 606 |
CU |
SS: Trinidad, Pico Potrerillo |
|
Pleurothallis trichophora Lindl. |
Stenzel 630 |
CU |
Gu: Sierra Maestra, Victorino, El Gigante |
|
Pleurothallis trichyphis Rchb. f. |
Stenzel 620 |
CU |
Gr: Sierra Maestra, Victorino, mogote at road |
|
Pleurothallis wilsonii Lindl. |
Stenzel 621 |
CU |
Gr: Sierra Maestra, Victorino, mogote at road |
|
Pleurothallis wrightii Rchb. f. |
Stenzel 733 |
CU |
Ho: Sierra de Nipe, Cayo Las Mujeres, W slope |
|
| [page 24↓] |
Material – Since it was not possible to extract DNA from existing herbarium collections, material for molecular investigations had to be collected in the wild. Outside ITS sequences for outgroup comparison were kindly provided by Dr. A. M. Pridgeon. They were originally published by Pridgeon & al. (2001) and will be cited hereafter, if necessary, under the GenBank accession number.
DNA extraction – DNA was extracted at Friedrich-Schiller-University in Jena from 0.01-0.5g of dried leaves or fruits, following a modified 2%-CTAB (hexadecyltri-methylammoniumbromide) procedure of Doyle & Doyle (1987) and Hellwig & al. (1999). DNA was purified using Qiagen tip-20 columns (Qiagen Inc., Hilden, Germany) following the manufacturer’s protocols. Purified DNA extracts are stored in HUB.
Amplification – All PCRs were run using Taq DNA Polymerase Kit from Qiagen (Qiagen Inc.). Initially, Baldwin’s (1992) primers P1 (=”ITS5” sensu Baldwin), P2 (=”ITS2”), P3 (=”ITS3”), P4 (=”ITS4”) were employed. They yielded two fragments. One was the result of primers P1 (5'-GGA AGT AAA AGT CGT AAC AAG G-3') and P2 (5'-CTC GAT GGA ACA CGG GAT TCT GC-'3). It covered ITS1 and 2/3 of 5.8S gene with a total length of ~380 bp. The other fragment of ~440 bp included 2/3 of the 5.8S gene and ITS2. It was the product of primers P3 (5'-GCA TCG ATG AAG AAC GCA GC-'3) and P4 (5'-TCCTCCGCTTATTGATATGC-'3). Both fragments are overlapping in the 5.8S region, so by combining the two, the complete ITS1-5.8S-ITS2 (hereafter ITS) sequence could be achieved.
Tab. 4: Pleurothallis gemina: 17SE (p.p.), ITS1, 5,8S, ITS2, and 26SE (p.p.) sequences.
|
TGGAAGTAAAAGTCGTAACAAGG>TTTCCGTAGGTGAACCTGCGGAAGGATCATTGtcgagaccgaatatatcgagcgattcggagaacctgtgaatgaatgagcggcggcatcgtcgtcgcgcaaatgccgcctccatcgccggccttgttaaagcgccgtcgatgagaggcggatgaaaactcaaaccggcgcagctgcgcgccaaggaaatacaaatatacacgatcctgtattgggttcggtggcgtggagtgcagtcgcacaccacacggataAAAACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGC G CAGC>GAAATGCGATACGTGGTGCGAATT<GCAGAATCCCG C G AA CCATCGAGAATTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCgttacgtcgctccgtgccagctccatgccacccgacgggtgtgtatggggaggggtcggatgtgcagagtggctcgtcgtgcccgcgggcgtggcgggcttaagatcgggtgatcgtctcgtttgccacgaacgataagggtggatgaaaattgtgcctgtgttgtatcgtggcgacgtgagaagagattgtacccagcagatgatcccaatctaagcgtcgttccacagacgtcggcttggaatGCGACCCCAGGATGGGCGAGGCCACCCGCTGAGTTTAA<GCATATCAATAAGCGGAGGAAAGAAACTTACAAG |
Tab. 4 illustrates the position of each primer within the nrDNA region of interest. Baldwin’s primers gave ad hoc excellent results in ITS1 (P1-P2) but less so in the case of ITS2 (P3-P4). Adjusting of the annealing temperature did not improve the quantity and quality of the products. Since the PCR with P1-P4 gave the same blurred PCR products as P3-P4, I [page 25↓]assumed that the P4 must include bases mismatching the 26SE target region. However, this cannot explain the notorious difficulty amplifying ITS2. Rather than base mismatches, secondary structures could explain those problems, for later usage of P4 in nested cycle sequencing with templates gained from non-P1-P4 PCR, showed no problems at all.
Sequence analyses revealed a three base mismatch in primer P2 compared with the actual 5.8S target region in all species examined, whereas primer P3 has one base mismatch (Tab. 4). Cycle sequencing functioned well despite these incongruities.
In those cases where PCR with Baldwin’s primers failed, a second set of oligos was employed (Sun & al. 1994). Using the primers “17SE” (5'-ACG AAT TCA TGG TCC GGT GAA GTG TTC G-3') and “26SE” (5'-TAG AAT TCC CCG GTT CGC TCG CCG TTA C-3') PCR yielded a fragment of ~ 900 bp comprising ITS1, 5.8S gene, and ITS2 along with ends of the bordering coding regions. Since these oligos anneal further outwards from primers P1 and P4, P1-P4 could be used for nested cycle sequencing.
The amplification was conducted via the following thermal cycle profile: 150s95°C/ 28-34x [30s95°C/60s50-58°C/ 60s72°C]/ 300s72°/ 4°C. PCR products were purified using the QiaQuick® PCR Purification Kit (Qiagen Inc.).
Cycle sequencing – Both strands of the amplified gene fragments were directly cycle sequenced in 10 µl volumes containing 2 µl of ABI Prism BigDye Terminator cycle sequencing reaction mix (ABI Biosys-tems), 0.5 µM primer, 2 µl dd H2O and 4 µl DNA. Sequencing products were purified following the ABI standard protocol adjusted to 10 µl reaction volume by addition of dd H2O. Sequences were obtained by running the sequencing products on an Perkin Elmer ABI 377 automated sequencer. The resulting sequence electropherograms of both strands were corrected manually for misreads and merged into one sequence file using BioEdit (version 5.0.9.; Hall 1999) for Windows 95, which was generally used to store and manage sequences.
Alignment and phylogenetic analysis – The question of homology is a crucial problem in inferring phylogenetic relationships from nucleotide sequence data (Doyle & Davis 1998), i.e. the insertion of gaps is one of the most critical steps in molecular analysis. To compare the influence of the extent of indels, sequences were initially aligned using CLUSTAL W (Thompson & al. 1994) employing different delay values and gap costs and then adjusted by eye (see appendix for sequences). Unambiguous indels that seem to be duplications of upstream sequences (e.g. ATAT à ATATAT) were coded as single events. From each matrix an additional set with ambiguous indel regions being excluded was drawn. A fifth matrix was created by stripping an aligned set of all columns containing gaps. Cladistic analysis was conducted with these 5 data sets using sequence AF262915 (Dilomilis montana (Sw.) Summerh.) from (Pridgeon & al. 2001) as outgroup.
Substitution patterns were analysed by comparing observed and expected substitutions [page 26↓]among all sequences. The number of expected substitutions was calculated from base frequencies. Substitution saturation was evaluated by plotting portions of transitions and transversion against distance.
Phylogenetic trees were built using parsimony algorithms (Maximum Parsimony – MP hereafter). Computation was accomplished with PAUP* version 4.0b8 (Swofford 2000). The following settings were chosen: Fitch parsimony (Fitch 1971), heuristic search, gaps as fifth character, 100 replicates of random sequence addition, tree bisection-reconnection (TBR) branch swapping, MulTree.
Relative support of the topologies found was evaluated with 1000 bootstrap subsets of each of the 5 matrices.
Sequence editing and statistical analysis were performed using BioEdit and DAMBE (version 4.1.19; Xia & Xie 2001).
Taxonomy
Although profoundly challenged by molecular data (Pridgeon, Solano & Chase 2001, Pridgeon & Chase 2001) the morphological concept of Luer (1986c) will be the basis of this work. The main reasons are
There are more reasons why to handle the new system with extreme care. In order not to anticipate the results of this work they will be discussed later (p. 112).
Authority abbreviations follow those of Brummit & Powell (1992) and abbreviations of herbaria are in concordance with those of the Index Herbariorum (http://www.nybg.org/bsci/ih/searchih.html). Name of the Cuban provinces were abbreviated according to the rules of the FCP (Greuter & al. 2002): PR – Pinar del Río, SS – Santi Spíritus, Ci – Cienfuegos, Ho – Holguín, Gr – Gránma, SC – Santiago de Cuba, Gu – Guantánamo.
| © Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme. | ||
| DiML DTD Version 3.0 | Zertifizierter Dokumentenserver der Humboldt-Universität zu Berlin | HTML generated: 05.04.2004 |