Thiele, Holger: Struktur und Funktion des Gens für das translationell kontrollierte Tumorprotein (TCTP)

34

Kapitel 4. Ergebnisse

4.1. Die Strukturen der TCTP-mRNAs

4.1.1. TCTP-mRNA-Varianten mit alternativen 3’UTRs

Die Aktivität eines Gens spiegelt sich in seinen Transkripten wider. Da sich diese Arbeit in erster Linie mit der Transkriptionskontrolle des TPT1-Gens des Kaninchens beschäftigen sollte, war es sinnvoll, die Transkripte dieses Gens genauer zu untersuchen. Aus Datenbankeinträgen gingen die TCTP-mRNA-Sequenzen von Maus, Mensch und Kaninchen hervor. Die Sequenz der Maus war als einzige vollständig und enthielt am 5’-Ende der 5’-UTR eine als “Polypyrimidin-Trakt“ bezeichnete Struktur, die ursächlich für die posttrankriptionelle Kontrolle angesehen wird. Die Humansequenz und die des Kaninchens waren 5’UTR-seitig nur unvollständig aufgeklärt. Eine Konservierung der für diesen mRNA Typ charakteristischen Polypyrimidinsequenzen auch bei anderen Säuger TCTP-mRNAs wäre als Hinweis für ihre allgemeine Bedeutung bei der posttranskriptionellen Regulation der Synthese des TCTP zu deuten gewesen. Deshalb war die vollständige Aufklärung der 5’UTR eine weitere, im Vordergrund stehende Aufgabe.

Für die Analyse von Trankripten gibt es mehrere Möglichkeiten. Northernblots geben Aufschluß über die Vielfalt vorhandener Transkripte, ihre Größen und Mengen und gestatten Aussagen über gewebsspezifische Unterschiede (Kap. 4.1.2 .). Auch cDNA-Banken spiegeln die Genaktivität der Gewebe wider, aus denen sie erstellt worden sind und gestatten neben semiquantitativen Aussagen auch eine direkte Sequenzierung der positiven Klone.

Die Suche nach TCTP-positiven Rekombinanten in einer Kaninchen Retikulozyten cDNA Bank mit einer Kaninchen TCTP-cDNA Sonde erbrachte mehrere Klone, die sich auf zwei Varianten reduzieren ließen (M. Berger, Promotion 1998). Als Sonde wurde ein PCR-Fragment benutzt, das den größten kodierenden Teil der mRNA repräsentierte. Die Primer (LX2H4b/LX2R1) wurden aus der Datenbanksequenz Z46805 abgeleitet. Die Inserts positiver Klone wurden durch Spaltung mit Restriktionsenzymen und PCR charakterisiert und einige Klone mit möglichst langen Inserts vollständig sequenziert. Die Abb. 4-1 zeigt schematisch den Aufbau der gefundenen TCTP-cDNA Klone im Vergleich mit der Datenbanksequenz (EMBL-Zugangsnummer Z46805).


35

Abb. 4-1 Vergleich der publizierten TCTP-cDNA Sequenz mit Klonen aus einer cDNA-Bank: Hauptunterschied ist die verlängerte 3’UTR2 des Klones 31/1. Ursache der Punktmutationen in den Klonen 33/34 und 31/1 sind wahrscheinlich Sequenzierfehler der veröffentlichten Datenbanksequenz, die 5’UTR-seitig zudem noch Teile des zur Klonierung benutzten Vektors enthält (MCS).

Am auffälligsten präsentierte sich der Klon 31/1, der sich von den anderen durch eine 320 bp längere 3' UTR unterschied (3'UTR2). In keiner bislang untersuchten Spezies konnte zu diesem Zeitpunkt ein Gegenstück zu dieser Sequenz gefunden werden. Da auch die Gensequenz fehlte, konnten hinsichtlich des Entstehungsmechanismus nur verschiedene Hypothesen herangezogen werden. Generell wäre es möglich, durch alternatives Splicing des letzten Exons zu alternativen Transkripten zu gelangen. Eine andere Erklärung ergäbe sich durch die Existenz mehrerer Gene im Sinne einer Multigenfamilie. Die häufigste Ursache bei der Bildung von Transkripten, die sich in der Länge der 3’UTR unterscheiden, stellt jedoch die Benutzung alternativer Polyadenylierungssignale dar. In der Tat konnte ein zweites Polyadenylierungssignal (AATAAA) in der Position 1141 gefunden werden.

Belegt werden konnte dies durch die Aufklärung der Kaninchengensequenz (Kap. 4.2 ) und durch die 1996 bekanntgewordene Teilsequenz des humanen TPT1-Gens ( Bonaldo et al. 1996 ). Das humane TPT1-Gen ist dem Kaninchengen stark homolog. Insbesondere die verlängerte 3’UTR2 Sequenz findet sich wieder. In Human-Northernblots finden sich ebenso wie im Kaninchenblot zwei Signale, und der humane “expressed sequence tag“ (EST) HUM000S635 ist mit der humanen 3’UTR2 Sequenz identisch. EST-Datenbanken bestehen aus 3’UTR und 5’UTR-seitig ansequenzierten cDNA-Bibliotheken verschiedener Gewebe. Damit ist der cDNA Klon HUM000S635 das humane Äquivalent zum Kaninchenklon 31/1. Der Vergleich der Klone 33/34 und 31/1 mit der cDNA Sequenz aus der Datenbank (Z46805) zeigte insgesamt fünf Nukleotidunterschiede, darunter drei Punktmutationen in der kodierenden Sequenz, die auch nicht-konservative Aminosäureaustausche (Pos. 4: Aspartat _ Tyrosin, Pos. 13: Methionin _


36

Threonin, Pos. 129: Phenylalanin _ Leucin), eine Insertion in der 5' UTR (Pos. 76: Ins. _ Cytosin) und eine 3 bp Deletion in der 3' UTR (Pos. 705: Del. _ CCA). Da sich alle diese Abweichungen in der Basensequenz sowohl im Gen, als auch in den Pseudogenen bestätigten, dürfte es sich hierbei um Sequenzierfehler in der veröffentlichten Sequenz handeln. Die Möglichkeit, daß die Mutationen auf rassebedingte Polymorphismen zurückzuführen sind, ist jedoch auch nicht auszuschließen. Die folgende Sequenz ( Abb. 4-2 ) zeigt die lange TCTP-cDNA2 (3'UTR1 + 3'UTR2). Die 3'UTR2 Sequenz beginnt ab Position 844. Die Rekonstruktion der kompletten 5’UTR war durch die spätere Analyse des TPT1-Gens und der TPT1-Pseudogene möglich. Sie zeigt alle Merkmale der schon von der Maussequenz bekannten Polypyrimidinstruktur.

Abb. 4-2 Vollständige TCTP-cDNA2 Sequenz des Kaninchens: Die beiden alternativ benutzten Polyadenylierungssignale und der Beginn der 3’UTR2 sind unterstrichen dargestellt. Die Sequenz der TCTP-cDNA2 und die daraus hervorgehende TCTP-cDNA1-Sequenz sind unter AJ131951 in der EMBL-Datenbank abgelegt (*=STOP-Signal).

   1 CTTTTCCGCCCGCTCCCCCCTACCCCCGAGGGCCGCTCCGGCTGCACCGCCTCGCTCTGAGCTCCGGGCTCCTGCCAAGC 80


  81 TAGCGCCGCCGCTGTCGTCTCCTACCAGCCGCCATC ATG ATT ATC TAC CGG GAC CTC ATC AGC CAC GAT 149
   1                                      M   I   I   Y   R   D   L   I   S   H   D   11


 150 GAG ATG TTC TCC GAC ATC TAC AAG ATC CGG GAG ATC GCG GGC GGA CTG TGC CTG GAG GTG  209
  12 E   M   F   S   D   I   Y   K   I   R   E   I   A   G   G   L   C   L   E   V    31


 210 GAG GGG AAG ATG GTC AGT AGG ACA GAG GGT AAC ATT GAT GAT TCG CTC ATC GGT GGG AAT  269
  32 E   G   K   M   V   S   R   T   E   G   N   I   D   D   S   L   I   G   G   N    51


 270 GCC TCC GCC GAA GGG CCG GAG GGC GAA GGT ACC GAA AGC ACA GTG ATC ACT GGT GTT GAT  329
  52 A   S   A   E   G   P   E   G   E   G   T   E   S   T   V   I   T   G   V   D    71


 330 ATT GTC ATG AAC CAT CAC CTG CAG GAA ACC AGC TTC ACA AAA GAA GCC TAC AAG AAG TAC  389
  72 I   V   M   N   H   H   L   Q   E   T   S   F   T   K   E   A   Y   K   K   Y    91


 390 ATC AAA GAT TAC ATG AAA TCA ATC AAA GGC AAA CTT GAA GAA CAG AGA CCA GAG AGA GTA  449
  92 I   K   D   Y   M   K   S   I   K   G   K   L   E   E   Q   R   P   E   R   V    111


 450 AAA CCT TTT ATG ACA GGG GCT GCA GAA CAA ATC AAG CAC ATC CTT GCT AAT TTC AAA AAC  509
 112 K   P   F   M   T   G   A   A   E   Q   I   K   H   I   L   A   N   F   K   N    131


 510 TAC CAG TTC TAT ATT GGT GAA AAC ATG AAT CCA GAT GGC ATG GTT GCT CTG CTG GAC TAC  569
 132 Y   Q   F   Y   I   G   E   N   M   N   P   D   G   M   V   A   L   L   D   Y    151


 570 CGT GAG GAT GGT GTG ACC CCG TTT ATG ATT TTC TTT AAG GAT GGT TTA GAG ATG GAA AAA  629
 152 R   E   D   G   V   T   P   F   M   I   F   F   K   D   G   L   E   M   E   K    171


 630 TGT TAA caaagttggcaatttggatctatcactgctcatcgtaactggctgctgcttgtcatccacacaacaccagga 707
  72 C   *                                                                            173


 708 tttacaggaagtgggactgatgttatgttgagctcctcacttattttgaccatgatttacttcaagtggaggcattgttt 787


 788 ttaaggcaaaaaacattgtcatgtaggttgtctaaaAATAAAatgcatttaaattCATTTgagagaatgcctattagttt 867
                                                            uarr Beginn der 3’UTR2
 868 aatgtacatttaagctaaatccatcctgtagtgtttcctggagaagctaaagcctggtttgtagacactactagaaagca 947


 948 taagactgtcttcagataacttctacagtgaaaactgctgggactggaatataaactgagaatccaaagttaaattctga 1027


1028 attacagtaaagggaaaaaccatgctcatagcagtgccaacatttgaagtggagccttaacacatttcatcacctacaac 1107


1108 ggaagtagctaactggaagagattaccaaaagAATAAAgagagactgattgagttg                         1163


37

4.1.2. Unterschiede in der gewebsspezifischen Transkription der TCTP-mRNAs bei Mensch und Kaninchen

Die Frage nach der quantitativen Verteilung der beiden gefundenen TCTP-mRNAs in verschiedenen Geweben war aus mehreren Gründen interessant. Zum einen erhofften wir uns prinzipielle Aussagen über die Frage, in wieweit TCTP gewebsspezifisch transkribiert wird. Damit sollte eine Lücke in der Literatur geschlossen werden, denn bislang gab es keine Untersuchung dieser Art. Zum anderen wollten wir prüfen, ob die alternativen Transkripte funktionell mit spezifischen Geweben in Verbindung zu bringen waren.

Der Mechanismus, durch den die beiden TCTP-mRNAs entstehen, wurde schon im Kap. 4.1.1 angedeutet. Bestätigt wurde dies durch die spätere Aufklärung der Gensequenz (Kap. 4.2 ). Das Gen besitzt innerhalb der 3'UTR zwei unterschiedliche Polyadenylierungssignale. Offensichtlich ist die Poly(A)-Polymerase in allen untersuchten Geweben in der Lage, bei primären TCTP-Transkripten beide Signale zu erkennen. Daß dies nicht immer so ist, zeigt das Beispiel der 15-Lipoxygenase beim Kaninchen, wo alternative Polyadenylierung hochgradig gewebsspezifisch erfolgt (Thiele et al. 1999).

Hinsichtlich der gewebeabhängigen Transkriptionsmuster kann man drei Typen unterscheiden. Viele Genprodukte werden von allen Zelltypen gleichermaßen benötigt, etwa Strukturproteine wie Actin, Tubulin oder Enzyme des zentralen Energiestoffwechsels. Solche Gene werden als Haushaltsgene bezeichnet. Man findet typischerweise in allen Geweben vergleichbare Mengen an mRNA. Eine andere Gruppe von Genen wird auch in allen Geweben transkribiert, jedoch findet man hier quantitative Unterschiede. Die dritte Gruppe von Genen wird spezifisch in wenigen Geweben transkribiert. Hämoglobin in roten Blutzellen oder Immunglobuline in Plasmazellen sind hierfür Beispiele. Zu klären war die Frage, in welche Gruppe sich das TPT1-Gen einordnen ließ.

Eine bewährte Methode zur Darstellung von mRNAs in Geweben sind Northernblots. Deren Auswertung gestattet quantitative und qualitative Aussagen zur Transkription der untersuchten mRNA. Derartige Versuche mit TCTP-spezifischen Sonden aus dem kodierenden Teil der cDNA-Sequenz wurden mit einer Auswahl verschiedener Gewebe des Kaninchens durchgeführt (Berger, nichtpublizierte Ergebnisse).


38

Abb. 4-3 Northernblot von Kaninchen-mRNA aus verschiedenen Geweben: Als Sonde wurde eine kodierende Sonde aus der TCTP-cDNA1 verwendet. Neben den als Marker fungierenden 18S und 28S rRNAs sind die Positionen des kurzen TCTP-Messengers (843 nt) und des langen Messengers (1163 nt) markiert. (Mit freundlicher Genehmigung von M. Berger)

Man erkennt zwei Signale bei 0,8 kb und 1,2 kb. Diese entsprechen den beiden alternativen TCTP-Transkripten. Das Mengenverhältnis der kurzen mRNA1 zu der langen mRNA2 schwankte in den Geweben schätzungsweise 4:1 bis 10:1. Festzuhalten war, daß in allen untersuchten Geweben eine Transkription stattfand und sich in allen Geweben der kurze mRNA1-Messenger als dominierend erwies. Die Aussagekraft des Northernblots war in sofern eingeschränkt, daß zwar gleiche Mengen Gesamt-RNA aufgetragen worden waren, aber keine Kalibrierung mit Sonden von Haushaltsgenen erfolgte und somit der Gewebsvergleich untereinander limitiert war. Ferner konnte nur eine kleine Auswahl von Geweben berücksichtigt werden.

Der Entschluß, weitergehende Untersuchungen anzustellen, war neben diesen Gründen auch eine Arbeit, die zeigen konnte, daß TCTP in humanen Nierenzellen und Nierenkarzinomzellen nicht


39

exprimiert wurde (Sanchez et al. 1997a). Um möglichst viele Gewebe zu erfassen und eine höchstmögliche Genauigkeit in der quantitativen Aussage zu erreichen, wurden an Stelle von Northernblots RNA-Multigewebe („multitissue“) Dotblots verwendet. Aus Gründen der Vergleichbarkeit mit dem überwiegend aus humanen Quellen stammenden publizierten Material verwendeten wir ebenfalls ein Humansystem. Man kann jedoch davon ausgehen, daß Mensch und Kaninchen keine wesentlichen Unterschiede im TCTP-Expressionsmuster zeigen sollten. Diese Aussage läßt sich aus der großen Ähnlichkeit beider TPT1-Gene und ihrer Transkripte ableiten. Als Sonden für die Blots kamen radioaktiv markierte 32P-Transkripte zum Einsatz, die von verschiedenen Teilen der humanen TCTP-cDNA stammten. Abb. 4-4 verbildlicht die Lage der Sonden zur TCTP-mRNA. Mit der kodierenden Sonde wurden beide mRNAs summarisch erfaßt, während die 3’UTR2 Sonde spezifisch für den langen Messenger war.

Abb. 4-4 Die zur Dotblot-Hybridisierung benutzten Sonden in Relation zu ihrer Lage innerhalb der humanen TCTP-cDNA2.

Tabelle 3 zeigt den Aufbau des Blots mit den Positionen der mRNAs der verschiedenen Gewebe. Die Ergebnisse der Hybridisierung des Blots mit den zwei verschiedenen Sonden nach Anfertigung autoradiographischer Aufnahmen sind in Abb. 4-5 gegenübergestellt.

Tabelle 3 Aufbau des Multigewebedotblots: mRNA von 50 adulten (Reihe A-F) und fetalen (Reihe G) Geweben des Menschen wurden als Dotblot auf eine Membran aufgetragen. Alle Gewebe wurden durch Hybridisierung mit verschiedenen Haushaltsgensonden so quantitativ kalibriert, daß deren Signalstärke in allen Geweben gleich ist. Reihe H enthält verschiedene Negativkontrollen und erlaubt Aussagen über mögliche Kreuzhybridisierungen.

  1 2 3 4 5 6 7 8
A Gehirn Mandel-kern Schweif-kern Kleinhirn Hirnrinde Frontal-hirn Hippo-campus Hirn-stamm
B Occipital-hirn Putamen schwarzeSubstanz Scheitel-hirn Thalamus Luys-Körper Rücken-mark
C Herz Aorta Skelett-muskel Dickdarm Blase Uterus Prostata Magen
D Hoden Ovarien Pancreas Hypo-physe Neben-niere Schild-drüse Speichel-drüse Brust-drüse
E Niere Leber Dünn-darm Milz Thymus Leuko-zyten Lymph-knoten Knochen-mark
F Blinddarm Lunge Luftröhre Placenta
G fetalesGehirn fetalesHerz fetaleNiere fetaleLeber fetaleMilz fetalerThymus fetaleLunge
H HefeRNA50ng HefetRNA100ng E.colirRNA100ng E.coliDNA100ng Polyr(A)100ng humanc0t1DNA100ng humanDNA100ng humanDNA50ng


40

Abb. 4-5 Humaner Multigewebedotblot nach Hybridisierung mit verschiedenen Sonden: Abbildung A zeigt den Blot nach Hybridisierung mit der kodierenden TCTP-Sonde und 4 h Expositionsdauer, Abbildung B nach Hybridisierung mit der 3’UTR2 Sonde und 2 d Exposition.

Wie man in Abb. 4-5 erkennen kann, findet in allen untersuchten 50 adulten und fetalen Geweben eine Transkription statt. Die Stärke der Signale ist in Geweben wie Gehirn und Hoden deutlich schwächer als in muskelreichen Geweben, wie glatten Muskelzellen, die das stärkste Signal aller Gewebe haben. Ein fast identisches Muster findet sich zwischen den mit der kodierenden Sonde einerseits und der 3’UTR2-spezifischen Sonde andererseits hybridisierten Blots.

Um die Ergebnisse besser quantifizierbar zu machen, ( Abb. 4-5 zeigt Blots, die unterschiedlich lange exponiert wurden) wurden die Blots mit Hilfe eines Phosphorimagersystems digital gescannt. Die Hybridisierungsmuster beider Sonden wurden mit zwei unterschiedlichen Phosphorimagern untersucht und zwischen den Datensätzen der Mittelwert gebildet. Ein gewisses Problem ergibt sich aus der Tatsache, daß die Datensätze der beiden Sonden nicht unmittelbar miteinander vergleichbar sind. Diese Information erschließt sich jedoch aus dem Northernblot der Abb. 4-3 . Die beiden Signale des kurzen und langen TCTP-Messengers lassen sich hier ihren Signalstärken entprechend miteinander ins Verhältnis setzten. Dieses Verhältnis wurde ungefähr auf 4:1 - 10:1 der kurzen TCTP-mRNA1 zur langen TCTP-mRNA2 geschätzt.


41

Nun ließen sich die beiden Datensätze der Multitissueblots in einer Abbildung so nebeneinander projizieren, daß ihre Relationen den in vivo-Verhältnissen entsprachen.

In der Abb. 4-6 wurde von einem Verhältnis von 1:6 des kurzen zum langen TCTP-Messenger ausgegangen. Als 100% wurde das stärkste Signal definiert, konkret handelte es sich um die TCTP-mRNA1 von glatter Muskulatur (schwarze Säule: C3). Man erkennt, daß in der TCTP-mRNA Menge der verschiedenen Gewebe große Unterschiede vorliegen. Die im Block A und B repräsentierten Hirn- und Rückenmarkgewebe enthalten weniger mRNA als die muskelreichen Geweben, wie glatte Muskelzellen, Aorta oder Herz. Der Unterschied zwischen höchstem und niedrigstem gemessenen Wert lag hier zwischen 1:50 bei der kodierenden Sonde und 1:100 bei der 3’UTR2-Sonde. Die zweithöchste mRNA-Konzentration zeigte sich in Pankreasgewebe. Zu den Geweben, die TCTP-mRNA verstärkt exprimierten, zählten weiterhin Ovarien, Speicheldrüse, Leber und Niere. Dem gegenüber standen Gewebe wie Hoden, Brustdrüse und weiße Blutzellen, die ähnlich wie das ZNS nur geringe Transkriptionsraten aufwiesen. Kaum Unterschiede waren zwischen adulten und fetalen Geweben zu beobachten, und tendenziell fand sich kein Unterschied in der Gewebeverteilung der beiden TCTP-mRNA-Varianten. Die Ähnlichkeiten der Expressionsmuster beider TCTP-mRNAs waren augenscheinlich, jedoch ließen sich im Verhältnis der beiden mRNAs in den verschiedenen Geweben auch Unterschiede feststellen. Um dies anschaulicher zu machen, wurde die Stärke der Hybridisierungssignale der kodierenden Sonde zum Verhältnis der 3’UTR2-Sonde graphisch dargestellt ( Abb. 4-7 ).


42

Abb. 4-6 Gewebeverteilung humaner TCTP-mRNA: Poly(A)+RNA aus 50 Humangeweben wurde auf einer Blottingmembran immobilisiert und nacheinander mit je einer TCTP-kodierenden und einer TCTP-3’UTR2 Sonde hybridisiert. Die Auswertung der Signale mit Hilfe eines Phosphorimagers ermöglichte eine Quantifizierung der Signale, die proportional zur mRNA-Menge ist. Die schwarzen Säulen repräsentieren die Summe aus TCTP-mRNA1 und TCTP-mRNA2, die gelben Säulen nur die lange TCTP-mRNA2.


43

Abb. 4-7 Verhältnis der kurzen zur langen TCTP-mRNA in verschiedenen Geweben des Menschen: Hohe Quotienten wie im Gewebe Hippocampus (A7) signalisieren eine höhere Transkription des kurzen Messengers im Verhältnis zum langen. Die Y-Achse zeigt den relativen Maßstab der Verhältnisse an. Der Fehler beträgt +/- 5%.

Die Ergebnisse der Abb. 4-7 lassen erkennen, daß das Verhältnis von kurzer zu langer mRNA nicht in allen Geweben konstant ist. Zwar schwankt das Verhältnis kurz/lang bei den meisten Geweben nicht mehr als um den Faktor zwei, jedoch beträgt es bei einigen (Hirnrinde A5, Frontalhirn A6, und Hippocampus A7) bis zum Faktor fünf. Kompliziert wird die Aussage durch zwei methodische Besonderheiten. Zum einen stellt die kodierende Sonde die Summe der Konzentrationen der mRNAs 1 und 2 dar, und zum anderen sind die absoluten Markierungsintensitäten der Sonden nicht identisch. Wie die Northernblots mit Kaninchen TCTP-mRNA zeigen (Abb. 4-3), die einen echten Vergleich der mRNA Konzentrationen zulassen, beträgt das geschätzte Verhältnis der kurzen zur langen mRNA in allen Geweben etwa 4-10:1. Aus den Human-Dotblots läßt sich das Verhältnis der Konzentrationen der beiden mRNAs zueinander natürlich nicht ohne weiteres ableiten. Zwei Aussagen sind jedoch durchaus korrekt zu treffen: Die Konzentrationen der Summe beider mRNAs unterscheiden sich auch beim Menschen von Gewebe zu Gewebe erheblich, bis nahezu zum Faktor 100 (Abb. 4-6, schwarze Säulen). Das gleiche trifft auch für den Gewebsvergleich der langen mRNA2 zu, die durch die spezifische Sonde eindeutig darstellbar ist (Abb 4-6, gelbe Säulen). Da beim Menschen ebenso anzunehmen ist, daß die kurze mRNA1 in allen Geweben die dominierende Form ist, spiegeln die schwarzen Säulen (Summe von mRNA1+2) im wesentlichen die Verhältnisse der Konzentrationen der mRNA1 wider. Summarisch läßt dies sicherlich den


44

Schluß zu, daß auch beim Menschen die Expression beider TCTP mRNAs einer gewebsspezifischen Regulation unterliegt.

4.2. Aufklärung der Struktur des TPT1-Gens des Kaninchens

4.2.1. Genomische Southernblots

Um erste Aussagen über die Verteilung von TCTP-ähnlichen Sequenzen im Genom des Kaninchens treffen zu können, wurden genomische Southernblots mit kodierenden Sonden hybridisiert. Die Southernblots der Abb. 4-8 zeigten erstaunlicherweise eine hohe Anzahl von Hybridisierungssignalen.

Abb. 4-8 Genomischer Southernblot mit TCTP-kodierender Sonde hybridisiert: Die Bahnen 1-6 entsprechen Restriktionsspaltungen mit den Enzymen BamHI (1), EcoRV (2), KpnI (3), XbaI (4), SfiI (5) und NotI (6).

Für dieses Ergebnis gibt es mehrere Erklärungsmöglichkeiten. Erstens hätte es sich um Artefakte handeln können, die durch Kreuzhybridisierung der Sonde mit ähnlichen Sequenzen entstehen. Zweitens wäre es denkbar, daß es sich im Falle des TCTP um eine Genfamilie mit weiteren


45

TPT1-ähnlichen Genen handelt. Drittens standen Pseudogene im Verdacht, die genomische Komplexität zu verursachen. Die dritte Hypothese war auf Grund von Versuchen, das TPT1-Gen der Maus zu klonieren, sehr wahrscheinlich (Bommer, persönliche Mitteilung). Dort waren zahlreiche Pseudogene gefunden worden, die für die erfolglose Suche nach dem Gen verantwortlich waren.

4.2.2. Screening einer Lambda DASHII Phagenbank

Um die vollständige Gensequenz aufklären zu können, war die Isolierung einer genomischen Rekombinante des TPT1-Gens notwendig. Dafür eignete sich die von Stratagene vertriebene Lambda DASH® II Phagenbank, die in den ersten beiden Isolierungsversuchen mit einer kodierenden TCTP cDNA Sonde gescreent wurde.

Die Komplexität der genomischen Southernblots fand ihre Bestätigung in der ersten Screeningrunde, bei der zahlreiche positive Signale gefunden wurden. Von 13 der über 30 gefundenen Primärsignale wurden Einzelplaques isoliert und anschließend Lambda-DNA präpariert. Um die Frage zu klären, ob es sich bei den gefundenen Signalen um Gene oder Pseudogene handelte, wurden Southernblots aus SacI gespaltener Lambda-DNA mit TCTP-spezifischen Sonden hybridisiert. Aus der TCTP-cDNA ließ sich nach SacI-Spaltung ein 680 bp großes Fragment vorhersagen. Diese Fragmentgröße war auch bei prozessierten Pseudogenen zu erwarten. Das Ergebnis des Southernblots ergab, daß es sich ausnahmslos um Pseudogene handelte (Ergebnisse nicht gezeigt).

Bei dem zweiten und dritten Bankscreening wurde auf PCR-Techniken zur Gen/Pseudogendifferenzierung zurückgegriffen. Mit verschiedenen Primerkombinationen wurde untersucht, ob sich von der cDNA unterscheidbare Fragmentgrößen amplifizieren ließen. Diese Technik war weniger zeitintensiv als die Untersuchung durch Southernblots, weil Sekundär- und Tertiärscreenings der gefundenen Phagenklone nicht erforderlich waren und keine Phagen-DNA-Präparation notwendig war. Als Ergebnis des zweiten Screenings wurden 20 weitere Pseudogenklone, die nicht weiter analysiert wurden, und ein Klon (lambdaH1) mit intronanalogen Sequenzen identifiziert, der als Kandidat für das Gen in Frage kam. Mit einer Sonde aus einem der mutmaßlichen Introns wurde die Bank ein drittes Mal gescreent und lieferte


46

zwei weitere Klone. Der Klon lambdaH2 enthielt nach Ergebnissen der PCR-Kartierung vermutlich das komplette gesuchte TPT1-Gen und wurde weiter untersucht.

4.2.3. Subklonierung und Kartierung des TPT1-Gens

Da eine direkte Sequenzierung von Lambda-DNA zum Zeitpunkt der Untersuchung technisch nicht möglich war, wurde eine Klonierung von Subfragmenten in einen Plasmid Vektor vorgenommen (pBluscript), der sich mit den verfügbaren Sequenzierungssystemen direkt sequenzieren ließ. Geeignete Fragmente erschlossen sich aus Southernblots, die mit lambdaH2-DNA nach Verdauung mit verschiedenen Restriktionsendonukleasen entstanden ( Abb. 4-9 ).

Abb. 4-9 Subklonierung genomischer Fragmente: (A) Lambdaphagen DNA des Klones lambdaH2 wurde mit unterschiedlichen Restrikionsendonukleasen geschnitten und elektrophoretisch aufgetrennt. Das dazugehörige ethidiumbromid-gefärbte Gel ist invers dargestellt. (B) repräsentiert den Molekulargewichtsmarker. (C) Southernblot des selben Gels nach Hybridisierung mit einer TCTP-kodierenden Sonde. Die Pfeile in den Abb. (A) und (C) markieren die subklonierten Fragmente.

Sowohl das 4 kb große SmaI Fragment als auch das 6.8 kb große EcoRI Fragment erschienen für eine Subklonierung geeignet, da sie die einzigen Hybridisierungssignale der Spaltungen waren. Elektrophoresebilder von EcoRI und SmaI gespaltener lambdaH2-DNA zeigten auch eine gute Zuordenbarkeit der Fragmente ( Abb. 4-9 ), weswegen diese Fragmente weiter subkloniert wurden (Klone lambdaH2-SmaI und lambdaH2-EcoRI).


47

Als nächster Schritt erfolgte eine grobe Kartierung der Klone zur Klärung der Frage, in welcher Orientierung die Fragmente im Vektor integriert waren und welche Teile der Fragmente dem Gen zuzuordnen sind. Darüber hinaus konnten für weitere Subklonierungen geeignete Schnittstellen herausgefunden werden. Wie sich herausstellte, lag ein SmaI Spaltort in einem der Introns, so daß der lambdaH2-SmaI Klon das Gen nur partiell enthielt. Die Analyse des lambdaH2-EcoRI Klones hingegen ergab, daß das etwa 3,8 kb große Gen vollständig in diesem Fragment enthalten war. Stromaufwärts des Gens waren etwa 3 kb und stromabwärts 0,5 kb zusätzliche Sequenzen verfügbar ( Abb. 4-10 ).

Abb. 4-10 Zusammenfassung der Kartierungsexperimente des Klones lambdaH2-EcoRI: Das Fragment enthält das TPT1-Gen vollständig und befindet sich in negativer Orientierung im MCS des Vektors.

4.2.4. Vollständige Sequenzierung des Gens und Aufklärung der Intron-Exon Übergänge

Mit der Umklonierung des etwa 7 kb großen EcoRI Fragmentes aus dem Phagenklon lambdaH2 waren alle Voraussetzungen für eine Sequenzierung gegeben. Das TPT1-Gen präsentierte sich als typisch für Eukaryonten. Ein Vergleich mit der cDNA Sequenz ergab, daß 6 Exons (144 bp, 74 bp, 191 bp, 106 bp, 117 bp, 531 bp) durch 5 Introns (220 bp, 503 bp, 331 bp, 746 bp, 856 bp)., unterbrochen wurden. Die Exonsequenzen stimmten zu 100 % mit der selbst ermittelten cDNA Sequenz überein (siehe Kapitel 4.1). Der Übergang von den exonischen zu den intronischen Sequenzen gehorchte in allen Fällen der gt/ag Regel. Das letzte Exon enthält keine kodierenden Sequenzen, da es mit dem Stopkodon beginnt. Die Organisation der Exons und Introns wird durch Tabelle 4 dargestellt. Zur graphischen Darstellung der Ergebnisse siehe Abb. 4-11 .


48

Tabelle 4 Intron-Exon Übergänge des TPT1-Gens des Kaninchens: Die erste Zeile zeigt die allgemeine Konsensussequenz der Intron/Exonübergänge von vielen Genen ( Alberts et al. 1995 ). Die anderen Zeilen stellen die TCTP Intron/Exonübergänge gegenüber. In allen Fällen beginnen die Introns mit GT und enden mit AG. Diese Positionen sind für den Erkennungsmechanismus der Spleißosomen ausschlaggebend. Alle anderen zum Konsensus gehörenden Positionen sind mehr oder weniger stark konserviert.

  5’Exon

Intronsequenz

3’Exon
Konsensus

  C..
5’--|AG
  A..  

..A          TTTTTTTTTTT C..
GT|AGT-------|||||||||||N|AG
..G          CCCCCCCCCCC T..

G
|--3’
A
Exon1/Intron1/Exon2

GCC

GTGAGT-------TCTGTCCCCGCGCAG

A
Exon2/Intron2/Exon3

AAG

GTGATG-------TTTTTCTTAATGCAG

A
Exon3/Intron3/Exon4

ATC

GTAAGT-------AAAATGTTGTTCCAG

A
Exon4/Intron4/Exon5

CAG

GTAAAC-------TGTTTGTTTCTCAAG

T
Exon5/Intron5/Exon6

TGT

GTAAGT-------TTTTTTTTTCTTCAG

T

Abb. 4-11 Struktur des TPT1-Gens des Kaninchens

Wie sich herausstellte, waren die Sequenzen stromabwärts der 3'UTR1 Sequenz des Gens identisch mit denen vom cDNA-Klon 31/1, der sich von der publizierten cDNA durch eine um 320 bp längere 3'UTR unterschied. Somit kodiert ein Gen für zwei unterschiedliche mRNA-Varianten. Dies läßt sich durch die Annahme unterschiedlicher Polyadenylierungsstellen erklären. Ein zweites Polyadenylierungssignal 24 bp vor dem Ende der alternativen 3'UTR spricht für diese Theorie. Die Frage nach der biologischen Funktion der beiden mRNA-Varianten bleibt damit jedoch weiterhin ungeklärt. Zur Aufklärung der Struktur der 5’ flankierenden Region, die die potentielle Promotorregion enthalten sollte, wurden weitere 1200 bp 5’ jenseits des Transkriptionsinitiationsortes sequenziert. Die vollständige Gen- und Promotorstruktur ist in dem nachfolgenden Sequenzschema dargestellt ( Abb. 4-12 ). Die Sequenz wurde in der EMBL-Datenbank deponiert und unter der Nummer AJ225898 registriert.

Ein auffälliges Strukturmerkmal vieler eukaryontischer Promotoren ist ein AT-reiches Sinal um die Position -30, die sogenannte TATA-Box. Beim Kaninchen TPT1 Promotor fällt sofort das Signal TATAT bei der Position -29 auf, das somit die Charakteristik einer TATA-Box hat. Um weitere charakteristische Sequenzmotive zu entdecken, die potentielle Bindungsregionen für


49

Transkriptionsfaktoren (TF) darstellen, wurde die gesamte Promotorregion einer Computeranalyse unterzogen. Hierzu wurde das MatInspector® Programm und eine Datenbank für TF (Transfac) benutzt. Das Ergebnis dieser Vorhersage ist in die Abb. 4-12 eingegangen (siehe auch Kapitel 5.2 ).

Abb. 4-12 TPT1-Gensequenz des Kaninchens (EMBL-Datenbank AJ225898): Im Promotor wurden Bindungsregionen für Transkriptionsfaktoren mit dem Programm “Matinspektor“ vorhergesagt ( Quandt et al. 1995 ) und unterstrichen dargestellt. Introns sind in Kleinbuchstaben angegeben. In der 3’UTR sind zusätzlich das STOP-Kodon, der Beginn der 3’UTR2 und die Polyadenylierungssignale (AATAAA) durch Unterstreichung hervorgehoben.

-1200 ATAGTATCCAAGCGATACCTATAGCATTTACGGTGTAATTCAATATATTCATTTTGTGGCACGGTGACTGTCTTAAGGCC -1121


-1120 GGCTGGATGTGGCCTCCTGGAAACCAAGAACTTCCCAACTTTTGGGTCTCAGAAAACCATGAGAAAGACCCGCGCAGCCC -1041
        IK2
-1040 GCGACAGGAAAATTCCCACAAACTTAAAGATTTGTTCCTGGCCTACATCTATGCCTTCGAAAAGAAAAGATGCTCCTAGA -961
        IK2
-960  AAGGGCTAAGTCCCTAATAATTGACTTTCCAGCCCTTCAAAGGCTAGCTGGGTTTGGGGGACACTCGCTATTTTGGTTTG -881
        S8        MZF-1
-880  TTTAACCCCCTAGCACCAGGGATAAAATTTCAACGTCATACTAAAGGGACAACATACCCTTTTCTTGCAAACAAAGGCCA -801


-800  CACTTCAATACCAAGTGCAAAACAAAAGGGAAGAGCTCTTTGGCGGTCTGCCACAAACACGACACCCTAAGCTTTCTAAT -721
        SRY        NF-1
-720  TCCGGACCAAACTGAAACAGACGGGAGAGCCGGGCAACCTTCCGCGCCACCTGCTTCCCTCGCGAGGTCCCTTCTCCCAC -641
        MYO-D
-640  ACTGGGCGCCCGCCGCGATTATTCCCCGGGGAGCCGGGCGGGCCGTCCTGGGTCCCCCACCCGGACAAAGGCGCCCGAGA -561
        MZF-1
-560  ACCCCAGACGGGACCGCTGTGGGCAAAGCCGGGAAGTTCTCGGAGAGCACGGGAGTTAGACAAGCACCCAGACGGCGCTG -481


-480  GGTCGCCTCCAGGGGTCAGAGCCCCTCCTTCCGTAAACGCAGGTCCCTCCCTCTGTAGACATGTTCGCTCCCAGAAAAGG -401
        STAT-1
-400  GAGGGAACTTGGGTGGGGCGGAAGCTTGACGAGAGTTCACGTAAGCTGCCCCCAGGCCGCCCCGCAGGGCAGGGTAGGGA -321


-320  GGCGCAGAGCCCTCACTTCTCCCACTCTCCCTAGCCGAGGGCGGAAGACCGCTCATAGAGCCCCCGCCAACCCGCCCCTC -241
        NF-1
-240  CCCATCCCGCACACTCCCGCGTCCCAGCCCTCGCGTACCCGCCGAACACAGACGGCATCGCGGCTCCCAGCCAAGTACCC -161
        MZF-1        NF-1
-160  GGATGTCCGCGTTTGTCCGCCCCGACCAGGCCTAGCCGTGGCCCCGCCCCCGCGCCGCTCTGCGTGCCACGTCACTGCTT -81
         ETS-1        SP-1        CREB/AP-1
-80   GCGGCGCTTCCGGGAGCGCAGCGGACGATGACGTAGAAGGACGTGCCCTCTATATGAGGTTGGGGAGCGGCTGAGTCGGC -1
        ETS-1        CREB/AP-1        -*TBF        MZF-1
   +1 CTTTTCCGCCCGCTCCCCCCTACCCCCGAGGGCCGCTCCGGCTGCACCGCCTCGCTCTGAGCTCCGGGCTCCTGCCAAGC 80  
        MZF-1        NF-1
   81 TAGCGCCGCCGCTGTCGTCTCCTACCAGCCGCCATC ATG ATT ATC TAC CGG GAC CTC ATC AGC C gtgag 149  
    1                                      M   I   I   Y   R   D   L   I   S   H       10   


  150 ttttgactgcactacccccttgtgccgcacacggcttgggtgcgggtgggggcggacgccgccgcgggcccaggcgacgc 229  


  230 cggcggcttttcccgaagcgaggagggtcggtgcctgggacacgcgcccggggaggggcgggggccgcgtgcggcagccg 309  


  310 gcgcgggaaatggcgccgggcgcggtgtgacgggcgcgtctctgtccccgcgcag AC GAT GAG ATG TTC TCC   381  
   11                                                            D   E   M   F   S     15   


  382 GAC ATC TAC AAG ATC CGG GAG ATC GCG GGC GGA CTG TGC CTG GAG GTG GAG GGG AAG gtga 442  
   16 D   I   Y   K   I   R   E   I   A   G   G   L   C   L   E   V   E   G   K        34   


  443 gtcgctcgggccgccgcgcgggggaggcgaggccgggcgggctcgggtttccgccgcaccccctcccgaggttgtgcaat 522  


  523 cctccccgccgcctcctggcggaggagacgctctttccgggcttgggtttttctagaaaagtggaggcggagctgagcct 602  


  603 gtaaataggtccgctgcctcggcgcccatcctcctccctggccgtccgggacaggtctctgctttggcagtgccaagccc 682  


  683 tcggactttggcctttcctgcttctcaacgcgtgagtccacaactggacacctcttccctttgcttgtaaaggactccgt 762  


  763 tttcgttgtagtcaacagacccatgagtgcttgctgagttggatagcaagggtcatgggtgacttctctcccagtgcgcg 842  


  843 cgtggttttccctgagatctaggaacgtttgttgagatgggtggtggagttaggaagtgtttccgcccttcccagcttaa 922  


  923 ctgctttttcttaatgcag ATG GTC AGT AGG ACA GAG GGT AAC ATT GAT GAT TCG CTC ATC GGT  986  
   35                     M   V   S   R   T   E   G   N   I   D   D   S   L   I   G    49   


  987 GGG AAT GCC TCC GCC GAA GGG CCG GAG GGC GAA GGT ACC GAA AGC ACA GTG ATC ACT GGT  1046 
   50 G   N   A   S   A   E   G   P   E   G   E   G   T   E   S   T   V   I   T   G    69   




50

 1047 GTT GAT ATT GTC ATG AAC CAT CAC CTG CAG GAA ACC AGC TTC ACA AAA GAA GCC TAC AAG  1106 
   70 V   D   I   V   M   N   H   H   L   Q   E   T   S   F   T   K   E   A   Y   K    89   


 1107 AAG TAC ATC AAA GAT TAC ATG AAA TC gtaagtggtcccagcaacgcacagctcatgtgtggactcttaaaa 1177 
   90 K   Y   I   K   D   Y   M   K   S                                                98   


 1178 ggatttagggatgggctggcttgagctcctttaacagtagacagacttggtgaaagaccctaggtgggggctttgctttt 1257 


 1258 tgctaccttctgagcaatgtgagcatactggagtagtgctttggaactagtaagcgtgaaattcagaattgtaaatattc 1337 


 1338 acggaagaccctgtctatagcctagtgataactgaatcttcccatgttactttgctcttttcttttgttatggtctgaat 1417 


 1418 ttacttttttttaaaaaataacacgttaaataaaatgttgttccag A ATC AAA GGC AAA CTT GAA GAA CAG 1488 
   99                                                  I   K   G   K   L   E   E   Q   106  


 1489 AGA CCA GAG AGA GTA AAA CCT TTT ATG ACA GGG GCT GCA GAA CAA ATC AAG CAC ATC CTT  1548 
  107 R   P   E   R   V   K   P   F   M   T   G   A   A   E   Q   I   K   H   I   L    126  


 1549 GCT AAT TTC AAA AAC TAC CAG gtaaacatcttgaaatattgggatcgaataatttatggttttaactgcaaga 1621 
  127 A   N   F   K   N   Y   Q                                                        133  


 1622 acaaaaaatgacttcattgatctgtaacagcgaagttgtggctttgagctggttaaatttagcttcataggatcagggag 1701 


 1702 cagcagtccatctgtgctttgtcttcagatcccatctactgattgaaaagcctaccaccacccaccttgctttgttttcc 1781 


 1782 cagattacatttctcttggattgcttcctaacctcttaagtcttccaacttttctctttacagttccattgtgttggtac 1861 


 1862 tttttttttctttttaaacttaagtgacttccctctactttcattaaaaaaaaaaaaaccacaggggctcttaatttccc 1941 


 1942 agctgtcatacatctattggctgtgagatagtttccctatgtgataatactttgttgtcagtattgtgttccctgtgttt 2021 


 2022 ggttatgtcaattggcttgtaggttttggaattgtgcatgtagggctgagaaagtagatttccagaaatgctaaagtgtt 2101 


 2102 tttgttgctctgtactcttactgtggtcagcatttgtgctttagtcaagtgaacagatgtttgtgattaatgagcatttc 2181 


 2182 taggcatcagcttctggttgcaaaaatttgattttgtagtattctgaatcatcctttgttgcgttgtagtttattggata 2261 


 2262 ggatacatgtttgtatgcagtggtctaattctgggtacttgtttgtttctcaag TTC TAT ATT GGT GAA AAC   2333 
  134                                                        F   Y   I   G   E   N     139  


 2334 ATG AAT CCA GAT GGC ATG GTT GCT CTG CTG GAC TAC CGT GAG GAT GGT GTG ACC CCG TTT  2393 
  140 M   N   P   D   G   M   V   A   L   L   D   Y   R   E   D   G   V   T   P   F    159  


 2394 ATG ATT TTC TTT AAG GAT GGT TTA GAG ATG GAA AAA TGT gtaagtatgaggaagtgggttgggatta 2460 
  160 M   I   F   F   K   D   G   L   E   M   E   K   C                                172  


 2461 aatgatataaaaatggagttactttgggtgtgagtctcactgtctaatgccacagagatggttgccatagattctacagt 2540 


 2541 tttctctttaaaatgtgatccattttcttctggggtgggctctaaaaaagatgatgttcacatgtaaaagataacagtat 2620 


 2621 ttaaaagggcttagaatcttgattctctaggaagtttagtgtatgaggcattccgcaatttaacagctggtgagcagaga 2700 


 2701 agcctctacgttgatcttcccatagataatggcctcattctcattctatgctcaccctttgccatgcctgggtgagtctc 2780 


 2781 aagtctttcaccttggtagctaatcattgaaaacttttaggagattgttagcttttagtaaatacagttggagctgactg 2860 


 2861 ttgaactgataggcaaattgcattagtaaacacagggcactgtttaaagctgtacagaaacaaaagcattctttgtcctg 2940 


 2941 gatttcaggagacttaaagctgtgttaaacaagattagggcaagatgacttgccaaagggaaggttattcagatagtaac 3020 


 3021 cggagtttttgttggtagaacgcggtgtgagtgggacttgggaacttctctggaaaatgttacctctgctttggtgagga 3100 


 3101 tgttctgcatccactgatagaccttgaacagtctgctgttgttcttttggtttgcaataggatgccaaaggaaaatccct 3180 


 3181 gcgtttctgtctgtctttgtggcagcccagattgaattgggggatacatttgtagcctagaaatgttgcttggagagtgt 3260 


 3261 tgaagtaattttttttttttttcttcag TAA CAAAGTTGGCAATTTGGATCTATCACTGCTCATCGTAACTGGCTGCT 3338 
  173        STOP        173  
 3339 GCTTGTCATCCACACAACACCAGGATTTACAGGAAGTGGGACTGATGTTATGTTGAGCTCCTCACTTATTTTGACCATGA 3418 


 3419 TTTACTTCAAGTGGAGGCATTGTTTTTAAGGCAAAAAACATTGTCATGTAGGTTGTCTAAAAATAAAATGCATTTAAATT 3498 


 3499 CATTTGAGAGAATGCCTATTAGTTTAATGTACATTTAAGCTAAATCCATCCTGTAGTGTTTCCTGGAGAAGCTAAAGCCT 3578 
       uarr Beginn der 3’UTR2
 3579 GGTTTGTAGACACTACTAGAAAGCATAAGACTGTCTTCAGATAACTTCTACAGTGAAAACTGCTGGGACTGGAATATAAA 3658 

51

 3659 CTGAGAATCCAAAGTTAAATTCTGAATTACAGTAAAGGGAAAAACCATGCTCATAGCAGTGCCAACATTTGAAGTGGAGC 3738 


 3739 CTTAACACATTTCATCACCTACAACGGAAGTAGCTAACTGGAAGAGATTACCAAAAGAATAAAGAGAGACTGATTGAGTT 3818 


 3819 G                                                                                3819





4.2.5. Genomische Southernblots mit intron- und exonkodierenden Sonden

Mit der Sequenzierung des Gens waren alle intronischen Sequenzen bekannt. Mit Hilfe markierter Intronsonden sollte nun gezeigt werden, ob die Komplexität der genomischen Southernblots ausschließlich auf Pseudogensequenzen zurückzuführen waren. Dazu wurden genomische Southernblots mit kodierenden Sonden und Sonden aus intronischen Bereichen hybridisiert ( Abb. 4-13 ).

Der Vergleich der autoradiographischen Bilder zeigte in der Tat eine Reduzierung des Bandenmusters auf einzelne vollständig aus der Struktur eines unikalen TPT1-Gens vorhersagbare Banden. Insbesondere die SacI Spaltung war hinsichtlich der Interpretation der Signale gut geeignet, da es unter den ausgewählten Enzymen das einzige war, das im Gen zweimal spaltete ( Abb. 4-14 ).


52

Abb. 4-13 Vergleich der genomischen Southernblotmuster nach Hybridisierung mit einer exon - und einer intronspezifischen TPT1-Sonde: Die Komplexität der Bandenmuster im exonspezifischen Blot reduziert sich auf einzelne vorhersagbaren Banden im intronspezifischen Blot. Diese Gegenüberstellung legt den zwingenden Schluß nahe, daß die genomische Komplexität der Southernblots allein durch die zahlreichen gefundenen Pseudogene verantwortet wird. Die Pseudogene akkumulieren innerhalb der mit dem Pfeil markierten Bande nach SacI Spaltung.

Abb. 4-14 Gegenüberstellung von TPT1-Gen und TPT1-Pseudogenen hinsichtlich der Lage der verwendeten Sonden und Restriktionsendonukleasen im Southernblot der Abb. 4-13 : Am aussagekräftigsten ist die Spaltung mit SacI. Während im Gen ein Fragment der Größe 3 kb entsteht, liegt die Fragmentgröße bei prozessierten Pseudogenen im Bereich der homologen cDNA, d.h. 0,68 kb. Dieses Fragment akkumuliert bei allen Pseudogenen gleichermaßen und erzeugt die charakteristische starke Bande im kodierend-spezifischen Blot. Alle anderen Schnittorte lassen nur im Falle des Gens bei den Enzymen XbaI, HindIII und KpnI eine Zuordnung erkennen, da Spaltorte in der unbekannten Genumgebung eine Rolle spielen.


53

4.3. Funktionelle Analyse der Promotorregion des TPT1-Gens des Kaninchens

Eines der Ziele dieser Arbeit bestand in der Analyse der regulativen Sequenzen, die für die Expressionssteuerung auf der Ebene der Transkription verantwortlich sind. In den meisten Fällen sind dafür die stromaufwärts der 5'UTR gelegenen Sequenzen zuständig. In diesem etwa 500 bis 1000 bp langen Sequenzabschnitt befinden sich die modular aufgebauten Bindungsstellen für ausgewählte TF, deren Anwesenheit die Ansammlung allgemeiner TF an der TATA-Box beschleunigen oder verlangsamen bzw. inhibieren. In einigen Fällen befinden sich diese als Enhancer oder Silencer bezeichneten DNA-Sequenzen auch weiter stromaufwärts vom Transkriptionsstartpunkt entfernt, bzw. in einem der Introns oder auch stromabwärts des Gens (siehe Kap. 2.3.4 ).

Ausgehend von der wahrscheinlichsten Konstellation, daß die Regulation des TPT1-Gens innerhalb von 1 kb der stromaufwärts des Transkriptionsstartpunktes gelegenen Sequenzen stattfindet, sollte dieser Bereich funktionell näher untersuchen werden.

4.3.1. Klonierung von CAT-Reportergenkonstrukten aus Teilen des Promotors

Ein weit verbreitetes Modell zur Untersuchung der Promotoraktivität eines Sequenzbereiches ist seine Beurteilung mit Hilfe von CAT-Assays. Hierbei wird das Gen, der in Eukaryontenzellen nicht vorkommenden Chloramphenicoltransferase (CAT) als Reportergen benutzt. Man koppelt den zu untersuchenden Promotor an das promotorlose cat-Gen und transfiziert damit eine neoplastisch transformierte Zellinie. Nur wenn der Promotor über Verstärkerelemente verfügt, kommt es in den transfizierten Zellen zur Synthese des CAT-Enzyms, dessen Aktivität quantifiziert werden kann und direkte Aussagen zur Stärke des Promotors zuläßt.

Ziel war es, eine Serie von CAT-Reportergenkonstrukten mit Teilen des Promotors verschiedener Länge zu klonieren, mit diesen Konstrukten eine Kaninchenzellinie zu transfizieren und die Promotoraktivitäten untereinander zu vergleichen. Ausgangspunkt der Klonierungen war die Sequenz des Promotors, der auf eine Länge von 1,2 kb sequenziert wurde. Jetzt war es möglich, geeignete Restriktionsenzyme auszusuchen, deren Schnittstellen Fragmente der gewünschten Länge erzeugen ( Abb. 4-15 ).


54

Abb. 4-15 Fragmentierung der TPT1-Gen-Kontrollregion: Durch Auswahl verschiedener Restriktionsendonukleasen konnte der Bereich des Promotors in Bereiche unterteilt werden. Alle Fragmente (A-E) beginnen an der Position +80, die sich innerhalb der 5' UTR des Gens befindet. Die 5 stromaufwärts gelegenen Spaltstellen decken den Bereich von -66 bis -918 ab.

Als Vektor für die Transfektionsexperimente diente das Plasmid pBLCAT3 (Luckow und Schütz 1987). Dieses Plasmid kodiert für ein cat-Gen, dem ein Multiklonierort (MCS) unmittelbar vorangestellt ist. Nach Einbau der Promotorfragmente A-E ( Abb. 4-15 ) in den MCS standen fünf Konstrukte zur Testung der Promotorstärke zur Verfügung.

Um zu überprüfen, ob der Einbau der Fragmente in den Vektor erfolgreich war, diente ein PCR-System. Zwei Primer flankieren hierbei den MCS des Vektors. Nach erfolgter Amplifikation gab die Länge des Amplifikats direkten Aufschluß über die Insertgröße und damit den Erfolg der Klonierung ( Abb. 4-16 ).

Abb. 4-16 PCR-Screening auf Fusions-Konstrukte von TPT1-Promotor-Fragmenten mit dem cat-Gen: Die Bahnen A-E entsprechen den Fragmenten aus Abb. 4-15 . Dargestellt sind die PCR-Produkte, die nach Amplifikation des MCS des Vektors pBLCAT3 inklusive Insert entstanden. Die erste Bahn repräsentiert den MCS ohne Insert.


55

4.3.2. Transfektion von glatten Kaninchenmuskelzellen (SMC) mit TPT1-Promotorgenkonstrukten

Nachdem die Konstrukte vorlagen, war der nächste Schritt ihre Analyse durch Zelltransfektionsexperimente in einer geeigneten Zellinie. Gute Voraussetzungen für eine effektive Transfektion sollten Zellen aus Geweben mit einer hohen TPT1 Expression haben ( Abb. 4-6 .). Dafür kamen Zellen eines Rhabdomyoms des Kaninchens (SMC=smooth muscle cell) in Frage. In einem Verfahren, auf das im Kapitel Methoden näher eingegangen wird, wurden die mit Hilfe der CAT-Reaktion hergestellten radioaktiv 14C-markierten Acetylierungsprodukte des Chroramphenicols aus den Zellen angereichert und dünnschichtchromatographisch aufgetrennt und quantifiziert. Die natürliche Funktion der Chroramphenicol-Acetylierung durch CAT in Bakterien besteht in der Vermittlung einer Resistenz gegenüber dem Antibiotikum durch diese Modifizierung. Es existieren drei Acetylierungsstellen auf dem Molekül, und jede dieser Isoformen kann durch die Dünnschichtchromatographie voneinander getrennt werden. Nach der Trennung fertigt man autoradiographische Aufnahmen an. Die Stärke der Summe aller acetylierten Chloramphenicolsignale ist direkt proportional zur Enzymaktivität und damit zur Promotorstärke. Genau quantifizierbar werden die Signale durch Ausschneiden der markierten Acetylierungsflecke aus der Dünnschichtfolie und Bestimmen der Radioaktivität mit einem Flüssigkeitsszintillationszähler. Dieses Verfahren wurde 3-4 mal mit jedem der CAT-Konstrukte wiederholt. In Abb. 4-17 ist beispielhaft eine autoradiographische Aufnahme eines CAT-Assays dargestellt.


56

Abb. 4-17 Dünnschichtchromatographische CAT-Analyse aller untersuchter TPT1-Promotorkonstrukte: Neben einer Positiv- (pBLCAT2) und einer Negativkontrolle (pBLCAT3) sind die Aktivitäten aller Promotorkonstrukte aufgetragen. Die Schwärzungen entsprechen unterschiedlich oft acetyliertem Chloramphenicol. Die Summe aller acetylierten Signale ist der CAT-Aktivität und damit der Promotorstärke äquivalent.

Parallel dazu wurden alle Transfektionsansätze mit dem Plasmid pSVbeta-Gal transfiziert. Dieses enthält ein beta-Galaktosidasegen in Verbindung mit einem starken viralen Promotor (CMV=Cytomegalievirus). Die Aktivität dieses Enzymes kann wiederum gemessen werden. Dies ist notwendig, da die Transfektionseffizienz gewissen Schwankungen unterworfen ist. Mit Hilfe der beta-Galaktosidaseaktivität wird jeder CAT-Assay kalibriert und dieser Fehler dadurch eliminiert. Um die Ergebnisse statistisch zu sichern, wurden alle Assays 3-4 mal wiederholt und der Mittelwert gebildet. Als Positivkontrolle kam der Vektor pBLCAT2 zur Anwendung, der die CAT in Verbindung mit dem starken Thymidinkinasepromotor des Herpes-Simplex-Virus exprimiert. Alle Werte beziehen sich auf diese CAT-Aktivität, die als 100% definiert wird. Als Negativkontrolle diente der Vektor pBLCAT3 (cat-Gen ohne Promotor).

Aus allen Daten resultierte eine Aussage über die Promotorstärke der verschiedenen CAT-Konstrukte im Vergleich mit einem bekannten starken viralen Promotor ( Abb. 4-18 ).


57

Abb. 4-18 Die Promotor-Stärke verschieden langer TPT1-Gen-Promotorbereiche im Vergleich mit einem starken viralen Promotor (pBLCAT2) ausgedrückt als relative CAT-Aktivitäten: Als Negativkontrolle fungierte das Plasmid pBLCAT3, das den Ausgangsvektor ohne Insert, d.h. ohne Promotor, repräsentiert. Die Zuordnung der Promotorfragmente zu den anderen Konstrukten erschließt sich aus Abb. 4-15

Wie man deutlich erkennen kann, ist der TPT1-Promotor durch eine starke Aktivität gekennzeichnet. Schon im Bereich von -66 bis -166 zeigte sich eine Aktivität von etwa 20-25% der Positivkontrolle. Das nächst längere Fragment bei -379 bp zeigt dann einen sprunghaften Anstieg der Aktivität bis zu 90-95% des viralen Promotors. Dieser Wert fällt bei den noch längeren Konstrukten wieder leicht auf Werte zwischen 75 und 80% ab. Eine Diskussion und Interpretation dieser Daten findet im Kapitel 5.2 statt.

4.3.3. Transfektion einer humanen Zellinie mit dem CAT-Konstrukt -918/+80

Parallel zu den Versuchen mit einer Kaninchenzellinie bot sich die Möglichkeit an, humane K562 Zellen (eine hämatopoetische Erythroleukämiezellinie) zu verwenden. Es wurde hier jedoch nur eines der CAT-Reportergenkonstrukte getestet. Es handelte sich um das 997 bp große Fragment aus dem Promotor des TPT1-Gens. Erstaunlicherweise war auch in menschlichen Zellen eine Aktivität von etwa 40 % der Kontrolle meßbar (Ergebnisse nicht gezeigt). Dieses Ergebnis deutet darauf hin, daß sowohl die an der Transkriptionregulation beteiligten TF als auch die DNA-Bindungsstellen im Verlaufe der Evolution konserviert sein müssen. Ein Vergleich der TPT1-Genkontrollregion verschiedener Spezies könnte so wertvolle Hinweise auf konservierte Bereiche und mögliche TF liefern.


58

4.3.4. Analyse der CpG-Inseln des TPT1-Gens

Unter CpG-Inseln versteht man die statistisch signifikante Häufung von CG-reichen Sequenzen in der unmittelbaren Umgebung des Transkriptionsstartpunktes aktiver Gene. Wie es zu dieser Anhäufung kam, steht wahrscheinlich mit der vermuteten Funktion der DNA-Methylierung in Zusammenhang. Vertebraten besitzen spezifische Enzyme zur Methylierung von CG-Sequenzen. Die Funktion dieser Modifikation scheint in der entgültigen Stillegung transkriptionell inaktiver genomischer Bereiche zu liegen. Möglicherweise ist dies das Ergebnis einer alternativen Chromatinstruktur ( Tazi und Bird 1990 ) oder von spezifischen Proteinen, die methylierte CG-Sequenzen erkennen, binden und transkriptionell inaktivieren ( Tate und Bird 1993 , Nan et al. 1998).

Da methylierte CpG-Sequenzen durch ineffektivere Reparaturmechanismen desaminierter 5-Methyl-C dazu tendieren, im Laufe der Evolution zu mutieren, blieben diese Sequenzen in Bereichen aktiver Transkription, die unmethyliert bleiben, in Form von CpG-Inseln erhalten. CpG-Inseln hat man bislang in der Umgebung aller Haushaltsgene und vieler gewebsspezifischer Gene gefunden. Sie scheinen ein Merkmal transkriptionell aktiver Gene zu sein. Für die Genomforschung sind CpG Inseln sehr interessant, da sie Hinweise auf mögliche Gene in uncharakterisierten genomischen Sequenzen geben, wie sie z.B. in großer Menge beim humanen Genomprojekt anfallen. Man schätzt, daß etwa 56% der Humangene mit einer CpG Insel assoziiert sind und etwa 45000 CpG Inseln insgesamt existieren ( Brown 1999 ).

Eine interessante Frage war nun, ob das Gen des TCTP ebenfalls eine Häufung von CG-reichen Sequenzen besitzt, was ein weiteres Argument dafür liefern würde, daß wirklich das aktive TPT1-Gen isoliert worden war. Eine einfache Sequenzuntersuchung bestätigte dies. Die graphische Darstellung des Gens und seiner Umgebung zeigt, daß sich im Bereich des Transkriptionsstartpunktes eine CpG-Insel befindet ( Abb. 4-19 ).

Abb. 4-19 CpG-Insel im Bereich des TPT1-Gens: Alle CG-Sequenzen innerhalb des TPT1-Gens und des flankierenden stromaufwärts gelegenen Bereiches sind als senkrechte Striche dargestellt. Der Transkriptionsstart befindet sich an der Position +1 bp. Man erkennt eine Häufung von CG-Sequenzen in diesem Bereich.


59

4.3.5. Mögliche TF-Bindungsstellen im TPT1-Promotor des Kaninchens

Nachdem die Kaninchen-Promotorsequenz bekannt war, konnte nach Bindungsstellen für in Frage kommende TF gesucht werden. Dazu wurde die TF-Datenbank Transfac® (http://transfac.gbf.de) unter Zuhilfenahme des Programmes MatInspector ( Quandt et al. 1995 ) benutzt. Berücksichtigt man nur diejenigen Faktoren, deren Kernbindungsmotiv zu 100% und deren flankierende Bindungsbereiche zu mehr als 95% zum gefundenen Konsensusmotiv homolog sind, so befinden sich im kleinsten CAT-Konstrukt Bindungsmotive für die TF NF-1, MZF-1 (2x) und CREB/AP-1. Das nächst größere Fragment (-166/+80) hat Bindungsmotive für ETS-1 (2x), AP-1/CREB und SP-1. Im Fragment -279/+80 finden sich Bindungsstellen für NF-1 (2x) und MZF-1. Weiter stromabwärts existieren cis-Motive für STAT-1, MYO-D, NF-1, SRY, S8 und IK2. Die Diskussion dieser Faktoren findet im Kap. 5.2 statt.

4.4. Aufklärung der Struktur des humanen TPT1-Gens

1996 kam es zur Veröffentlichung von Teilen der humanen TPT1-Genstruktur ( Bonaldo et al. 1996 ). Die publizierte Sequenz bestand aus den Exons 2-7 einschließlich kurzer Intron/Exon Übergänge. Promotor und Exon 1 fehlten vollständig und lediglich vom kurzen Intron 3 war eine vollständige Sequenz vorhanden. Die Gensequenz war ein Teilergebnis des Versuches, Chromosom-13 spezifische Gene zu finden. Die Ergebnisse dieser Arbeit fielen zeitlich mit den Bemühungen unserer Gruppe zusammen, zusätzlich zum Kaninchengen das humane TPT1-Gen zu klonieren. Wegen der Unvollständigkeit der publizierten Sequenz, insbesondere des fehlenden Promotors, entschlossen wir uns somit zur Aufklärung der fehlenden Teile.

Als Vorgehensweise zur Klonierung des Humangens boten sich Alternativen zur Herangehensweise der Klonierung des Kaninchengens an. Diese bestanden in der Benutzung einer kommerzieller P1-Bank. (Gene Discovery Array von Genome Systems Inc.). Ein Satz an Nylonfiltern repräsentiert das Genom 2-3 mal. Jeder Spot ist einem definierten Klon zugeordnet und kann nach Identifizierung bestellt werden. Die Hybridisierung der Bank mit kodierenden Sonden hätte sich wegen der sich abzeichnenden Situation der Existenz multipler Pseudogene jedoch fatal ausgewirkt. Analog zum Kaninchen wären eine große Zahl von Klonen zu untersuchen gewesen. Deshalb wurde der Versuch unternommen, zuerst intronische Sequenzen mittels genomischer PCR zu amplifizieren, um dann eine intronische Sequenz als Sonde zu


60

benutzen. Beim Kaninchen hatte der Versuch mittels PCR derartige Sequenzen zu klonieren immer zu Pseudogenamplifikaten geführt, wahrscheinlich zurückzuführen auf die ausgeprägt hohen Homologien einiger Pseudogene zum Gen. Beim Menschen, warum auch immer, führte diese Strategie jedoch zum Erfolg. Mit Hilfe der speziesübergreifenden Primerkombination LX2h4/HMO-TAP-R1 konnte ein genomisches Fragment gewonnen und kloniert werden (Berger, unveröffentlicht). Aus diesem Fragment erschlossen sich Teilsequenzen aus den Introns 3 und 4. Mit Hilfe eines Intron 4 spezifischen Primerpaares (hP23I4H/hP23I4R) konnte ein 290 bp langes Amplifikat aus Intron 4 generiert und als Sonde zur Hybridisierung der P1-Bank eingesetzt werden. Das Screening der P1-Bank wurde von Dr. Carola Marczinek in Kooperation mit der Arbeitsgruppe von Dr. Peter Nürnberg durchgeführt und führte zu zwei Signalen im Autoradiogramm. Beide Klone wurden bestellt und weiter analysiert. Der Klon 231/E12 enthielt nach Ergebnissen der PCR-Kartierung das gesuchte humane TPT1-Gen. Geeignete Restriktionsfragmente wurden dann subkloniert und vollständig sequenziert.

Die vorläufigen Sequenzdaten bedürfen noch der weiteren Verifizierung. Aus diesem Grund erfolgte noch kein Datenbankeintrag, und auf die vollständige Darstellung der Sequenz wurde im Rahmen dieser Arbeit verzichtet. Die wesentlichen Aspekte der Struktur des Human-TPT1-Gens gehen jedoch aus Abb. 4-20 , Abb. 5-1 , Abb. 5-3 und Tabelle 6 hervor. Das Humangen ist mit 4269 bp um 450 bp länger als das Kaninchengen. Die Differenz geht überwiegend auf unterschiedliche Längen der Introns zurück. Den größten Beitrag hierzu liefert das humane Intron 5, das mit 1220 bp um 364 bp länger als das entsprechende Kaninchenintron ist. Wie schon erwähnt, ist die Struktur der Exons und Introns absolut konserviert. Die Längen der Exons 2 bis 5 stimmen mit 74 bp, 191 bp, 106 bp und 117 bp mit dem Kaninchengen überein. Längendifferenzen des ersten (142 bp) und letzten (517 bp) Exons gehen auf Unterschiede der UTRs zurück. Die Längen der Introns 1 bis 5 betragen 255 bp, 525 bp, 391 bp, 721 bp und 1220 bp. Die weitere Diskussion von Unterschieden beider Gene findet im Kap. 5.1 statt.

Insgesamt war es möglich, 500 bp des humanen TPT1-Promotors zu sequenzieren. Analog zur Vorgehensweise beim Kaninchen wurden diese Sequenzen auf Bindungsstellen für TF abgesucht (Kap. 4.3.5 ). Die Sequenz des Human-TPT1-Promotors und die Positionen möglicherweise involvierter TF zeigt Abb. 4-20 .


61

Abb. 4-20 Sequenz des Human-TPT1-Promotors und die Positionen potentieller TF-Bindungsstellen



 -500                                                            AGATCTACCCCAGGCCAGAGG -481  


 -480 GCCTGACCCTCCCTAAATGCGACGTTCTCCTACCTTGGTTGATACTCACGTTCCCAGAAAAGGGTGGAACCTAGGCTGGA -401  
        STAT-1
 -400 CGAGGCGCAGGGCCAAAGTTTAATTCCTCTAAGCTCCACCCAGCTCCCAGCACCTCTCCAGGCGGCCCCGTGGGGTAGGG -321  
        TST-1        CP-2
 -320 CGGAGCCGGGTCAAACGTACTCCGCTTCCCCCGCTCCACCCACCCAGGGCTAGGGAGCGCCCCGAGAGTTGGCCTCCCTC -241  
        MZF-1
 -240 CCCACTGGGGGCGCACCTCCCCGCCCCCACCCCTACCCGCTGGCGTACCCAGTGGAACGGAGCCTTGTGTCTCCGCCTCA -161  
        MZF-1        SP-1
 -160 AGTCCCCGGATGCTCACCTCCCCGACTCGCCCCCGCTGTGGCCCCGCCCCCGCGCGGCTCTTCGTGCCACGTCACCGCCT -81   
        ETS-1        MZF-1        SP-1        CREB/AP-1
  -80 GCGTCGCTTCCGGAGGCGCAGCGGGCGATGACGTCACGGGACGTGCCCTCTATATGAGGTTGGGGAGCGGCTGAGTCGGC -1 
        ETS-1        CREB/AP-1        TBF        MZF-1

Der direkte Vergleich der Promotoren der Spezies Mensch und Kaninchen lieferte wichtige Anhaltspunkte für konservierte TF-Bindungsstellen. Näheres hierzu im Kap. 5.2.2 .

4.5. Analyse von 13 TPT1-Pseudogenklonen

4.5.1. Subklonierung von genomischen Fragmenten

Im Kapitel 4.2.1 wurde darauf eingegangen, daß genomische Southernblots mit TCTP-kodierenden Sonden sehr komplex erschienen und die Vermutung geäußert, daß es sich dabei um Pseudogene handeln könnte. Eine endgültige Bestätigung konnten jedoch nur Sequenzierungen liefern. Dazu mußten die 13 isolierten TPT1 positiven Lambdaklone subkloniert werden. Eine Auswahl von Fragmenten erschloß sich aus Southernblots mit gereinigter Lambda-DNA. Insbesondere die EcoRI Fragmente vieler Lambdaklone waren auf Grund ihrer günstigen Größe für Subklonierungen geeignet ( Abb. 4-21 ).


62

Abb. 4-21 Subklonierung von genomischen TPT1-Pseudogenfragmenten: Auf dem Bild ist ein EcoRI gespaltener Southernblot von 13 isolierten TPT1 positiven Lambdaklonen zu sehen (lambda1-lambda13). Die mit Pfeil markierten Banden wurden isoliert und in den Vektor pBLSK+ subkloniert.

Von sechs der 13 dargestellten Lambdaklone wurden EcoRI Fragmente subkloniert. Damit waren die Voraussetzungen für eine Sequenzierung gegeben.

4.5.2. Sequenzierung und Analyse der Pseudogene

Die sechs subklonierten genomischen EcoRI Fragmente, die nach der Restriktionsenzymkartierung TCTP-cDNA ähnliche Sequenzen enthielten, wurden vollständig sequenziert. Die Sequenzen bestätigten alle vorläufige Daten, daß es sich bei den gefundenen Klonen um Pseudogene handelte. Alle untersuchten sechs Pseudogene gehörten zur Gruppe der prozessierten Pseudogene, d.h. sie wiesen die typischen Merkmale wie Sequenzhomologie zum Gen, Intronlosigkeit, kurze Poly(A)-Sequenzen, multiple Mutationen und Zielsequenzduplikationen (ZSD) auf. Die sechs Pseudogene ließen sich auf vier Varianten reduzieren. Unter der Bezeichnungen TPT1-ps1, TPT1-ps2, TPT1-ps3 und TPT1-ps4 werden sie in dieser Arbeit und in den EMBL-Datenbankeinträgen AJ131952, AJ131953, AJ131954 und AJ131955 geführt.


63

Abb. 4-22 Vergleichende Betrachtung aller sequenzierten TPT1-Pseudogene: Die Pseudogene lambda2, lambda7 und lambda13 (TPT1-ps1) sind bis auf ein zusätzliches, wahrscheinlich artifizielles A in der Poly(A)-Region von Pseudogen lambda13, identisch. Zusammen mit Klon lambda9 (TPT1-ps2) repräsentieren sie Abkömmlinge der kurzen TCTP-mRNA1. Im Gegensatz dazu haben die Pseudogene lambda1 (TPT1-ps3) und lambda12 (TPT1-ps4) eine verlängerte 3'UTR2 und spiegeln die Verhältnisse der TCTP-mRNA2 wider. Einige identische Mutationen kommen in verschiedenen Pseudogenen vor, was auf evolutionär getrennte Entwicklungen des Gens und der Pseudogene hindeutet. Die Mutationsrate ist in allen Pseudogenen kleiner als 2% und führt in keinem Fall zu einer Zerstörungen des Leserahmens.

Eine graphische Darstellung aller Pseudogene im Vergleich mit den cDNAs sowie die Position der Mutationen zeigt Abb. 4-22 . Die Pseudogene der Klone lambda2-EcoRI, lambda7-EcoRI und lambda13-EcoRI stellten sich als nahezu identisch heraus (siehe Legende zu Abb. 4-22 ), wie auch schon durch die homologen Southernblot-Muster zu vermuten gewesen war. Bei den Klonen lambda1-EcoRI und lambda12-EcoRI handelte es offenbar um Abkömmlinge der langen TCTP-mRNA2, wie aus der


64

Existenz von 3'UTR2 Sequenzen ersichtlich wurde. Alle anderen Klone stammten von der kurzen mRNA-Variante ab. Unabhängige Untersuchungen der nicht weiter subklonierten Pseudogenklone durch PCR ergaben, daß auch sie den kurzen Messenger repräsentierten. Geht man davon aus, daß Pseudogene die zytoplasmatischen Konzentrationen der vorhandenen mRNAs widerspiegeln, so findet diese Annahme im Falle der TCTP-Messenger seine Bestätigung in dem Verhältnis der kurzen zu den langen Pseudogenen - im konkreten Fall ca. 10:1. Dies korreliert mit den Ergebnissen der Northernblots, die ähnliche Verhältnisse in vivo zeigen.

Eine Besonderheit aller sequenzierten Pseudogene lag in der Intaktheit des Leserahmens und der insgesamt hohen Homologie zur cDNA von über 98%. Die große Mehrheit aller in der Literatur beschriebenen Pseudogene ist durch weitaus zahlreichere Mutationen gekennzeichnet. Diese zerstören in der Regel den Leserahmen oder führen zu schwerwiegenden Aminosäureaustauschen in der kodierenden Region. Daß dies in den untersuchten TPT1-Pseudogenen nicht der Fall war führte zu der Diskussion, ob die Pseudogene unter funktionellem Erhaltungsdruck standen (Kap. 4.5.3 ).

Ebenfalls interessant ist die Tatsache, daß einige identische Mutationen bei verschiedenen Pseudogenen gefunden wurden. Dazu zählt die G-Insertion an Position 51 der homologen cDNA. Sie findet sich bei dem Pseudogen TPT1-ps1 (stellvertretend für die Klone lambda2, lambda7 und lambda13), TPT1-ps2 und TPT1-ps4. Das Pseudogen TPT1-ps3 hat an der gleichen Stelle eine andere Mutation. Ähnlich sieht es mit dem Austausch G nach C an der Position 734 der mRNA aus, die in allen Pseudogenen, außer TPT1-ps4, vorkommt. Die Pseudogene TPT1-ps3 und TPT1-ps4 teilen sich wiederum eine Reihe gemeinsamer Mutationen, die sich vor allem in der 3'UTR2 Sequenz häufen.


65

4.5.3. Untersuchung der flankierenden Bereiche der Pseudogene

Im Kapitel 2.4 wurde besprochen, auf welchem Wege es zur Bildung von prozessierten Pseudogenen kommen könnte. Ein gemeinsames Merkmal aller Modelle ist eine Erklärung für die 5-20 bp lange Sequenz, die sich unmittelbar stromauf - und stromabwärts des Pseudogens dupliziert. Man vermutet, daß der Mechanismus des Einbaues zu dieser sogenannten Zielsequenzduplikation (ZSD) führt. Um dieses Merkmal auch bei den TCTP-Pseudogenen nachzuweisen, wurden die flankierenden Bereich sequenziert ( Tabelle 5 ).

Wie die Tabelle zeigt, haben alle untersuchten Pseudogene als ZSD anzusprechende Elemente in den flankierenden Bereichen. Die beiden Pseudogene TPT1-ps1 und TPT1-ps2 haben vollständig der Regel entsprechende Duplikaturen von 16 bzw 10 Nukleotiden, wobei in der ZSD für ps1 eine Mutation vorkommt. Das Pseudogen TPT1-ps3 hat insofern keine typische ZSD, da sich unmittelbar im Anschluß an die 5’UTR keine derartige Sequenz findet, jedoch ist ein Äquivalent circa 100 bp stromaufwärts (gaaattat) vorhanden. Da auch der Anfang der Pseudogensequenz fehlt, könnte eine Insertionssmutation die Verschiebung erklären. Das Pseudogen TPT1-ps4 ist auch kein typischer Vertreter für ZSD. Auffällig ist aber die sowohl 5’UTR- als auch 3’UTR-seitig anzutreffende Sequenz des Typs (g(a)n)n. Sie ließe sich durchaus als ZSD interpretieren, auch wenn die genauen Dimensionen nicht anzugeben sind. Die Tatsache, daß die Base Adenin 5’UTR-seitig des Motivs g(a)n 4 mal wiederholt wird, 3’UTR-seitig jedoch 5 mal, ist schwer erklärbar. Möglicherweise spielen nachträgliche Mutationen hierbei eine Rolle.

Tabelle 5 Zielsequenzduplikationen in den flankierenden Bereichen von vier TPT1-Pseudogenen.

Pseudogene

5’ flankierende Region

3’ flankierende Region

TPT1-ps1

....atttaaaatccatagccctgCtttt---CCG...

...AAATTC(a)12taaaatccatagccctttt...

TPT1-ps2

....aaactctcttcttCTTTT---CCG...

...AAATT-(a)16ctctgttctttta...

TPT1-ps3

...aatgaaattatcca(n)91aaa........ccg...

...gagttgaaagc(a)28gaagaagaaattattata..

TPT1-ps4

...g(a)4g(a)4g(a)4g(a)7CTTTTTTTCCG...

...TTGAGTTG(a)5g(a)5g(a)5g(a)5g...

4.5.4. Promotoraktivität der 5’-flankierenden Regionen der Pseudogene

Der Grund dafür, daß die stromaufwärts der Pseudogene gelegenen Sequenzen auf Promotoraktivitäten untersucht wurden, liegt in der Intaktheit des Leserahmens aller untersuchten Pseudogene und der damit verbundenen prinzipiellen Möglichkeit ihrer


66

Exprimierbarkeit bis hin zum funktionellen Protein. Beispiele hochkonservierter prozessierter Pseudogene sind in der Literatur sehr selten (Dahia et al. 1998). Normalerweise mutieren nichtfunktionelle Pseudogene schnell weiter. Die Tatsache, daß beim Kaninchen Pseudogene gefunden wurden, die für authentisches TCTP kodieren, läßt sich entweder so erklären, daß sie evolutionär sehr jungen Ursprungs sind und ihren intakten Leserahmen noch nicht verändert haben, oder daß sie unter funktionellem Erhaltungsdruck stehen. Für die Transkription ist ein Promotor nötig. Die Inspektion der 5’-flankierenden Bereiche ließ jedoch keine klassischen Promotorelemente erkennen. Trotzdem wurde der Versuch unternommen, in Konstrukten mit dem cat-Reportergen dort potentielle Promotoraktivitäten nachzuweisen.

Der Aufbau der Experimente, die Subklonierung von Promotorfragmenten, Zelltransfektion und anschließende Testung in CAT-Assays war analog zu denen im Kap. 4.3 beschriebenen. Die Abb. 4-23 zeigt das Ergebnis.

Abb. 4-23 Promotoraktivität der 5’ flankierenden Bereiche ausgewählter TPT1-Pseudogene: Der Vektor pBLCAT2 ist die Posivkontrolle und pBLCAT3 die Negativkontrolle. Neben der Promotoraktivität der vier Pseudogene TPT1-ps1/2/3/4 sind die CAT-Aktivitäten des minimalen TPT1-Promotormotivs (Fragment -66/+80) und des Fragments mit maximaler TPT1-Promotoraktivität (Fragment -279/+80) gegenübergestellt.

Während die Promotoraktivität der Pseudogene TPT1-ps1 und TPT1-ps3 im Bereich der Negativkontrolle lagen, hatten die 5’ flankierenden Bereiche der Pseudogene TPT1-ps2 und TPT1-ps4 eine deutliche Promotoraktivität, wie sie vergleichbar mit der Minimalaktivität des Promotors des TPT1-Gens war. Anscheinend führten Verstärkersequenzen in der Umgebung der


67

Pseudogene zu einer Transkriptionsstärke von 15-20% des viralen Promotors. Eine Analyse der verfügbaren 120 bp TPT1-ps4 Promotorsequenzen erbrachte keine Anhaltspunkte für das Vorliegen typischer Promotorelemente, wie einer TATA-Box oder Bindungsorte mit hoher Homologie für spezielle TF, sonder zeigte Eigenschaften von Mikrosatelliten und Poly-A-reichen bzw. AT-reichen Abschnitten. Da der in CAT-Assays untersuchte Promotorbereich von TPT1-ps4 jedoch 1,2 kb umfaßte, könnten Enhancer jenseits der 120 bp Grenze für die beobachtete Promotoraktivität verantwortlich sein.
[Titelseite] [Widmung] [Einleitung] [Abkürzungsverzeichnis] [1] [2] [3] [4] [5] [6] [Bibliographie] [Danksagung] [Selbständigkeitserklärung] [Lebenslauf] [Anhang]

© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiML DTD Version 2.0
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Mon May 29 13:40:59 2000