Thiele, Holger: Struktur und Funktion des Gens für das translationell kontrollierte Tumorprotein (TCTP)

68

Kapitel 5. Diskussion

5.1. Ein Vergleich der TPT1-Gene von Mensch und Kaninchen

Ein typisches Säugetiergen hat die Länge von 1-100 kb und kodiert für eine Polypeptidkette von 100-1000 Aminosäuren. Die Grenzbereiche der Größenskala schließen kleine intronlose Gene, wie die der Histone, und mehr als 2 Mb große Gene, wie das Dystrophingen mit über 500 Introns, ein.

Das TPT1-Gen des Kaninchens, dessen Struktur und Sequenz in dieser Arbeit erstmals vorgestellt wurde, präsentierte sich mit 3819 bp als eher kleiner, aber durchschnittlicher Vertreter eines Säugergens. Das Gen enthält 6 Exons (144 bp, 74 bp, 191 bp, 106 bp, 117 bp, 531 bp), die durch 5 Introns (220 bp, 503 bp, 331 bp, 746 bp, 856 bp) unterbrochen werden ( Abb. 4-11 , S. 51). Alle Exon/Intron-Übergänge gehorchen der gt/ag Regel - ein Charakteristikum der Mehrzahl aller gefundenen Gene. Die 5’ untranslatierte Region des Gens ist 116 bp lang. Das letzte Exon enthält zwei alternativ benutzte Polyadenylierungssignale. Dies erklärt die beobachteten mRNA-Varianten (TCTP-mRNA1 und TCTP-mRNA2) von 843 nt und 1163 nt, die sich in der Länge der 3’ untranslatierten Region unterscheiden. Bisher konnte noch kein funktioneller Zusammenhang zur Bedeutung der alternativen Transkripte gefunden werden.

Die Genkontrollregion und Teile des ersten Exons sind in eine CpG Insel eingebettet ( Abb. 4-19 , S. 63). Die Entstehung von CpG-Inseln in der Umgebung der Genkontrollregionen wird auf einen besonderen Inaktivierungsmodus ausgewählter Chromatinabschnitte zurückgeführt. Auslöser für die reversible Stillegung von Teilen der chromosomalen DNA ist die Methylierung von CG-Sequenzen. Werden methylierte C-Nukleotide desaminiert, kommt es infolge ineffektiver Reperaturen zum Verlust der CG-Sequenz, die zu TG mutiert. Unmethylierte DNA-Abschnitte, wie die Genkontrollregionen, bleiben von diesen Veränderungen verschont und als CG-reiche Insel erhalten (siehe Kap. 4.3.4 ). Der Nachweis der CpG-Insel im Bereich des Promotors des TPT1-Gens ist als Hinweis für eine transkriptionelle Aktivität des Gens zu bewerten. Obwohl man CpG-Inseln bevorzugt bei Haushaltsgenen findet, spricht deren Vorkommen bei einigen gewebsspezifischen Genen gegen die automatische Annahme, es handle sich um ein Haushaltsgen. Das TPT1-Gen nimmt in dieser Hinsicht eine Zwischenstellung ein,


69

da die Transkription in allen untersuchten Geweben stattfindet, aber durch gewebsspezifische Faktoren quantitativ mitreguliert wird und auf mitogene Stimuli reagiert.

Die vollständige Aufklärung der Struktur des Human-TPT1-Gens machte den direkten Vergleich von Human- und Kaninchengen möglich. Die Veröffentlichung einer Teilstruktur des Humangens lieferte die Daten über die Exon/Intronarchitektur, die Struktur der 3’UTR2 und die Sequenz des Introns 3 ( Bonaldo et al. 1996 ). Durch die in dieser Arbeit beschriebene Klonierung und vollständige Sequenzanalyse der restlichen Teile des Humangens wurden 500 bp Promotorsequenzen, das vollständige Exon 1 und die bisher unbekannten intronischen Sequenzen aufgeklärt. Das Human-TPT1-Gen ist nach vorläufigen Sequenzdaten 4269 bp groß. Seine Struktur ist identisch mit der des Kaninchengens. Zu den konservierten Strukturen gehören die Exon/Intronübergänge, die CpG-Insel sowie die besonderen Merkmale des Exons 6. Dieses enthält analog zum Kaninchengen die verlängerte 3’UTR2. Die Abb. 5-1 stellt das Kaninchengen dem humanen gegenüber. Tabelle 5 listet die Größen aller Exons und Introns und deren Homologien untereinander auf.

Abb. 5-1 Vergleich zwischen dem TPT1-Gen des Kaninchens und des Menschen

Tabelle 6 Größen der Exons (E) und Introns (I) der TPT1-Gene des Kaninchens und des Menschen (in bp) und ihre Homologien untereinander

 

E1

I1

E2

I2

E3

I3

E4

I4

E5

I5

E6

Kaninchen

144

220

74

503

191

331

106

746

117

856

531

Mensch

142

255

74

525

191

391

106

721

117

1220

517

Homologie

86%

64%

98%

73%

94%

48%

98%

52%

95%

46%

85%

Die Analyse beider Gene zeigt, daß alle Exon- und Intronübergänge konserviert sind. Die Exons 2, 3, 4 und 5 zeigen keine Längendifferenzen. Ihre Homologien liegen zwischen 94% und 98%.


70

Die Abweichungen des ersten und letzten Exons, deren Homologien bei etwa 85% liegen, sind zum größten Teil auf die UTRs zurückzuführen. Auf Aminosäureniveau beträgt die Sequenzhomologie 98,3%. Erwartungsgemäß weichen die Introns sehr viel stärker voneinander ab. Ihre Übereinstimmung erreicht Werte bis 73% im zweiten Intron. Das humane Intron 5 ist 364 bp länger und stimmt nur zu 46% mit dem Kaninchenintron überein. Dies geht unter anderem auf mehrere Insertionen, die größte etwa 200 bp, zurück.

5.2. Die Transkriptionsregulation des TPT1-Gens

5.2.1. Auswertung der CAT-Assays und Analyse der Promotorsequenzen

Das eigentliche Anliegen dieser Arbeit war, Aussagen zur Kontrolle des TPT1-Gens zu treffen. Voraussetzung dafür war die Klonierung und vollständige Strukturaufklärung des TPT1-Gens, einschließlich der Klonierung des TPT1-Promotors, dem 5’ flankierenden Genbereich, welcher die Kontrolle des Gens auf transkriptioneller Ebene vermittelt. Aus diesen Bemühungen ging die erste vollständige TPT1-Gensequenz eines eukaryontischen Organismus, im konkreten Fall die des Kaninchens, hervor. Etwa 1,2 kb der Promotorsequenz wurden vollständig sequenziert und standen für weitere Analysen zur Verfügung. Parallel dazu gelang später die Subklonierung des humanen TPT1-Gens. Von diesem Gen wurden bislang nur Teile veröffentlicht. Zwar gingen die Intron/Exonübergänge daraus hervor, jedoch fehlten die meisten Introns, Teile des Exons 1 sowie der Promotor. Indem etwa 500 bp des humanen Promotors sequenziert werden konnten, waren erstmals Einblicke in mögliche regulatorische Charakteristika des humanen TPT1-Gens und Vergleiche zum Kaninchen Promotor möglich.

Als nächstes sollte die Fragestellung untersucht werden, ob es sich im vorliegenden Fall um die authentischen aktiv transkribierten TPT1-Gene handelte und im positiven Falle die Stärke des Promotors ermittelt werden. Bekannterweise existieren von einer Vielzahl von Genen Pseudogene vom unprozessierten Typ. Diese besitzen alle Merkmale von Genen mit Exons, Introns und Promotorstrukturen, sind jedoch durch verschiedenste Mutationen ausgeschaltet worden. Die Computeranalyse des Kaninchengens konnte die Intron- und Exonorganisation eindeutig zuordnen und zeigen, daß keine Mutationen im kodierenden Bereich sowie der wichtigen Spleißkonsensusorte vorlagen. Der Promotor wies ferner eine TATA-Box an der Konsensus-Position -29 auf, was genau mit den beobachteten mRNA-Größen übereinstimmte.


71

Dieses Element wird vom TBF erkannt und ermöglicht den Aufbau des PolymeraseII-Multienzymkomplexes. Trotzdem hätten Mutationen im Promotorbereich eine Inaktivierung des Gens bewirken können. Deshalb wurden CAT-Assays mit Teilen des Kaninchenpromotors durchgeführt, um Aussagen über die Funktionalität und Stärke des Promotors zu erhalten.

Dazu wurde der Promotor in 5 unterschiedlich große Fragmente (-66/+80, -166/+80, -291/+80, -379/+80, -918/+80) zerlegt und in einen CAT-Reportervektor umkloniert. Diese Konstrukte wurden anschließend in glatte Muskelzellen des Kaninchens transfiziert und die Promotorstärke, die proportional zur gemessenen CAT-Aktivität ist, gemessen. Die Ergebnisse ( Abb. 4-18 , S. 62) zeigten eine starke Aktivität des Fragmentes -291/+80 von 90% des viralen (HSV1-Virus) Vergleichspromotors. Die kleineren Fragmente hatten Aktivitäten von 20-25%, während die größeren Fragmente leicht an Aktivität (80-85%) einbüßten. Das Fragment -291/+80 war jenes mit der höchsten Aktivität. Ob es sich hierbei um die maximale Aktivität des TPT1-Promotors handelt, kann nicht mit Sicherheit beantwortet werden, da Konstrukte jenseits der -918 bp-Grenze nicht kloniert und somit nicht getestet wurden. Der Abfall der Aktivität bei den Fragmenten größer als -291 bp könnte auch als Indiz für stromaufwärts gelegene Silencer-Sequenzen gedeutet werden, obwohl der Meßfehler von etwa 10% diese Aussage nicht mit Absolutheit zuläßt.

Eine interessante Aussage ließ sich durch parallel durchgeführte Transfektionsexperimente des größten Konstruktes -918/+80 mit einer humanen Blutzellinie (K562-Zellen) erzielen, in der sich ebenfalls eine deutliche Aktivität zeigte. Die Tatsache, daß ein Kaninchenpromotor auch in humanen Zellen aktiv ist, deutete auf eine starke Konservierung der beteiligten cis/trans Elemente hin. Vor diesem Hintergrund war die Analyse des humanen TPT1-Promotors eine wichtige Zielstellung. Die Sequenzierung des humanen Promotors zeigte dann auch erwartungsgemäß eine ausgeprägte Sequenzhomologie, besonders der ersten 160 bp.

Die weiteren Analysen des Human- und des Kaninchenpromotors stützten sich im wesentlichen auf die Suche nach potentiell bindenden TF und dem Sequenzvergleich zwischen dem Human- und dem Kaninchenpromotor. Das Auffinden bekannter TF wurde mit Hilfe des Programms MatInspector® realisiert ( Quandt et al. 1995 ). Dieses Programm stützt seine Auswertung auf


72

eine Datenbank mit gespeicherten TF und deren Bindungssequenzen und -motiven. Indem man Programmversionen benutzt, die auf Internetresourcen als Datenbankquelle zurückgreifen, kann man effektiv das Potential der ständig aktualisierten TF-Datenbanken (z.B. TransFac®) auf frei zugänglichen Netzwerkservern nutzen (http://transfac.gbf.de).

Das Ergebnis dieser Analysen besteht aus einer Liste von möglicherweise bindenden TF. In der Gensequenz der Abb. 4-12 (S. 55) wird eine Auswahl dieser Faktoren und ihre hypothetischen Bindungsorte am TPT1-Promotor des Kaninchens dargestellt.

Berücksichtigt wurden nur Faktoren mit 100 % Kernsequenzhomologie. Damit ist ein etwa 4 bp langer Sequenzbereich innerhalb der Bindungsregion gemeint, der nur in seltenen Fällen eine Abweichung zeigte. Die angrenzenden Bereiche (Matrix) können dagegen kleine Abweichungen haben. Diese Schwelle der Übereinstimmung wurde auf 95% Homologie festgelegt. Durch Veränderung der Schwelle nach unten ist es möglich, erheblich mehr Bindungsregionen für Faktoren vorherzusagen, weshalb die Grenze bewußt so gewählt wurde, daß mit einer überschaubaren Anzahl von TF weitergearbeitet werden konnte. Dieses Vorgehen ist gerechtfertigt, da die Erfahrungen unserer und anderer Gruppen zeigen, daß TF in der Regel nur an hochhomologe Konsensussequenzen binden. Abb. 5-2 gibt die Lage der Faktoren am Kaninchenpromotor graphisch-maßstabsgerecht wider.

Abb. 5-2 Position einiger möglicher TF am Kaninchen TPT1-Promotor: Die Positionsmarkierungen (in bp) entsprechen den in den CAT-Experimenten verwendeten Promotorfragmenten.

Berücksichtigt man die Ergebnisse der CAT-Assays, ergibt sich folgendes Bild. Im kleinsten Fragment (-66/+80) binden zwei Faktoren - MZF-1 (Pos. -22) und die Mitglieder der CREB/AP-1-Familie (ab Pos. -52). Die Promotoraktivität dieses Fragmentes entspricht etwa 20% des zum Standart erhobenen viralen Promotors. Das nächst längere Fragment (-166/+80) weist einen weiteren Bindungsort für die CREB/AP-1-Familie (ab Pos. -94) sowie zwei ETS-1 Orte (Pos. -76, -163) und einen SP-1 Ort (Pos. -121) auf, hat aber eine etwa vergleichbare Aktivität, so daß


73

sich die Minimalaktivität des Promotors auf die beiden erstgenannten Faktoren des -66/+80-Fragmentes konzentrieren läßt. Einen deutlichen Anstieg der Aktivität (90%) verzeichnet das Fragment -291/+80. Zwei Faktoren kommen als Bindungspartner in Frage- NF-1 (Position -182) und MZF-1 (Position -242). In den nächst längeren Fragmenten kommen mögliche Bindungsstellen für die Faktoren MZF-1, STAT-1, MYO-D, NF-1, SRY, S8 und IK2 vor. Da alle Konstrukte Teile der 5’UTR enthielten (80 bp), wurde auch dieser Bereich auf Bindungsstellen analysiert. Dabei stellten sich zwei weitere Bindungsstellen für MZF-1 und NF-1 dar.

5.2.2. Vergleich der TPT1-Promotoren von Mensch und Kaninchen

Die Klonierung des Human-TPT1-Promotors eröffnete die Möglichkeit, weiterreichende Aussagen über die Wahrscheinlichkeit zu treffen, ob ein TF tatsächlich in die Kontrolle des Gens involviert sein könnte. Dies beruht auf der Tatsache, daß TF als trans-Faktoren und DNA-Bindungsorte als cis-Faktoren evolutionär stark konserviert wurden. Die Bedeutung des TCTP für eukaryontische Organismen scheint auf Grund der weiten Verbreitung in allen untersuchten Organismen und der hohen Konserviertheit des Proteins gegeben zu sein. Deswegen würde man erwarten, daß sich cis-Elemente im TPT1-Gensequenzvergleich verschiedener Organismen durch gesteigerte Homologien zu erkennen geben. Die folgende Abbildung ( Abb. 5-3 ) zeigt den Vergleich des Human- mit dem Kaninchenpromotor.


74

Abb. 5-3 Vergleich der TPT1-Promotoren des Kaninchens und des Menschen: Übereinstimmende Basen wurden blau markiert. Potentielle TF-Bindungsstellen sind zusätzlich gelb hervorgehoben.

Beachtenswert ist die starke Homologie der ersten 160 bp, die 89% beträgt. Danach fällt sie rasch auf niedrigere Werte ab. Alle Faktoren, die sich in diesem Abschnitt finden, sind hochkonserviert. Dazu gehören CREB/AP-1 (-52, -94), ETS-1 (-76, -163), MZF-1 (-22) und SP-1 (-121). Danach zeigt sich, daß einige Bindungsstellen kaum Homologie zueinander haben, z.B. NF-1 (-182) und TST-1 (-385). Wiederum konserviert scheinen die Bindungsstellen für die Faktoren MZF-1 (-242) und STAT-1 (-413) zu sein. Im folgenden sollen diese konservierten Faktoren besprochen werden.

5.2.3. TPT1-Induktoren

Im Kapitel Einleitung wurde schon darauf hingewiesen, daß das Wissen um die transkriptionelle Regulation des TPT1-Gens nur sehr unzureichend war. Seit der Erstbeschreibung des Proteins gab es jedoch zunehmend Hinweise auf eine Reihe von Induktoren der TCTP-Synthese, von


75

denen man zum Teil den Wirkmechanismus kennt. Zu den bekannten TPT1-Genaktivatoren gehören DMSO, TPA, LPS, einige Schwermetalle und IL-3. Es lag also auf der Hand, nach Hinweisen zu suchen, die diese Induktoren in Verbindung mit TF brachten.

Interessanterweise gibt es Zusammenhänge, die die meisten, der beobachteten Induktionsphänomene, auf gemeinsame Mechanismen reduziert. Die Tatsache, daß TPA zu diesen Induktoren zählt, ist in diesem Zusammenhang erwähnenswert. Phorbolester sind schon lange als Tumorpromotoren bekannt. Dieser Reizstoff aus den Blättern der Crotonpflanze greift in einen zentralen Regulationspunkt der Zellwachstumssteuerung ein, indem es die Proteinkinase C (PKC) aktiviert ( Varmus und Weinberg 1994 ), von der bekannt ist, daß sie auch durch IL-3 stimuliert wird ( Mufson et al. 1992 ). Die PKC gehört zu den Schlüsselkomponenten einer Signalkaskade, die als Reaktion der Zelle auf extrazelluläre Stimuli aktiviert wird. Die Reaktionskaskade geht über die Aktivierung bestimmter Rezeptoren rarr G-Proteine rarr aktivierter Phospholipase C und Spaltung von PIP3 in IP3 und DIG. TPA ahmt die Wirkung von DIG nach, indem es genau wie dieses zur Aktivierung der PKC führt ( Alberts et al. 1995 ). Die Wirkungen dieser Kinase sind mannigfaltig. In vielen Zellen führt sie zu einem Anstieg der Transkription spezifischer Gene, indem sie direkt Transkriptionsfaktoren phosphoryliert (z.B. c-JUN und CRE-BP1) und dadurch aktiviert oder andere Kinasen aktiviert. Dazu gehören die MAP-Kinasen (auch als ERKs bezeichnet), von deren Familie mindestens fünf verschiedene Vertreter bekannt sind (JNK/SAPK, ERK1, ERK2, p38, p42) und die ebenfalls in der Lage sind, TF zu aktivieren. Zu den TF, die von der PKC und den MAP-Kinasen phosphoryliert werden, gehören Elk-1 als Teil des SRE (serum response element), I_-B als spezifischer Inhibitor des Faktors NF-_B und c-Jun als Teil des Faktors AP-1. Da sich im Promotor des TPT1-Gens zwei Bindungsorte für die CREB/AP-1-Familien befinden, scheint hier eine mögliche Verbindung zwischen der PKC-Aktivierung einerseits und Aktivierung der TCTP-Synthese andererseits zu bestehen. Die MAP-Kinase ist selbst Substrat anderer Kinasen, der MAP-Kinase-Kinase und diese wiederum Substrat von MAP-Kinase-Kinase-Kinasen. Dazu gehört z.B. Raf als Teil eines Rezeptor-Tyrosinkinasen-Signalweges, der über eine ras-gekoppelte Aktion ebenfalls die MAP-Kinasen aktiviert. Folgende Abbildung ( Abb. 5-4 ) veranschaulicht dies graphisch.


76

Abb. 5-4 PKC und MAP-Kinase abhängige Signaltransduktionsprozesse (aus Alberts et al. 1995 )

Lipopolysaccharide (LPS) sind ebenfalls als Aktivatoren der TCTP-Synthese bekannt. Man weiß, daß LPS an einem bestimmten Serumprotein bindet (LPS bindendes Protein) und mit dem Oberflächenrezeptor CD14 interagiert. Die von hier ausgehenden Signaltransduktionsprozesse führen zur Aktivierung verschiedener MAP-Kinase-Familien, wie p42, p44, ERK1, ERK2, p38 und JNK/SAPK ( Hambleton et al. 1995 , Swantek et al. 1997 ). Da Mitglieder der MAP-Kinasen TF, wie AP-1 und einige CREB-Faktoren, phosphorylieren, ist eine Aktivierung des TPT1-Gens auf diesem Wege erklärbar.

Eine andere Möglichkeit der TCTP-Akkumulation wurde beim Regenwurm beschrieben ( Sturzenbaum et al. 1998 ). Hier war die Synthese als Reaktion auf schwermetallbelastete Böden erhöht. Besonders Kupfer, aber auch Cadmium und Blei, führten hier zu Induktionsphänomenen. Für Kupfer als essentiellem Spurenelement sind spezifische Regulationsmechanismen bekannt. In den Promotoren einiger Gene ( Winge 1998 ) befinden sich kupferresponsible Elemente, die mit spezifischen, kupferbindenden TF interagieren (z.B. ACE-1, AMT-1, MAC-1, MTF-1). Im TPT1-Promotor des Kaninchens kommen jedoch keine derartigen Bindungsmotive vor. Da eine Reihe verschiedener Schwermetalle zu einer Induktion des TCTP führen, kann man vermuten, daß es sich hierbei um eine zelltoxische Stimuli


77

subsummierende Zellreaktion handelt. Zu den Ereignissen, die als Antwort auf Schwermetallbelastungen beschrieben wurden, zählt z.B. auch ein Anstieg des intrazytoplasmatischen Redoxpotentials ( Hultberg et al. 1997 ). Da auf der anderen Seite Radikale als direkte und indirekte Aktivatoren der PKC gelten ( Whisler et al. 1994 , Kuo et al. 1995 ), scheint die TCTP-Syntheseerhöhung auf diesem Wege erklärbar zu sein. Dem stehen die Beobachtungen konzentrationsabhängiger hemmender und stimulierender Effekte von Schwermetallen auf die Aktivität der PKC anderer Autoren gegenüber ( Speizer et al. 1989 , Rajanna et al. 1995 ). Die Tatsache, daß Schwermetalle zu einer spezifischen Anschaltung einer Reihe von TPA-induzierbarer Gene trotz PKC-Hemmung führen ( Epner und Herschmann 1991 ), macht auch andere Induktionsprinzipien wahrscheinlich, wie die Involvierung der p60SRC Tyrosinkinase ( Lee et al. 1996 ).

DMSO war der erste gefundene TPT1-Aktivator, doch sind seine breit gefächerten Effekte auf Zellen sind bis heute nicht restlos verstanden. Neben den Eigenschaften als Lösungsmittel, Zytoprotektor, Biomenbranen-Permeator, Radikalfänger und Zellfusogen, die auf besondere chemische Eigenschaften dieser Verbindung zurückgehen, steht seine Fähigkeit, die Zelldifferenzierung verschiedener Gewebearten zu aktivieren im Vordergrund des Interesses ( Yu und Quinn 1994 ). Diese wird auf der Ebene der Genaktivierung vermutet und vieles spricht dafür, daß dies auf eine Aktivierung intrazellulärer, “second messenger“ gekoppelter Signalkaskaden zurückgeht. Dafür sprechen z.B. die synergistische Wirkung von PMA und DMSO bei der Apoptose, die mit einer Langzeit-PKC-Aktivierung einhergeht ( Trubiani et al. 1998 ), die Tatsache, daß die DMSO-induzierte Differenzierung von Human- Erythroleukämiezellen von einer Erhöhung der PKC-Aktivität begleitet ist ( Durkin et al. 1992 ) oder die DMSO-gekoppelte Aktivierung des HIV-1 LTR, welche synergistisch zu den Induktoren PMA, TNF-alpha und H2O2 wirkt ( Klebanoff et al. 1997 ).

5.2.4. Beschreibung der potentiell bindenden TF

Der Promotor des Menschen und des Kaninchens enthält zwei Bindungsorte der CREB/AP-1-Familien an den Positionen -52 und -94. Beide Familien sind Untergruppen der Leucin-Zipper-Klasse der TF. Dieses Motiv bezieht sich auf eine Domäne in der Proteinstruktur der TF, mit deren Hilfe die Faktoren hetero- bzw. homodimerisieren. Die Familie der


78

AP-1-ähnlichen Faktoren besteht aus sieben Unterfamilien mit über 50 Vertretern, wozu Jun, Fos, Maf, NF-E2, AP-1 ähnliche Faktoren der Pilze und CRE-BP/ATF gehören. Die Protooncogene Jun und Fos spielen eine wichtige Rolle in der Wachstumskontrolle der Zelle. Dies wird durch die Beobachtung der malignen Transformation durch bestimmte tierische Viren gestützt, die diese TF als Oncogene übertragen ( Varmus und Weinberg 1994 ). Zu der Jun Unterfamilie gehören XBP-1, v-Jun, c-Jun, JunB, JunD und dJRA. Der Fos Unterfamilie gehören v-Fos, c-Fos, FosB1, FosB2, Fra-1, Fra-2, dFRA und LRF-1 an. Als AP-1 bezeichnet man einen dimeren Komplex zwischen den Faktoren einer oder zweier Untergruppierungen der AP-1 ähnlichen Faktoren. Bekanntgeworden ist die AP-1 Familie durch den c-Jun/c-Fos Komplex, von dem mittlerweile Strukturmodelle existieren ( Abb. 5-5 ).

Abb. 5-5 Modell der Wechselwirkung von AP-1 Komponenten mit cis-Elementen (aus Varmus und Weinberg 1994 ). LZ=Leucin-Zipper-Strukturmotiv

Nach der Dimerisierung an spezifischen DNA-Sequenzen erfolgt die Aktivierung der Faktoren. Vom TF c-Jun ist bekannt, daß er mit dem CREB bindenden Protein (CBP) wechselwirkt ( Ariaset al. 1994 ). Dieser Faktor nimmt seinerseits Kontakt mit dem allgemeinen TF TFIIB auf ( Kwok et al. 1994 ), wodurch eine Verstärkerfunktion des AP-1-Komplexes erklärbar wird. Man nimmt an, daß verschiedene Hetero-/Homodimere unterschiedliche DNA-Bindungssequenzen besetzen und sich auch in der Regulierung unterscheiden. Die Bindungsregion des AP-1-Komplexes wird wegen der induktiven Beeinflußbarkeit durch Phorbolester auch als TPA responsibles Element (TRE) bezeichnet.


79

Die zweite Familie von TF, die eine dem AP-1 Bindungsort sehr ähnliche Sequenz erkennt, ist die mittlerweile aus über 30 Mitgliedern bestehende CREB-Familie. Wie AP-1 gehört sie zur Klasse der Leucin-Zipper-Faktoren und setzt sich aus den Untergruppen CREB, ATF-1, CREM, BBF-2, dCREB2, SKO1, HAC1 und PCR1 zusammen. Weitere Gemeinsamkeiten zu AP-1 sind die Fähigkeit zur Homo - und Heterodimerisierung. Die Aktivierung der Faktoren geschieht genau wie bei AP-1- durch Phosphorylierung durch spezifische Kinasen. Der bisher am besten untersuchte Vertreter der CREB-Familie, CREB 1, wird durch die Proteinkinase A (PKA) an Position Serin-133 phosphoryliert. Die Namensgebung CREB: für cAMP responsibles Element (CRE) - bindendes Protein trägt diesem Sachverhalt Rechnung. CREs reagieren auf eine Signalkaskade, die über Aktivierung bestimmter Rezeptoren: G-Proteine _ Adenylylcyclase _ cAMP _ und PKA- Aktivierung abläuft. Nach der CREB Phosphorylierung ist der dimere Komplex in der Lage mit CBP zu wechselwirken ( Kwok et al. 1994 ), einem ebenso an AP-1 bindenden Faktor. Dem CBP kommt somit eine Brückenfunktion zwischen allgemeinen und speziellen TF zu ( Abb. 5-6 ).

80

Abb. 5-6 Modell PKA abhängiger Signaltransduktionsprozesse: Bestimmte Rezeptoren führen nach Bindung eines Liganden über die dargestellten Signaltransduktionsprozesse zur Aktivierung der PKA. Deren katalytische Untereinheit gelangt in den Zellkern und phosphoryliert Transkriptionsfaktoren wie CREB, wodurch es anderen Transkriptionsfaktoren (CBP) ermöglicht wird am Promotor zu binden und somit die Aktivität des Gens modifiziert wird.

Weitere Untersuchungen konnten zeigen, daß CREB mit einer Komponente von TFIID interagiert ( Ferreri et al. 1994 ), eine Tatsache, die mit der basalen Enhancerfunktion der CREBs korrelieren könnte ( Quinn 1993 ). Untersuchungen über die Spezifität der AP-1 Bindung an TREs und der CREB Bindung an CREs konnten zeigen, daß hier keine absolute Zuordnung besteht. Zwar gibt es für spezifische dimere TF Präferenzen für spezielle Sequenzmotive, doch kommt es auch zur Bindung von CREB an TREs und AP-1 Komplexen an CREs ( Fink et al. 1991 ). Darüber hinaus wurden Dimere zwischen Mitgliedern der AP-1 und der CREB Familie z.B. CREB/c-Jun beschrieben ( Benbrook und Jones 1990 ). Damit wird ersichtlich, daß es keine echte Trennung zwischen diesen beiden TF-Subfamilien gibt.

Die beiden CREB/AP-1 Elemente im TPT1-Promotor sind nicht identisch. Das erste Element an Position -52 (TGACGTAG) hat beim Kaninchen als wahrscheinlichste Bindungspartner die


81

Faktoren CREB1 und CREB2. Das humane Pendant weicht in den letzten beiden Positionen von der Kaninchensequenz ab (TGACGTCA). Dies hat die Konsequenz, daß sich die Bindungswahrscheinlichkeit, zugunsten der Kombination CREB1/CREB1 oder CRE-BP1/c-JUN verschiebt. Beim Menschen ist dieses Motiv als einziges von zweien 100% homolog zum Konsensusmotiv der angegebenen TF, was die Wahrscheinlichkeit für eine physiologische Bedeutung erhöhen dürfte. Die Faktorenkombination CRE-BP1/c-JUN erscheint im Lichte der TPA-Induzierbarkeit als eine interessante Möglichkeit, da die phorbolesterinduzierte Aktivierung der PKC mit der Phosphorylierung von c-Jun und CRE-BP1 einhergeht und beide Faktoren ebenso Substrate der JNK/MAP-Kinase-Signalkaskade sind. Sollten zusätzlich CREB-Faktoren funktionell am Promotor binden können, würde man eine cAMP/PKA abhängige Responsibilität erwarten, eine bis heute nicht untersuchte Fragestellung, die man durch die Induzierbarkeit des TPT1-Promotors durch cAMP Analoga bzw. PKA-Aktivatoren (z.B. Forskolin) überprüfen könnte.

Das zweite CREB/AP-1-Motiv des TPT1-Promotors befindet sich an Position -88. Das in Abb. 5-3 angegebene Konsensusmotiv beinhaltet die Erkennungssequenz für den TF CREB 2, für den beim humanen Promotor 97,4%ige Matrixübereinstimmung, beim Kaninchenpromotor 88,8%ige Übereinstimmung gefunden wurde. Für den Faktor ATF verhalten sich die Konsensusmotive etwas anders: 96,6% (human) und 95,8% (Kaninchen). Die Tatsache, daß trotz der hohen Interspezieskonservierung des Bindungsmotives (nur eine Base Unterschied) sehr unterschiedliche Präferenzen für die einzelnen Mitglieder der CREB-Familie bestehen, mag auf Details in der Bewertung und auf die Anzahl der vorhandener Datensätze, die in die Bewertung der TF-bindungsdominierenden Sequenzen der zum Teil recht spärlichen Literatur eingegangen sind, zurückzuführen sein.

Der hochkonservierte Promotorbereich enthält zwei Bindungsstellen für den TF ETS-1. Interessanterweise wurden TREs in Verbindung mit ETS-1 Faktoren gefunden. Funktionell bedeutende AP-1 und ETS Bindungsorte sind in einer Vielzahl von Genkontrollregionen als Hinweis auf eine additive Kooperation beider Elemente beschrieben worden ( Newberry et al. 1997 , Majerus et al. 1992 , Noti et al. 1996 ). Aus mechanistischer Sicht scheint eine direkte Wechselwirkung zwischen der basischen Domäne von c-Jun und der ETS-Domäne des TF ETS-1 zu bestehen. Damit kommt es zu einem trimolekularen Komplex aus ETS, c-Jun


82

und anderen Mitgliedern der AP-1-Familie, etwa c-Fos ( Bassuk und Leiden 1995 ). ETS kann selber wiederum mit dem CBP und damit assoziiertem p300 Molekül wechselwirken ( Yang et al. 1998 ). Die schon erwähnte Brückenfunktion des CBP/p300 ist begleitet von einer Histon-Acetyltransferase-Aktivität. Damit würde sich ein weiterer Mechanismus erschließen, mit dem CBP seine Verstärkerfunktion erfüllt, indem es lokale Veränderungen der Chromatinstruktur bewirkt und damit den Promotorbereich für andere allgemeine und spezielle TF freilegt. Hier offenbart sich ein gewisser Schwachpunkt der Transfektionsexperimente, da die verwendeten Reportervektoren keine adäquate Chromatinstruktur ausbilden dürften.

Die im TPT1-Promotor identifizierten c-ETS-1p54 TF-Bindungsstellen repräsentieren einen TF aus der “Helix-turn-helix“ Superfamilie - Klasse: Tryptophan-Cluster, Familie: ETS-ähnliche Faktoren, Unterfamilie: c-ETSs-1. Circa 40 TF gehören zu der Familie der c-ETS - darunter c-ETS-1p54 (http://transfac.gbf.de/TRANSFAC/index.html). ETS-ähnliche Proteine gehören zu den Proto-Oncogenen, werden als wichtige Komponenten TATA-Box-loser Promotoren beschrieben, haben Bedeutung in wachstums- und zellzyklusspezifischen Aktionen und scheinen in die T-Zellaktivierung involviert zu sein ( Wasylyk et al. 1993 ). Insgesamt spricht die Präsens von zwei ETS-1 Faktoren und zwei Mitgliedern der CREB/AP-1 Familie im hochkonservierten Promotorbereich des TPT1-Gens und die gesicherte additive Kooperation beider TF-Familien in anderen oncogen-responsiblen Promotoren für deren Beteiligung in der TPT1-Transkriptionkontrolle.

Ein weiterer TF im konservierten Promotorbereich (Position -114) - SP-1 - verdient genauere Betrachtung. Die Bindungsregion dieses Faktors ist in beiden Spezies zu 100% konserviert und die Matrixübereinstimmung mit 99,6% sehr hoch. Schon aus dieser Konstellation ist eine Beteiligung des TF SP-1 sehr wahrscheinlich. SP-1 findet man in allen Geweben und beteiligt sich in einer Vielzahl von Promotoren regulativ. Er gehört in die Klasse der Zink-koordinierten DNA-Bindungsdomänen und ist Mitglied der Cystein2-Histidin2-Zinkfinger-Domänen Faktoren. Seine Verstärkerfunktion wurde auf verschiedene Weise postuliert. Dazu gehört die direkte Interaktion mit einer Untereinheit des Holo-TFIID-Faktors. Dieser setzt sich aus acht TAFs (TAFII250, TAFII150, TAFII110, TAFII80, TAFII60, TAFII40, TAFII30alpha, TAFII30beta) und TBP zusammen. Es konnte gezeigt werden, daß der TAFII110 für eine SP-1 responsible Aktivierung verantwortlich ist ( Gill et al. 1994 ). Andere Autoren beschreiben die Bildung von


83

SP-1-Tetrameren, die in der Lage sind, entfernte Promotorbereiche durch Schleifenbildung zu überbrücken ( Mastrangelo et al. 1991 ). Der für diesen Mechanismus essentielle zweite SP-1 Bindungsort findet im TPT1- Promotor keine direkte Entsprechung. Zwar existiert ein weiterer SP-1 Ort an Position -216 des Human- Promotors, aber dieser ist nicht stark konserviert. Als Hypothesen könnten weitere SP-1 Orte jenseits der sequenzierten 1.2 kb Kaninchenpromotor-Sequenz oder eine direkte Wechselwirkung des TF SP-1 mit TFIID angenommen werden.

In der Beschreibung der restlichen Promotorsequenzen fällt eine Häufung von MZF-1 Elementen auf. In den 500 bp Promotorsequenzen von Mensch und Kaninchen existieren zwei konservierte Konsensusbereiche. Dazu kommt ein weiterer MZF-1 Ort an Position +17 und zwei weitere MZF-1 Orte im Kaninchenpromotor jenseits der 500 bp-Grenze ( Abb. 4-12 ). MZF-1 wird genau wie SP-1 der Überfamilie: Zinkfinger-Bindung, Klasse der Cys2His2 Zinkfinger zugeordnet, wird jedoch nicht ubiquitär exprimiert und wegen seiner strukturellen und funktionellen Verwandtschaft mit dem entwicklungs- und zellzyklusreguliertem TF Krueppel gemeinsam in eine andere Unterfamilie eingeordnet. Seine Transkripte werden überwiegend in myeloiden Zellinien einer frühen Differenzierungsphase - Myelozyten und Metamyelozyten - gefunden, jedoch scheinen alternative Transkripte auch in Leber- und Plazentazellen vorzukommen ( Hromas et al. 1991 ). Sollten MZF-1 Faktoren in der Regulierung des TPT1-Gens eine Rolle spielen, würde man eine spezifische Modulation in den genannten Zellinien erwarten.

Der ebenfalls konservierte TF STAT-1 befindet sich an Position -412 des Kaninchenpromotors. Seine Aktivität wird durch eine Reihe von Signaltransduktionen, bekanntermaßen durch den JAK-STAT, aber auch durch PKC, PKA, MAP-Kinase, Ras und PI3K involvierende Signalwege bestimmt ( Weber-Norst et al. 1998 ). Seine inhibitorischen, gamma-Interferon induzierten Effekte auf das Makrophagen-Radikalfänger-Rezeptorgen erklärt man sich durch die direkte Wechselwirkung von STAT-1 mit CBP/p300. Dadurch würden den aktivierenden AP-1/ETS Faktoren dieses Promotors die erforderlichen CBP/p300 Komponenten durch Kompetition entzogen ( Horvai et al. 1997 ). Andere Autoren konnten eine direkte synergistische aktivierende Wechselwirkung zwischen SP-1 und STAT-1 im Gen des interzellulären Adhäsionsmoleküls-1 nachweisen ( Look et al. 1995 ). Somit existieren Fakten für sowohl hemmende als auch aktivierende STAT-1-Funktionen. Für die Beteiligung des STAT-1 Faktors am TPT1-Promotor


84

sprächen neben seiner Interspezieskonservierung vor allem zwei Argumente: 1. könnte der TPT1-Promotor analog dem Makrophagen-Radikalfänger-Rezeptorgen durch AP-1/ETS Faktoren reguliert werden, und 2. zeigten die CAT-Assays einen leichten Abfall der Aktivität jenseits der -379 Grenze, wie man es auf Grund der postulierten hemmenden STAT-1-Effekte erwarten würde.

Betrachtet man die CAT-Assays, so zeigt sich ein deutlicher Sprung in der Aktivität zwischen den Positionen -166 und -291. Im Kaninchenpromotor befinden sich in diesem Bereich Bindungsstellen für zwei NF-1 Faktoren. NF-1, der zu einer eigenen Klasse von Proteinen mit basischen Domänen gehört, hat als ubiquitärer Faktor Bedeutung für eine Vielzahl von Genen. Im TPT1-Promotor des Menschen befindet sich nur ein NF-1 Ort, der jedoch in entgegengesetzter Orientierung angeordnet ist, und deshalb keine Homologie zum Kaninchen zeigt. Obwohl die cis-Elemente erheblich voneinander abweichen sind für beide Motive identische Matrixhomologie von 94,2% angegeben, d.h. trotz ihrer Verschiedenheit könnten die Elemente von Mensch und Kaninchen als äquivalent betrachtet werden. Da die Orientierung von NF-1 nicht ausschlaggebend für seine Verstärkerfunktion zu sein scheint, ist die Bedeutung dieses cis-Elementes zumindest nicht auszuschließen.

Andere Faktoren in diesem Promotorfragment sind ein nicht konservierter SP-1-Faktor und ein konservierter und ein nicht-konservierter MZF-1 Faktor.

Tabelle 7 faßt noch einmal die im wesentlichen gefundenen TF im Promotorfragment +1 bis -500 unter dem Gesichtspunkt der Positionen, Bindungsmotive und Matrixübereinstimmungen zusammen. Auf die Diskussion der im Kaninchenpromotor jenseits der -500 bp vorkommenden TF-Bindungsmotive ( Abb. 4-12 u. Abb. 5-2 ) soll hinsichtlich des stark spekulativen Charakters ihrer Bedeutung verzichtet werden.


85

Tabelle 7 Gegenüberstellung von Bindungsmotiven für TF im Human- und Kaninchenpromotor: Dargestellt werden die Positionen, Orientierungen (+/-), prozentualen Matrixübereinstimmungen und Bindungsmotive der TF. Der 4 bp und großbuchstabig dargestellte Teil des Bindungsmotives entspricht der Kernsequenz der Bindung und entspricht bei allen TF 100% (Ausnahme STAT-1 beim Kaninchen).

CAT-

Fragment

TF

Name

(trans-Faktor)

Position

human

(Orient.)

Position

Kan.

(Orient.)

Matrix-

hum.

%

Matrix-

Kan.

%

Sequenz

human

(cis-Element)

Sequenz

Kaninchen

(cis-Element)

MZF-1

-22 +

-22 +

97,1

97,1

gttGGGGa

gttGGGGa

CREBP1/cJUN

-52 +/-

-52 +/-

100

85,1

tgACGTca

tgACGTag

-66/79

CREB1

-52 +/-

-52 +

100

96,2

TGACgtca

TGACgtag

AP1/Fos-Jun

-53 -

-53 +

93,2

94,3

cgTGACgtcat

gaTGACgtaga

 

CREB2

-54 +

-54 +

98,2

96,7

gcgaTGACgtca

acgaTGACgtag

ATF1

-56 +

-56 +

98,0

94,5

ccgTGACgtcatcg

cgaTGACgtagaag

ETS-1-p54

-76 +

-76 +

97,4

97,2

tcCGGAagcg

ccCGGAagcg

CREB1

-94 -

-94 -

93,1

93,1

TGACgtgg

TGACgtgg

CREB2

-94 -

-94 -

97,4

91,3

gcggTGACgtgg

gcagTGACgtgg

-166/79

ATF-1

-97 -

-97 -

96,6

95,8

cggTGACgtggcac

cagTGACgtggcac

SP-1

-121 -

-121 -

99,6

99,6

cgggGGCGgggcc

cgggGGCGgggcc

MZF-1

-142 -

95,7

gtcGGGGa

ETS1-p54

-156 +

-163 +

95,1

96,8

ccCGGAtgct

ccCGGAtgtc

NF-1

-182 -

97,3

actTGGCtgggagccgcg

MZF-1

-223 -

98,2

ggcGGGGt

-291/79

SP-1

-224 -

96,7

tgggGGCGgggag

MZF-1

-242 -

-242 -

100

97,4

agtGGGGt

gatGGGGa

NF-1

-254 +

-266 -

94,2

94,2

agtTGGCctccctcccca

ggtTGGCgggggctctat

MZF-1

-294

95,9

gcgGGGGa

-379/79

CP2

-367 +

98,2

gctccacCCAG

S8

-383 -

94,5

ttagaggaATTAaact

TST-1

-385 -

99,3

gaggAATTaaacttt

-918/79

STAT-1

-429 +

-413 +

98,0

98,0

TTCCcagaa

CTCCcagaa

Da funktionelle TF-Bindungsstellen innerhalb intronischer Sequenzen beschrieben wurden, ist im TPT1-Gen nach entsprechenden cis-Elementen gesucht worden. Eine Auswahl von jeweils drei der am besten passenden Faktoren pro Intron faßt Tabelle 8 als Ergebnis der Analyse zusammen. Inwieweit diese TF eine Rolle spielen könnten ist derzeit nicht abzuschätzen, jedoch muß diese Möglichkeit als eher unwahrscheinlich angesehen werden, da sich die regulären Promotorfragmente in den funktionellen Analysen als effiziente Verstärker der Expression erwiesen haben.


86

Tabelle 8 Potentielle Bindungsmotive für TF in Introns des Kaninchen TPT1 Gens

 

TF

(trans-Faktor)

Position

(Orient.)

Matrix

Sequenz

(cis-Element)

CREL 1

233 +

95,3

cggcttTTCC

Intron 1

SP-1

282 +

96,8

gaggGGCGggggc

MZF-1

354 -

97,5

cgcGGGGa

MZF-1

460 +

95,9

gcgGGGGa

Intron 2

CEBPB1

511 +

98,4

aggttgtGCAAtc

MZF-1

525 -

98,2

ggcGGGGa

CP2

1193 -

97,9

gctcaagCCAG

Intron 3

DELTAEF-1

1236 -

95,8

ccccACCTagg

GATA 1

1359 +

96,0

ctagtGATAactga

CDPCR3HD-1

1636 +

98,2

cattGATCtg

Intron 4

NKX25 1

1881 +

98,5

ttAAGTg

NKX25 1

2146 +

100

tcAAGTg

SOX5-1

2822 -

98,4

ctaaCAATct

Intron 5

NF-KAPPAB-1

3170 -

98,3

gggattTTCC

CREL 1

3170 -

98,0

gggattTTCC

5.3. Die Strukturen der TCTP-mRNAs

Die bis dato veröffentlichte Kaninchen TCTP-mRNA Sequenz zeichnete nur ein unvollständiges Bild von dem in vivo vorkommenden Expressionsmuster. Zum einen war die veröffentlichte Sequenz fehlerhaft und unvollständig, zum anderen fehlte bislang der Hinweis auf alternative TCTP-mRNAs. Dies konnte durch Screening einer cDNA-Bank, Northernblotanalysen und Aufklärung der genomischen Situation eindeutig belegt werden und scheint beim Menschen ( Bonaldo et al. 1996 ), und höchstwahrscheinlich auch bei anderen Spezies, ebenso zu sein. In dieser Arbeit werden erstmals die genauen Strukturen der bisher gefundenen Kaninchen TCTP-mRNAs vorgestellt.

Neben der Eleminierung von Sequenzierfehlern konnte eine exakte Bestimmung der 5’UTR vorgenommen werden. Sie hat eine Länge von 116 bp und weist eine hohe Homologie zur Maus- und Humansequenz auf. Die Ermittlung der kompletten 5' UTR Sequenzen von mRNAs aus cDNA Banken ist eine bekannte Schwachstelle, da das 5’-Ende, bedingt durch die Klonierungstechnologie, sehr oft unvollständig ist. Auch die Methode der “primer extension analysis“ hat diesbezüglich ihre Tücken. Bei diesem Verfahren sequenziert man aus der Summe aller cDNAs mit spezifischen Primern Richtung 5'UTR und bestimmt die Abbruchposition. Da es aber oft vorkommt, daß unspezifische Transkripte entstehen, die Folge von stromaufwärts


87

gelegenen Gebieten schwacher Promoteraktivität sind, erhält man hier oft zu lange Transkripte. Die Analyse der TPT1-Pseudogene eröffnete deshalb eine gute Alternative zu den bekannten Verfahren. Prozessierte Pseudogene verstehen sich in diesem Fall als eine Form von in vivo generierter cDNA mit oftmals intakt erhaltenem 5’-Ende. Die vergleichende Analyse mehrerer kaum mutierter prozessierter TPT1-Pseudogene eröffnete deshalb die Möglichkeit, die echten 5’-Enden der TCTP-mRNAs und damit die Position der Transkriptionsinitiation im TPT1-Gen exakt zu rekonstruieren. Es bestätigte sich mit den hier vorgelegten Ergebnissen, daß neben der Maus-mRNA auch die Human- und Kaninchen-TCTP-mRNA einen echten Polypyrimidin-Trakt am 5’-Ende tragen.

Die Erstbeschreibung des TCTP als Q23 geht auf die systematische Suche nach posttranskriptionell regulierten mRNAs zurück ( Yenofsky et al. 1983 ). Der Translationsarrest von TCTP-RNPs in ruhenden Zellen ließ sich ursächlich größtenteils auf Sequenzen in der 5’UTR eingrenzen, obwohl auch Bereiche der 3’UTR involviert zu sein schienen ( Böhm et al. 1991 ). Eine andere Gruppe von mRNAs reagiert ebenso wie TCTP auf exogen-mitogene Stimuli mit einer Aufhebung des Translationsarrestes inaktiver RNPs. Es handelt sich um die Transkripte ribosomaler Proteine wie S16, L32, L7 und anderer ( Jefferies et al. 1994 ). Auf der Suche nach Mechanismen fand man eine konservierte Polypyrimidin-Struktur direkt 5’terminal der mRNA. Allen untersuchten Polypyrimidin-Trakten war ein strikt konserviertes Cytidin am Beginn des Messengers gemeinsam, gefolgt von einer variablen Anzahl von 5-14 Pyrimidinen ( Levy et al. 1991 , Avni et al. 1994 , Severson et al. 1995 , Shama et al. 1996 ). Dieses Strukturmotiv (CY(n)) kommt in den TCTP-mRNAs der bisher 5’UTR-seitig komplett sequenzierten Spezies Kaninchen und Mensch (CTTTTCCG) sowie Maus (CTTTTTTCCG) auch vor. Die Bedeutung des Polypyrimidintraktes für die Translationskontrolle der TCTP-mRNA geht auch aus Hemmstoffstudien mit dem Antibiotikum Rapamycin hervor. Genau wie alle einen funktionellen Polypyrimidin-Trakt enthaltenden Transkripte läßt sich die TCTP-Expression durch Rapamycin in mitogen aktivierten Zellen selektiv blockieren ( Jefferies et al. 1994 ).Dies wird auf eine Hemmung der p70s6k/p85s6k Kinase-Isoformen zurückgeführt, die das 40S ribosomale Protein S6 spezifisch phosphorylieren, jedoch scheinen noch andere Faktoren eine Rolle zu spielen ( Jefferies et al. 1994 ).


88

Eine Besonderheit des TPT1-Gens ist die Fähigkeit zur Generierung unterschiedlich langer mRNAs. Die bisher entdeckten Möglichkeiten der Bildung alternativer Transkripte von einem Gen beinhalten die alternative Verwendung von Transkriptionsstartpunkten, alternatives Spleißen und alternative Polyadenylierung. Jedes der genannten Prinzipien zielt auf andere Strukturen der mRNA. Alternative Promotoren generieren meist unterschiedlich lange 5’UTRs, alternatives Spleißen führt meistens zu Veränderungen in der kodierenden Sequenz und damit der Proteinstruktur (Ausnahmen sind Exons, die alternative UTRs miteinschließen), während alternative Polyadenylierung zu Veränderungen der 3’UTR führt. Ein Beispiel für die Benutzung aller drei Regulationsformen ist das Gen für den TF Zfp-37 ( Mazarakis et al. 1996 ).

Die Northernblots ( Abb. 4-3 , S.41) zeigten zwei TCTP-Signale von 0,8 und 1,2 kb Größe, ohne daß eine Aussage zu Feinstrukturen möglich gewesen wäre. Das Screening der cDNA-Bank führte dann zur Identifizierung eines neuen TCTP-Klones, der sich von der publizierten cDNA neben geringfügigen Sequenzunterschieden durch eine um 320 bp verlängerte 3’UTR unterschied. Zusammen mit der Analyse des TPT1-Gens war klar, daß beide Transkripte vom selben Gen abstammen mußten, da die verlängerte 3’UTR2 ihr Äquivalent im Gen unmittelbar im Anschluß an die 3’UTR1 hatte und dem Abbruchpunkt der 3’UTR2 ein Polyadenylierungssignal unmittelbar vorausging.

Die Frage, die es zu beantworten galt war, worin die Funktionen der unterschiedlichen mRNAs liegen. In der Molekularbiologie steht die Erforschung der untranslatierten Regionen der mRNAs erst am Anfang. Die funktionelle Bedeutung der 3’UTRs eukaryontischer mRNAs wird heute für drei Gebiete diskutiert: Translationseffektivität, Stabilität und intrazelluläre Lokalisation ( Decker und Parker 1995 ). Gesicherte Erkenntnisse gibt es über mRNA destabilisierende, AU-reiche Sequenzmotive, die vor allem bei besonders kurzlebigen mRNAs gefunden werden, wie sie typisch für Messenger von Wachstumsfaktoren und Cytokinen sind ( Scheper et al. 1995 ). Ein gut untersuchtes Beispiel für die Kontrolle der Translationseffektivität über 3’-UTR bindende Proteine ist die 15-Lipoxygenase mRNA ( Ostareck et al. 1997 ). Eine weitere Funktion von 3’UTRs wurde in der intrazellulären Lokalisation des Messengers gezeigt ( Decker und Parker 1995 ). Die TF hunchback, bicoid und Krüppel sind hierfür Beispiele (siehe S. 18.).


89

Es gibt zahlreiche Beispiele für die Existenz von mRNAs mit alternativen 3’-UTRs, deren Bedeutung jedoch nicht immer bekannt ist. Häufig sind Varianten jedoch den oben genannten drei Kategorien zuzuordnen. So ist beispielsweise das lange Transkript der eLF-2a mRNA stabiler als das kurze ( Miyamoto et al. 1996 ). Oft sind mRNAs mit alternativen 3’UTRs gewissen Entwicklungsstadien oder Gewebetypen zuzuordnen. Eine gewebsspezifische Expression alternativer 3’UTRs findet man z.B. bei der 15-Lipoxygenase des Kaninchens ( Thiele et al. 1999 ). Um festzustellen, ob es auch eine Gewebsspezifität der Expression der beiden TCTP-mRNAs gibt, wurden ein mRNA-Dotblot einer Vielzahl von Humangeweben mit einer Sonde von kodierenden Bereichen der TCTP-mRNA und anschließend mit einer 3’UTR2 spezifischen Sonde hybridisiert ( Abb. 4-6 , S. 45). Die Transkriptionsmuster der beiden TCTP-mRNAs erbrachten mehrere neue Erkenntnisse. Eine wichtige Information war, daß TCTP in allen 50 untersuchten Geweben transkribiert wurde, jedoch mit quantitativen Unterschieden von bis zu 1:100. Daraus ließ sich der Schluß ableiten, daß TPT1 weder zu den gewebsspezifischen Genen noch zu den Haushaltsgenen gehört. Die Regulation des TPT1-Genes hängt offenbar von Faktoren ab, die in den untersuchten Geweben unterschiedlich ausgeprägt oder moduliert sind.

Das Verhältnis des kurzen zum langen Messenger erwies sich in den Geweben als nicht konstant ( Abb. 4-7 , S. 46). Einige Hirngewebe wie Hippocampus, Hirnrinde oder Frontalhirn exprimierten im Verhältnis mehr TCTP-mRNA1 zu TCTP-mRNA2 als dies in anderen Geweben, wie Leber, Herz oder Nebenniere der Fall ist. Unbekannt ist der dafür in Frage kommende Mechanismus.

Die hier vorgestellten Experimente haben klargemacht, daß TCTP für alle Gewebsarten gleichermaßen zu einem wichtigen Strukturelement gehört. Alle Daten deuten darauf hin, daß eine genaue Regulierung des Proteinniveaus sowohl im Zellzyklus als auch gewebsspezifisch zu den charakteristischen und notwendigen Eigenschaften des TCTP zählt. Die Analyse der TPT1-Genkotroll-Region lieferte neue Hinweise für eine Involvierung des Gens in bestimmte Signaltransduktionsprozesse und betont damit die Bedeutung der transkriptionellen neben der posttranskriptionellen Regulation. Die Tatsache daß alternative TCTP-Transkripte existieren, die sich nur in der Länge der 3‘UTR unterscheiden macht eine Beteiligung der 3‘UTR an der posttranskriptionellen Regulation wahrscheinlich. Diese drückt sich jedoch scheinbar nicht in einer Gewebsspezifität aus, wie diese Arbeit eindeutig zeigen konnte. Zukünftige


90

Forschungsstrategien sollten sich daher anderen Erklärungsansätzen widmen, wie der Frage nach der intrazellulären Lokalisation der beiden Messengertypen, Untersuchungen zur Stabilität der Transkripte oder ob die beiden TCTP-mRNP-Komplexe abhängig vom Zellzyklus in gleicher Weise mit einer Aufhebung des Translationsarrestes in mitogen stimulierten Zellen reagieren.

5.4. (Un)sinn der Pseudogene

Das Genom des Menschen enthält schätzungsweise 50000-70000 Gene, die nur für einen Bruchteil seiner Größe verantwortlich sind. Woraus die scheinbar überflüssigen restlichen Sequenzen bestehen, beginnt man nach und nach besser zu verstehen. Mit dazu beigetragen hat das humane Genomprojekt, das immer größere Bereiche der DNA offengelegt und einer systematischen Analyse zugänglich gemacht hat. Im Kap 2.4 ist auf wesentliche Bestandteile dieser DNA eingegangen worden.

Prozessierte Pseudogene findet man überwiegend bei Vertebraten, und ihre Genese wie ihre Bedeutung ist bis heute umstritten. Die Mehrzahl der gefundenen Pseudogene dürften keine Funktionen inne haben, da die ORFs durch zahlreiche Mutationen zerstört wurden und ihre Expression generell in Frage steht. Wieso gerade bei höheren Eukaryonten die Tendenz zur Akkumulation selbstischer DNA besteht, wurde durch die Annahme des fehlenden Selektionsdruckes diese Sequenzen zu eleminieren erklärt ( Alberts et al. 1995 ).

Trotzdem wurde immer wieder die Frage nach einer möglichen Bedeutung der Pseudogene gestellt. Diese ergab sich insbesondere bei den im Rahmen dieser Arbeit untersuchten TPT1-Pseudogenen, die durchweg hohe Homologien zu den korrespondierenden cDNAs aufwiesen. Neben den intakten ORFs und wenigen konservativen Aminosäure-Austauschen in der kodierenden Sequenz, legte die überraschenden CAT-Aktivität der 5’ flankierenden Bereiche von zwei der untersuchten Pseudogene eine mögliche Exprimierbarkeit nahe.

Prinzipiell ist die Existenz stark konservierter Pseudogene nicht als ungewöhnlich anzusehen. Jedes Pseudogen müßte zum Zeitpunkt seines Einbaues in das Kerngenom 100% Homologie zu seiner Matrizen-mRNA aufweisen. Von da an divergieren das Gen und das Pseudogen auf getrennten Wegen, das Pseudogen mutiert mit hoher Frequenz, während das Gen unter Selektionsdruck stehend stärker konserviert werden wird. Demzufolge wäre es legitim, die


91

gefunden TPT1-Pseudogene des Kaninchens als evolutionär jung einzustufen. Diese Divergenz erklärt auch, wieso einige TPT1-Pseudogene identische Mutationen aufweisen. Man könnte dies als eine evolutionäre Augenblickaufnahme des Gens zum Zeitpunkt der Pseudogenentstehung betrachten. Auf diese Weise sollten sich neue Einblicke in die Evolution des TPT1-Gens ergeben.

Eine andere Erklärung für die starke Homologie aller näher untersuchten Pseudogene berücksichtigt das Auswahlverfahren der Lambdaklone. Da es sich bei dem Screening der Phagenbanken um Hybridisierungstechniken handelt, sind die stärksten Signale bei den Klonen mit der höchsten Homologie zur eingesetzten Sonde zu erwarten. Außerdem besteht bei stark mutierten Sequenzen die Gefahr, daß sich die Sonde bei den Waschprozeduren wieder ablöst, und somit eine methodisch bedingte Selektion von stark homologen Sequenzen erreicht wurde.

In der Literatur gibt es nur wenige Fälle einer gesicherten Funktionalisierung von Pseudogenen. Von einigen Autoren wird die Existenz eines zweiten Insulingens bei der Ratte und der Maus als solch ein Ereignis gedeutet ( Weiner et al. 1986 ). Diese Gen enthält ein Intron weniger, ZSDs von 41 bp und Poly-A-reiche Sequenzen im Anschluß an die Gensequenz, so daß es sich um den retrograden Einbau einer teilprozessierten Insulin-mRNA handeln könnte. Von anderer Seite wurde bekannt, daß eine Ferritin L Untereinheit der Maus wahrscheinlich von einem intronlosen Gen kodiert wird ( Renaudie et al. 1992 ). Kürzlich wurde ein nicht-prozessiertes Pseudogen der 12-Lipoxygenase des Plättchentyps beim Menschen beschrieben, das in mRNA transkribiert wird, die jedoch nicht funktionell ist (Sun et al. 1999). Intronlose Gene sind bei höheren Eukaryonten wie der Maus ausgesprochen rar, und neben der Möglichkeit des selektiven Verlustes von Introns sind prozessierte Pseudogene als alternative Entstehungsform in Betracht zu ziehen.

Zum jetzigen Zeitpunkt deutet sich an, daß prozessierte Pseudogene tatsächlich Funktionen in Zellen übernommen haben können, dies jedoch nur Ausnahmeerscheinung sind.

Die Existenz von TPT1-Pseudogenen beim Kaninchen und der Maus (Bommer, persönliche Mitteilung) ließ eine ähnliche Konstellation beim Menschen vermuten. Die umfangreichen Daten, die das Human- Genomprojekt derzeit zur Verfügung stellt, legten den Versuch nahe, in Datenbanken nach Anhalspunkten für humane TPT1-Pseudogene zu suchen. In der Tat konnten


92

derartige Sequenzen eindeutig identifiziert werden. In dem einen Falle handelt es sich um ein Pseudogen auf dem Chromosom Xp22. Die Sequenz ist unter der EMBL-Datenbank Zugangsnummer AC002357 in dem Bereich von 136488-137627 bp zugänglich. Das Pseudogen hat eine Sequenzhomologie von 71% mit der humanen TCTP-cDNA2 und enthält somit die verlängerte 3’UTR2. Eine Untersuchung der Sequenz zeigte die für Pseudogene typischen Merkmale multipler Mutationen mit Leserahmenzerstörung, ZSDs und Intronlosigkeit, jedoch keinen typischen Poly-A-Schwanz. Statt dessen findet sich eine kurze A-reiche Sequenz im Anschluß an das 3’Ende.

Im anderen Fall stammt das Pseudogen von der kurzen TCTP-cDNA1-Variante ab. Es befindet sich auf Chromosom 7p15 und ist unter der EMBL-Datenbank Zugangsnummer AC003087 abgelegt. Die korrespondierenden Basen 90214-90995 stimmen zu 77% mit der TCTP-cDNA1 überein. Für die Identität als Pseudogen spricht die Intronlosigkeit, Leserahmenzerstörung und eine in Ansätzen erkennbare ZSD. Einen typischen Poly-A-Schwanz gibt es ebenfalls nicht, jedoch sind die 3’flankierenden Sequenzen sehr auffällig. Nach der zehnmaligen Wiederholung eines GT-Motives folgt eine mehrere hundert bp lange AT-reiche, mikrosatellitenähnliche Sequenz. Interessanterweise fällt der Abbruchpunkt fast unmittelbar mit dem Polyadenylierungssignal der cDNA zusammen. Zusammen mit dem Poly-A-Schwanz würden diese Sequenzen ausreichend komplementär zu den repetitiven genomischen Sequenzen sein, um einen Einbau des Pseudogens an dieser Stelle zu erklären.

Tabelle 9 Die flankierenden Bereiche von zwei humanen TPT1-Pseudogenen vom prozessierten Typ. ZSDs sind unterstrichen.

EMBL

5’ flankierender Bereich

3’ flankierender Bereich

AC002357

.ccttgttaataattggcaatgccaCTTTT

CAGTCtgaaagaaatacttggcaatgctatat...
AC003087

.caatacactcaaaaacacaatataCTTTT

TAGGTgtgtgtgtgtgtgtgtgtgtatatacacac
acacatatatacatatattttatgtatatttatat
ataaatatatattatacatatttatatataatata
tatttatacatatttatatacaaatatatatttat
acatatttatatacaaatatatatacatatttata
tatttatatataatatatatttatatattatatat
tatatatatctattttatatatatctattttatat
atat...

Ein gewisses Problem bereitet die Verifizierung der in vivo Transkribierbarkeit der Pseudogene TPT1-ps2 und TPT1-ps4. Zum einen sind die in vitro Transkription (positive CAT-Assays) noch


93

kein Beweis für die tatsächlich stattfindende in vivo Transkription, da sich die DNA der Pseudogenumgebung in einem inaktivem Chromatinzustand befinden könnte. Beweisend wäre ein TCTP-cDNA-Klon mit dem identischen Mutationsmuster der Pseudogene, nach dem gesucht werden müßte. Alternativ wären PCRs mit die Mutationen überdeckenden Primerkombinationen denkbar. Schwierig ist der Nachweis einer in vivo Translatierbarkeit. In vitro bieten sich zellfreie Transkriptions-/Translationssysteme an.

Zu bedenken ist in diesem Zusammenhang, daß exprimierbare Pseudogene mit knock out Experimenten interferieren könnten. Die kürzlich erwähnten TPT1-Gen knock outs der Hefe ( Sanchez et al. 1997a ) wären davon wahrscheinlich aber nicht betroffen, da prozessierte Pseudogene als besonderes Charakteristikum von Säugetieren in Hefen sehr selten sind. Bei Säugern müßten entsprechende Experimente berücksichtigen, daß prozessierte Pseudogene die Funktion des echten Gens kompensieren könnten.

5.5. Ausblicke

Die in dieser Arbeit vorgestellten Ergebnisse verstehen sich als Einstiegspunkt in die Erforschung der Regulation des TPT1-Gens. Nachdem die Aufklärung der Promotor- und Genstruktur des Kaninchen-TPT1-Gens vollständig, und des humanen Gens vorläufig erfolgte, sind die primären Voraussetzungen für weitergehende Experimente geschaffen worden. Die funktionellen Promotoranalysen, der Promotorvergleich zwischen Mensch und Kaninchen und die Herstellung von induktiven Zusammenhängen haben die Eingrenzung von potentiellen TF-Bindungsstellen über das wahrscheinliche Maß reiner Sequenzanalysen hinaus deutlich erhöht. Vor diesem Hintergrund sollte es möglich sein, gezielter nach funktionellen Aspekten zu suchen. Dazu gehören Reportergen-Analysen, welche die Bedeutung einzelner Faktoren durch gezielte Mutation von cis-Motiven untersuchen. DNA-“Foot print“ Analysen sind weitere etablierte Verfahren um cis/trans-Wechselwirkungen aufzudecken. Das Prinzip dieser Untersuchung besteht in der Maskierung von DNA-Bereichen durch Bindung von TF. Eine nachfolgende Sequenzierreaktion wird durch diese cis/trans-Aggregate gestört, und hinterläßt Aussparungen im Sequenzgel. Somit kann der Bindungsbereich der Proteine dargestellt werden. UV-Vernetzungsexperimente sind dann in der Lage die Molekulargewichte der bindenden Proteine näher zu charakterisieren. Andere Möglichkeiten der weiteren TF-Untersuchungen


94

bieten sich durch gezielten Einsatz von Induktoren bzw. Hemmstoffen der TPT1-Expression an. In Verbindung von Transfektionen mit Reportergenkonstrukten, die die vermuteten cis-Elemente enthalten, ließen sich sowohl die Faktoren identifizieren als auch ihre Beteiligung an der vermuteten PKC-gekoppelten Induktion überprüfen. Die genauere Untersuchung der intrazellulären “second-messenger“-vermittelten Signalwege sollte weiter Aussagen über die beteiligten TF geben, da sie Substrate von verschiedenen Kinasen sind, durch die sie aktiviert oder inaktiviert werden. Dazu gehören z.B. PKC, diverse MAP-Kinasen, Januskinase oder PKA. Viele dieser Kinasen und ihre Isoformen sind durch spezifische Induktoren bzw. Hemmstoffe beeinflußbar. Deren Auswirkungen könnten in Transfektionsexperimenten beobachtet werden. Als weitere Möglichkeit bietet sich die gezielte Ausschaltung einzelner TF unter Beibehaltung der cis-Elemente an. Dies ist durch den Einsatz neutralisierender Antikörper oder “antisense“ RNA realisierbar.

Die Untersuchung der posttranskriptionellen Regulation der Synthese des Kaninchen TCTP war wegen der unvollständig aufgeklärten mRNA-Strukturen bislang nur eingeschränkt möglich. Aufbauend auf den Ergebnissen dieser Arbeit läßt sich dies nunmehr realisieren. Dazu bieten sich zellfreie Transkriptions-/Translationssysteme in Verbindung mit dem Einsatz verschiedener cDNA-Konstrukte an, denen Motive der 5’UTR bzw. 3’UTRs fehlen. UV-Vernetzungsexperimente (“UV-cross-linking“), Gel-Verzögerungsexperimente (“gel-shifts“) sowie RNA-Affinitätschromatographie-Techniken können zur Identifizierung und Isolierung eventuell involvierter Proteinfaktoren beitragen.

Viele offene Fragen zur Funktion des Proteins TCTP, welche im Bereich des Zytoskeletts der Zellen vermutet wird, sind noch zu beantworten. Von medizinischer Seite ist es wichtig zu klären, ob TCTP in die Pathogenese von Krankheiten involviert ist. Dazu gehört es, die Funktion des Proteins als Histaminfreisetzungsfaktor bei Atopikern aufzuklären.

Aus der Beobachtung, daß TPT1-knock-out-Varianten der Hefe lebensfähig waren und nur strukturelle Veränderungen zeigten, läßt sich die mögliche Existenz von genetischen Erkrankungen ableiten, die mit einer mutierten TPT1-Genstruktur einhergehen. Die Kartierung des humanen TPT1-Gens auf Chromosom 13q14.2-21.1 korreliert mit Tumoren bei chronisch lymphatischen Leukämien ( Kalachikov et al. 1997 ). Einige der Tumoren die mit Deletionen in


95

diesem chromosomalen Bereich einhergehen zeigen auffällige strukturelle Veränderungen. Aus diesen Befunden läßt sich einerseits das Vorhandensein eines Tumorsupressorgens ableiten. Andererseits unterstützt dies die These der Lebensfähigkeit von Zellen mit mutiertem oder fehlendem TCTP. Die Suche nach Tumorklonen mit homozygoten Deletionen auf Chromosom 13q14 würde eine interessante Alternative zu „knock outs“ ergeben und als Zellmodell zum Studium der Funktion des TCTP vielfältig eingesetzt werden können. Kürzlich wurde die Nichtdetektierbarkeit von TCTP in einem Nierentumor beschrieben ( Sanchez et al. 1997a ). Hierbei könnte es sich um einen entsprechenden Tumor mit einer Deletion des TPT1-Gens handeln.

Bei der Suche und der Beschäftigung mit dem TPT1-Gen des Kaninchens und des Menschen waren immer wieder die Auswirkungen des humanen Genomprojektes spürbar. War die Suche nach dem Kaninchengen noch sehr zeitintensiv, gestaltete sich diese beim Menschen durch die kommerziellen genomischen Banken viel schneller. Zwei humane TPT1-Pseudogene konnten durch einfache Suche in Sequenzdatenbanken identifiziert werden. In naher Zukunft werden die vollständige genomische Sequenz des Menschen sowie anderer Organismen, und mit ihr alle Gene und Proteine bekannt sein. Die Beschäftigung mit den noch zu tausenden zu entdeckenden Genen, und der daraus resultierenden Beschleunigung des medizinischen und molekularbiologischen Fortschritts wird immens sein und ist derzeit noch nicht abschätzbar. Man kann damit rechnen, daß bald die meisten Krankheiten auf ihre molekularen Ursachen zurückgeführt werden können. Damit sind die Voraussetzungen für kausale Therapieansätze gegeben. Auch die Erforschung der transkriptionellen Regulation von Genen dürfte von dem Wissenszuwachs profitieren. Schon jetzt ist klar, daß ein erheblicher Teil der genomischen Kapazität für TF kodiert. Dies äußert sich eindrucksvoll in der ständig wachsenden Liste entdeckter TF (Mai 1998 - 2376 Faktoren). Bald wird es eine finale Liste von TF geben und die Erforschung von transkriptionellen Zusammenhängen wird systematisch möglich sein. Die gezielte Beeinflussung der Expression auf der Ebene der Transkription ist für die Zukunft ein sehr interessantes medizinisches Konzept. Die nach diesem Prinzip wirkenden Glukokortikoide haben sich z.B. als sehr effektiv für die Behandlung von vielen Erkrankungen, speziell des rheumatischen Formenkreises erwiesen.


[Titelseite] [Widmung] [Einleitung] [Abkürzungsverzeichnis] [1] [2] [3] [4] [5] [6] [Bibliographie] [Danksagung] [Selbständigkeitserklärung] [Lebenslauf] [Anhang]

© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiML DTD Version 2.0
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Mon May 29 13:40:59 2000