Thiele, Holger: Struktur und Funktion des Gens für das translationell kontrollierte Tumorprotein (TCTP)

25

Kapitel 3. Material und Methoden

3.1. Materialien

3.1.1. Geräte

Thermocycler

Biometra TRIO-Thermoblock

Hybridisierungsofen

MWG BIOTECH

Geigerzähler

Series 900 mini-monitor

Stromversorgungsgeräte

GIBCO, Consort, LKB

Zentrifugen

Sigma, Sorvall, Heraeus

Flüssigszintillationszähler

Wallac, LKB

Phosphorimager

Biorad

Transiluminator

AGS

Elektrophoresekammern

BRL, Pharmacia

Kamera

Polaroid

Laminarboxen

Antair

Speed-vac

Savant

Brutschränke

Heraeus

Wasserbäder

MGW-Biotech

Elektroporationsgeräte

Life Technologies, LKB

Photometer

Shimadzu

DNA-Sequencer

MGW Biotech, ABI Prism

3.1.2. Chemikalien

Alle verwendeten Chemikalien besaßen den Reinheitsgrad pro analysi.

Acetyl-Coenzym A

Boehringer Mannheim

Agarose

Serva

Ampicillin

Roth

Bacto Agar

Difco

BactoTrypton

Difco

Bacto Hefe

Difco

Borsäure

Roth

Bromphenolblau

Merck

BSA

Boehringer Mannheim

Chloroform

Baker

dATP, dCTP, dGTP, dTTP

Biolabs

DMEM

Gibco

DMSO

Merck

DTT

Sigma

EDTA

Serva

Ethanol

Baker

Ethidiumbromid

Ferak


26

FKS

Gibco

Glucose

Merck

Glycerin

Merck

HCl

Merck

Heringssperma-DNA

Boehringer Mannheim

KCl

Roth

KH2PO4

VEB Laborchemie Apolda

Maltose

BDH

Methanol

Baker

MgCl2

Sigma

MgSO4

VEB Laborchemie Apolda

2-Mercaptoethanol

Serva

NaAc

Roth

NaCl

Roth

NaCitrat

Roth

NaOH

Roth

PEG 6000

Roth

Phenol

Roth

SDS

Serva

Streptomycin

Serva

TRIS

Roth

X-Gal

AGS

3.1.3. Radiochemikalien

[alpha32P] dCTP (3000-6000Ci/mmol)

Amersham

[alpha32P] UTP (800 Ci/mmol)

ICN

[1,2 C14] Chloramphenicol (103 mCi/mmol)

ICN

3.1.4. Synthetische Oligonukleotide

Tabelle 1 Alle verwendeten TCTP/TPT1-Primer: Die Positionen der Kaninchenprimer orientieren sich an der Lage im Gen, während sich die Positionen der humanen Primer, wo möglich, an der korrespondierenden cDNA orientiert. Alle Primer sind von 5’ nach 3’ angegeben. (U=UTR, E=Exonnummer, I=Intronnummer, P=Promotor, ?=genaue Positionsangabe derzeit nicht möglich)

Name

5’ Sequenz 3’

Position

Name

5’ Sequenz 3’

Position

TPT1- Gen Hinprimer Kaninchen

TPT1- Gen RückprimerKaninchen

P2301H

cttttccgcccgctcccc

1 U

P23R10

tgctctccgagaacttcccg

-531 P

P23H9

tccgggctcctgcaagcta

63 U

P23R11

tctgggtgcttgtctaactc

-508 P

P23H5

tctcctaccagccgccat

98 U

P23R9

tagcttggcaggagcccgga

63 U

P23Nco5'

taccagccgccaccatggtt

103 UE

HMO-TAPR2

tcttgtagatgtcggagaac

375 E2

P23H8

tccgacatctacaagatccg

379 E2

LX2R4

gatgagcgaatcatcaatgt

964 E3

LX2H4b

acattgatgattcgctcatc

964 E3

LX2R3

caatatcaacaccagtgatc

1037 E3

P23H7

caagcacatccttgctaa

1536 E4

P23I1R

gtatgctcacattgctcag

1267 I3

P23H6

ggtgaaaacatgaatccaga

2325 E5

HMO-TAPR1

ccatctggattcatgttttc

2328 E5

P23I3H

gggcttagaatcttgattc

2628 I5

LX2R1

catctctaaaccatcctta

2405 E5

P23648H

tggatctatcactgctcatc

3306 U

P23-635R

ttaacatttttccatctctaa

2415 E5

P23H10

acttcaagtggaggcattgt

3422 U

P23I3R

caatctgggctgccacaa

3197 I5

P23H4

gagagaatgcctattagt

3504 U

LX2R0

agacaacctacatgacaatg

3457 U

P23H11

cctacaacggaagtagctaac

3756 U

P23R1

tgtagaagttatctgaag

3613 U

P23R3

caactcaatcagtctctc

3802 U


27

Name 5’ Sequenz 3’ Position Name 5’ Sequenz 3’ Position
TPT1-Gen/cDNA Hinprimer Mensch TPT1-Gen/cDNA Rückprimer Mensch

hP23PromH

atgcaccgggaatacaactg

?

P23-37R

ccaacctcatatagagggca

-37 P

P23-37H

tgccctctatatgaggttgg

-37 P

hP23-1R

aggggggagcgggcggaaaag

1 E

hP23-293H

gaaggtaccgaaagcacagt

292 E

hP23-333R

ctgcaggtgatggttcatga

332 E

hP23-I4H

tccggaagtatcttatggcc

? I4

hP23-654R

tgatgacaggtgatagatcc

653 E

hP23-I4H2

gtggtctaaaccttcccttg

? I4

hP23-U2R

ccactgaatgagtctcttttt

1135 U

hP23-635H

caaatgtggcaattattttg

634 E

hP23-U2H

atttgagagaatgccttttag

851 U

Zum Screening von Rekombinanten wurden folgende Primer verwendet:

CAT3-H2 5’ AGTCACGACGTTGTAAAACG 3’ Position 367 bp im Vektor pBLCAT3

CAT3-R2 5’ CCTTAGCTCCTGAAAATCTC 3’ Position 479 bp im Vektor pBLCAT3

Alle Oligonukleotide wurden von der Firma TIB Mol-Biol (Berlin) im Synthesemaßstab 0,2 µmol bezogen.

3.1.5. Enzyme, Kits und sonstiges

Restriktionsendonukleasen, Ligasen, Polymerasen,

Boehringer, AGS, Biolabs, Fermentas

CIP, RNAsin, Proteinase K, Nukleasen

Clontech, Invitrogen, MBI, Biolabs

PCR-Script™Amp Cloning Kit

Stratagene

Human monocyte cDNA library

Clontech

Human RNA Master Blot™

Clontech

P1-Bank gene discovery array

Genome Systems

QIAquick PCR Purification Kit

QIAGEN

QIAEX II Gel Extraction Kit

QIAGEN

QIAGEN Plasmid Mini/Maxi Kits

QIAGEN

QIAquick Nucleotide Removal Kit

QIAGEN

Random Primed DNA Labeling Kit

Boehringer

Hybond - N

Amersham

Immobilon™ - N

Millipore

Kodak BioMax MR film

Kodak

Polaroid Polapan PRO 100 film

Polaroid

DC-Plastikfolien 20 x 20 cm Kieselgel 60

Merck

Micro BCA™ Protein Assay Reagent Kit

Pierce


28

3.1.6. Soft- und Hardware

Diese Arbeit wurde auf einem Macintosh Computer (Power Macintosh G3) realisiert. Als Textverarbeitung kam Microsoft Office 98 zum Einsatz. Als Werkzeuge zum Bearbeiten und Analysieren von DNA-, RNA- und Proteinsequenzen wurden DNA-Strider 1.2, das DNAStar-Programm und GCG benutzt. Graphiken wurden mit Canvas und Adobe Photoshop erstellt und bearbeitet. Auf folgende Internetresourcen wurde zurückgegriffen:

http://www.ebi.ac.uk

Sequenzvergleiche, Zugriff auf EMBL-, GenBank-, Swissprot Datenbanken

http://transfac.gbf.de

Zugriff auf TransFac-Datenbank und MatInspector® Programm

3.2. Methoden

3.2.1. Polymerase-Kettenreaktion (PCR)

Ein Standart-PCR Ansatz setzte sich wie folgt zusammen: 18,75 µl H20, 0,75 µl 50mM MgCl2, 2,5 µl 10x PCR-Puffer, 1 µl 10 µM Hinprimer, 1 µl 10 µM Rückprimer, 0,5 µg Template-DNA und 0,25 µl Taq-Polymerase von InViTek 1 U/µl. Die Annealing-Temperaturen wurden unter Verwendung der Formel Tm=69,3 °C + 0,41 x (GC%) - 650/Primerlänge + 3°C abgeschätzt. Die weiteren PCR Bedingungen wurden angelehnt an das Protokoll von Kramer und Coen ( Kramer und Coen 1995 ).

3.2.2. Radioaktiv markierte Sonden

“random primed DNA labeling“

100 ng gereinigte PCR-Fragmente (Protokoll von QIAgen) wurden mit 5 µl [alpha32P]-dCTP (3000-6000 Ci/mMol) und 2 µl Hexanukleotid-Primer-Mix nach dem Protokoll von Boehringer Mannheim radioaktiv markiert, von restlichen radioaktiven Nukleotiden mit Affinitätssäulen nach dem Protokoll von QIAgen befreit und nach 5 min Kochen zur Hybridisierungslösung gegeben.


29

Radioaktiv markierte Transkripte

1 µg linearisierte Plasmid-DNA wurde unter Verwendung von 2,5µl [alpha32P]-UTP (800 Ci/mmol) und T3 oder T7 Polymerase nach dem Protokoll von Promega (Promega Riboprobe® in vitro system) generiert. Die Entfernung überschüssiger Nukleotide erfolgte durch Fällung der RNA-Sonde mit 2,5Vol Äthanol und 1/10Vol. 3M NaAc für 30 min. bei -80°C und 2 maliger Waschung mit -20°C kaltem 70%igem Äthanol. Nach Aufnahme in 100µl 1xTE-Puffer wurde die Sonde der Hybridisierungslösung zugegeben.

3.2.3. Southernblots

40 µg Kaninchen-DNA aus der Leber wurden 8 h mit Restriktionsenzymen gespalten. Die Reaktionen wurden mit dem vom Enzymhersteller empfohlenen Puffersystem und 3 U Enzym/µg DNA in einem Endvolumen von 400 µl durchgeführt. Die Anreicherung der DNA geschah nach Phenol/Chloroformextraktion und Fällung in 70% Äthanol bei -80 °C in 20 µl 1xTE. Die Auftrennung der Proben erfolgte in einem 1% Agarosegel über Nacht. Nach Photographie des Gels erfolgte dessen Übertragung auf eine Nylonmembran mittels Kapillartransfer in 20xSSC. Die Keuzvernetzung der DNA mit dem Filter wurde bei 80°C für 2h im Heißluftofen durchgeführt ( Southern 1975 ).

3.2.4. Hybridisierungen mit DNA und RNA Sonden

Die Prähybridisierung des Blots erfolgte 2h bei 68°C im Hybridisierungsofen. Die Hybridisierung wurde über Nacht in Hybridisierungslösung ebenfalls bei 68°C durchgeführt. Der Blot wurde anschließend mehrmals (4-6 mal) in Waschpuffern mit absteigender Salzkonzentration (2x SSC/0,1%SDS, 1x SSC/0,1% SDS, 0,5x SSC/0,1% SDS, 0,1x SSC/0,1% SDS) von unspezifisch gebundener Radioaktivität befreit. Die Temperaturen (45°C - 65°C) und Waschzeiten (1h-8h) richteten sich nach der detektierbaren Hintergrundaktivität ( Maniatis et al. 1989 ). Die Exposition erfolgte mit Röntgenfilmen bei -80°C für 1h -2d je nach Signalstärke.


30

3.2.5. Sequenzierungen

Die Sequenzierungen erfolgten per Auftrag durch die Firma InViTek Berlin nach der Methode von Sanger (Didesoxy-Methode) mit fluoreszensmarkierten Nukleotiden auf dem ABM Prism Sequencer Model 2.1.1., oder selbst von Hand mit 35S markiertem dATP und dem Sequenzierungskit der Firma USB ( Maniatis et al. 1989 ).

3.2.6. Screening einer genomischen Lambda DASH® Phagenbank

Das Screening der genomischen Kaninchenphagenbank Lamda DASH® II orientierte sich am Firmenprotokoll von Stratagene. Die Plaquedichte wurde so gewählt, daß auf 16 Platten (_ 13 cm) mit je etwa 30 000 pfu das Kaninchengenom statistisch 2-3 mal vertreten war. Nach partieller Spaltung der DNA mit Sau3AI erfolgte der Einbau von 9-22 kb großen Fragmenten in den Lamda DASH® II Phagenvektor. Als Sonde fand ein markiertes PCR Fragment Verwendung, das ein Teilamplifikat aus dem kodierenden Teil des TCTP-cDNA-Klones 31/1 darstellte (Primer LX2H4/LX2R1). Nach Primär-, Sekundär- und Tertiärscreening gelang die Isolierung von 13 Pseudogenklonen (lambda1-lambda13) und einem TPT1-Gen-Klon (lambdaH1). Die Präparation von lambda-DNA wurde Maniatis et al. 1989 entnommen. Durch erneutes Screening der Bank mit Hilfe einer radioaktiv markierten Intronsonde wurden zwei weitere genomische TPT1-Klone gewonnen (lambdaH2, lambdaH3), wobei geeignete Restriktionsfragmente des Klon lambdaH2 weiter subkloniert und analysiert wurden.

3.2.7. Screening einer P1-Bank nach genomischen Human-TPT1-Klonen

Die Vorgehensweise der Klonsuche ist dem Kap. 4.3.5 zu entnehmen. Die weitere Subklonierung von Restriktionsfragmenten des P1 Klones 231/E12 wurde wie folgt gestaltet. Klon 18: Der Klon E12 wurde XbaI/NotI gespalten und das Gemisch aller Fragmente in einen XbaI/NotI linearisierten pBLSK+ Vektor ligiert. Mit einem radioaktiv markierten PCR-Fragment aus Klon E12 (Primer: P23-37H/HMO-TAP-R2) wurden per Koloniehybridisierung positive Bakterienklone selektiert. Die Analyse des Inserts von Klon 18 ergab eine Größe von 6,6 kb. Der NotI Ort lag im Intron 1 während sich der XbaI Ort stromaufwärts des Gens befand. Klon 18/BglII/XbaI: Klon 18 wurde mit BglII/XbaI geschnitten und unter Deletion eines 6,1 kb Fragmentes religiert. Dieser Klon enthält 501 bp des humanen TPT1-Promotors.


31

3.2.8. Subklonierung genomischer Fragmente

lambdaH2-EcoRI: Der das Kaninchen-TPT1-Gen enthaltene lambda-Klon lambdaH2 wurde mit EcoRI gespalten und das durch Southernblots identifizierte 6,8 kb Fragment aus dem Gel eluiert. Dieses wurde in einen EcoRI geschnittenen und Phosphatase behandelten pBLSK + Vektor ligiert. H7: Der Klon lambdaH2-EcoRI wurde mit NheI gespalten und das 0,9 kb große NheI/NheI Fragment aus dem Gel eluiert. Dieses Fragment wurde in einen XbaI geschnittenen und Phosphatase behandelten pBLCAT3 Vektor ligiert. Die Orientierung des Fragmentes wurde durch HindIII-Spaltung überprüft. H12: Der Klon lambdaH2-EcoRI wurde mit NheI und HindIII gespalten und das 460 bp große Fragment aus dem Gel eluiert. Dieses wurde in einen HindIII/XbaI geschnittenen pBLCAT3 Vektor ligiert. H33: Der Klon H12 wurde mit EcoNI und HindIII gespalten, das 4 kb große pBLCAT3 Vektorfragment isoliert, die Enden mit der Klenow-Polymerase aufgefüllt und anschließend religiert. H27/H31: Das einklonierte Fragment des Klones H12 wurde mit Hilfe flankierender Primer (CAT3H2/CAT3R2) unter Einschluß von Teilen des Polylinkers per PCR in quantitativen Mengen amplifiziert, isoliert und anschließend mit RsaI bzw. MspAI nachgespalten. Diese Fragmente wurden in den HindIII gespaltenen, mit Hilfe von Klenow-Polymerase glattendig gemachten und anschließend BamHI gespaltenen pBLCAT3 Vektor einkloniert (H27=BspMI, H31=RsaI). TPT1-ps1/2/3/4: Southernblots mit EcoRI gespaltener DNA der Klone lambda1-lambda13 wurden mit einer TCTP-kodierenden Sonde hybridisiert und autoradiographisch dargestellt. Die in Abb. 4-21 markierten Banden wurden aus Agarosegelen extrahiert, in den mit EcoRI linearisierten und Phosphatase behandelten Vektor pBLSK+ ligiert und die TPT1-Pseudogen enthaltenen Bereiche anschließend sequenziert. H21, H14, H25: lambda1 (TPT1-ps3), lambda7 (TPT1-ps1) und lambda9 (TPT1-ps2) DNA wurde mit NheI und XbaI gespalten und die 700, 800 und 2000 bp großen Banden in einen XbaI linearisierten und Phosphatase behandelten pBLSK+ Vektor ligiert. Die positiven Klone wurden durch Spaltung mit BamHI auf die richtige Orientierung überprüft. H35: Das 1,2 kb große HindIII/NheI Fragment aus dem Klon lambda12 (TPT1-ps4) wurde in HindIII/NheI linearisierten pBLSK+ ligiert.


32

Tabelle 2 Kurzübersicht verwendeter Vektoren und Klone, sowie Größen, Orientierungen und Inhalte der Inserts.

Klon Insert
Größe
Insert
Orient.
Insert
enthält ...
Vektor
lambdaH2 15 kb ? Kan. TPT1-Gen komplett l-DASHII
lambdaH2-EcoRI 7 kb - Kan. TPT1-Gen komplett pBLSK +
lambdaH2-SmaI 4 kb + Kan. TPT1-Gen ab Intron 1 pBLSK +
H7 0,9 kb + Kan. TPT1-Promotor pBLCAT3
H12 0,49 + Kan. TPT1-Promotor pBLCAT3
H33 0,37 + Kan. TPT1-Promotor pBLCAT3
H27 0,25 + Kan. TPT1-Promotor pBLCAT3
H31 0,15 + Kan. TPT1-Promotor pBLCAT3
231/E12 100 kb ? Human TPT1-Gen komplett P1
Klon18 6,6 kb ? Human TPT1-Gen bis Intron1 pBLSK+
Klon18/BglII/XbaI 0,5 kb ? Human TPT1-Gen bis Intron1 pBLSK+
H14 0,8 + TPT1-ps1-Promotor pBLCAT3
H25 2,0 + TPT1-ps2-Promotor pBLCAT3
H21 0,7 + TPT1-ps3-Promotor pBLCAT3
H35 1,2 kb + TPT1-ps4-Promotor pBLCAT3
lambda1-lambda13 15 kb ? TPT1-Pseudogene l-DASHII
lambda2-EcoRIlambda7-EcoRIlambda13-EcoRI 1,8 kb ? TPT1-ps1 pBLSK+
lambda9-EcoRI 2,5 kb ? TPT1-ps2 pBLSK+
lambda1-EcoRI 2,5 kb ? TPT1-ps3 pBLSK+
lambda12-EcoRI 3,0 kb ? TPT1-ps4 pBLSK+
H40 0,39 kb - Kaninchen kodierend aus TCTP-mRNA pCRScript SK+
hP23/3’UTR2 0,69 kb + Human, komplette TCTP-3’UTR2 pCRScript SK+

3.2.9. CAT-Assays

Glatte Aorta-Muskelzellen vom Kaninchen (S. Ylä-Herttuala, Kuopio, Finnland) wurden in DMEM unter Zusatz von 10% FKS, 50 µg/ml Penicillin und 50 µg/ml Streptomycin kultiviert. 5 x 106 Zellen wurden pro Ansatz mit 30 µg CAT-Konstrukt-Plasmid und 8 µg beta-Gal-Plasmid nach der Elektroporatiosmethode kotransfiziert ( Bergot et al. 1992 ). Die Bestimmung der CAT Enzymaktivität wurde entsprechend der Vorschrift von Gorman et al. ( Gorman et al. 1982 ) durchgeführt. Dazu wurden die Zellen nach 48h in Zellkultur abzentrifugiert, ein Proteinextrakt präpariert und die Proteinkonzentration nach einer modifizierten Biuret-Methode (Micro BCA Protein Assay Kit, Pierce, USA) bestimmt. Aus 90 µg Proteinextrakt wurden die 14C-markierten acetylierten Chloramphenicol-Produkte angereichert und dünnschichtchromatographisch aufgetrennt. Nach Exposition der Kieselgelplatten gegen einen Röntgenfilm wurden die Acetylierungsprodukte auf den Platten markiert, ausgeschnitten und die Stärke der Aktivität im Szintillationszähler quantifiziert. Zur Kalibrierung der Unterschiede in der Transfektionseffizienz wurde die gemessene Aktivität durch Bestimmung der


33

beta-Galaktosidaseaktivität aller Ansätze umgerechnet. Alle Experimente wurden zur statistischen Sicherung 3-4 mal wiederholt ( Maniatis et al. 1989 , Kramer und Coen 1995 ).

3.2.10. Dotblots

Aus einer humanen Monozyten-cDNA-Bank wurden per PCR ein 388 bp großes kodierendes Fragment (Primerkombination P23-H8/HMO-TAP-R1) und ein 690 bp großes Fragment aus der humanen 3’UTR2 der TCTP-cDNA (Primerkombination hP23-U2H/hP23-U2R) amplifiziert und mit dem pCR-Script™ Amp.SK+ Kloniersystem von Stratagene subkloniert. Nach Verifizierung der PCR-Produkte durch Sequenzierung und enzymatischer Linearisierung der Vektoren wurden mit dem Promega Riboprobe® in vitro System radioaktiv markierte Transkripte generiert. Mit diesen Sonden wurde ein kommerziell erhältlicher RNA-Dotblot mit Poly(A)+RNA aus 50 verschiedenen menschlichen Geweben (Human Master Blot, Clontech) nacheinander im Abstand von 3 Monaten nach Abklingen der Aktivität hybridisiert. Nach der Anfertigung autoradiographischer Aufnahmen (die Expositionszeit für den mit der kodierenden Sonde hybridisierten Blot betrug 4 h und für die 3‘UTR2-spezifische Sonde 2 Tage) wurden mit zwei verschiedenen Phosphorimagersystemen von Biorad (Modell GS-525 und Modell FX) die Signale jeweils quantitativ ausgewertet.


[Titelseite] [Widmung] [Einleitung] [Abkürzungsverzeichnis] [1] [2] [3] [4] [5] [6] [Bibliographie] [Danksagung] [Selbständigkeitserklärung] [Lebenslauf] [Anhang]

© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiML DTD Version 2.0
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Mon May 29 13:40:59 2000