[Seite 16↓]

2  Material und Methoden

Einleitend ist die prinzipielle experimentelle Vorgehensweise schematisch abgebildet.

Abb. 2: Schema der prinzipiellen experimentellen Vorgehensweise.

2.1 Präparation von peripheren mononukleären Zellen des Blutes (PBMC)

Die PBMC wurden aus Blut erwachsener Spender mittels Dichtegradientenzentrifugation mit Ficoll-Paque® Plus (Amersham Biosciences, Uppsala, Schweden) nach Angaben des Herstellers isoliert. Ausgangsmaterial waren frische Leukozytenfilter und Buffy coats aus dem Institut für Transfusionsmedizin und dem Eigenblutspendezentrum der Charité. Das Prinzip beruht auf [Seite 17↓]einer von Böyum (1968) entwickelten Methode. Die unterschiedliche Migration während der Zentrifugation aufgrund unterschiedlicher Dichten führt zur Bildung von Schichten verschiedener Zelltypen. (Abb. 3). Die mit PBMC angereicherte Interphase wurde isoliert und bis zur Weiterverarbeitung in PBS/BSA (Deutsches Rheuma-Forschungszentrum Berlin) auf Eis gelagert. Mit dem Ziel der höheren Ausbeute wurden Monozyten aus Buffy coats präpariert. CD4+ T-Zellen konnten in ausreichender Menge aus Leukozytenfiltern gewonnen werden.

Abb. 3: Isolierung von PBMC mittels Ficoll-Paque® Plus-Technik.

2.2 Magnetisch aktivierte Zellsortierung von CD4+ T-Zellen und CD14+ Monozyten

CD4+ T-Zellen und CD14+ Monozyten wurden durch Anwendung der magnetisch aktivierten Zellsortierung (MACS) isoliert (Miltenyi et al. 1990, Radbruch et al. 1994). Es wurde nach Angaben des Herstellers der dabei verwendeten MicroBeadsTM (Miltenyi Biotec GmbH, Bergisch Gladbach, Deutschland) gearbeitet. Dies sind spezielle, mit supermagnetischen Partikeln von weniger als 100 nm Durchmesser konjugierte Antikörper, die gegen die CD4- und CD14-Oberflächenantigene gerichtet waren. Nach der Markierung mit den Antikörpern wurden die Zellen vollautomatisch in einem Hochgradienten-Magnetfeld eines autoMACSTM Separators (Miltenyi Biotec GmbH, Bergisch Gladbach, Deutschland) als Positivfraktion separiert (Abb. 4). Bis zur Weiterverarbeitung wurde die Positivfraktion in Zellkulturmedium auf Eis gelagert.


[Seite 18↓]

Abb. 4: Magnetisch aktivierte Zellsortierung. N = magnetischer Nordpol, S = magnetischer Südpol.

2.3 Zellzählung

Die Zellzahl wurde mit der Neubauer-Zählkammer oder durch automatische Zellzählung in einem Casy® Cell Counter (Schärfe System GmbH, Reutlingen, Deutschland) ermittelt. Die Zählkammermethode wurde außerdem für Vitalitätstests mit 0,04%iger Trypanblaulösung (Sigma Aldrich Chemie GmbH, Steinheim, Deutschland) genutzt. Der Anteil toter Zellen, die durch Trypanblau angefärbt wurden, betrug in der Regel weniger als 5 %.

2.4 Messung des zellulären Sauerstoffverbrauchs

Die Messung des zellulären Sauerstoffverbrauchs erfolgte amperometrisch mit einer Clark-Elektrode (Strathkelvin Instruments, Glasgow, Großbritannien). Grundlage dieser Methode ist eine spezielle Form der Elektrolyse (Rapoport und Raderecht 1989). An die Elektrode wird eine konstante Spannung angelegt. Dadurch entsteht ein Stromfluß, weil an der Kathode Sauerstoff zu Hydroxid-Ionen reduziert wird. Entsprechend dem Diffusionsgesetz strömt aufgrund des Konzentrationsgradienten Sauerstoff aus der Meßlösung nach. Die Sauerstoffkonzentration in der Meßlöung ist der pro Zeiteinheit an der Kathode reduzierten Sauerstoffmenge proportional.


[Seite 19↓]

Die Kalibrierung der Elektrode auf 100 % Sauerstoffgehalt erfolgte mittels Luftsauerstoff-gesättigtem Zellkulturmedium. Dessen Sauerstoffgehalt beträgt bei 37 °C 211 µM, weil sich bei normalem Luftdruck, 20,9 % Sauerstoffgehalt der Luft und 37 °C maximal 4,7 ml Sauerstoff in 1 l Zellkulturmedium lösen. Zur Nullpunktkalibrierung wurde eine hochkonzentrierte Zellsuspension (1x108 Zellen/ml) in die Meßkammer gegeben und mit der Elektrode luftdicht abgeschlossen. Durch die hohe Atmungsrate war der gesamte gelöste Sauerstoff des Zellkulturmediums in kurzer Zeit verbraucht und der Nullpunkt des Meßbereichs erreicht.

Bei der Sauerstoffverbrauchsmessung wurden 700 µl Zellsuspension (0,5-1,5x107 Zellen/ml) in die Meßkammer gegeben (Abb. 5). Während der Messung war die Zellsuspension durch ein angeschlossenes Thermostat (Lauda Dr. R. Wobser GmbH & Co. KG, Lauda-Königshofen, Deutschland) auf 37 °C temperiert. Ein integriertes Rührsystem (Janke & Kunkel GmbH & Co. KG - IKA Labortechnik, Staufen, Deutschland) gewährleistete eine ausreichende Äquilibrierung mit Luftsauerstoff, eine kontinuierliche Durchmischung und eine optimale Diffusion des Sauerstoffs zur Elektrode. Der sich infolge der Zellatmung kontinuierlich vermindernde Sauerstoffgehalt der Meßlösung wurde über ein angeschlossenes Sauerstoffmeßgerät mit integriertem Schreiber (Amersham Biosciences AB, Uppsala, Schweden) als Anstieg einer Kurve registriert (Abb. 6).

Abb. 5: Versuchsaufbau der Sauerstoffverbrauchsmessung. [1] Stopfen mit Clark-Elektrode, [2] Polypropylenmembran, befestigt mit O-Ring, [3] Kanal zur Wirkstoffzugabe, [4] Kabel zum Sauerstoffmeßgerät, [5] Inkubationsgefäß mit Wassermantel, [6] Wasserzu- und [7] -ablauf vom Thermostat, [8] Zellsuspension (rosa) mit Magnetrührstäbchen (weiß), [9] Magnetrührplatte.


[Seite 20↓]

Abb. 6: Originalabbildung eines Sauerstoffverbrauchsexperiments mit PBMC. Durch die Zugabe des Mitogens Con A wird die Atmung angeregt, so daß die gleiche Menge Sauerstoff in kürzerer Zeit verbraucht wird. Die Zugabe des Glucocorticoids bewirkt einen Rückgang der stimulierten Atmung, so daß der Anstieg der Kurve steiler wird. Ab diesem Zeitpunkt nimmt der Sauerstoffverbrauch pro Zeiteinheit wieder ab.

Die Berechnung des Sauerstoffverbrauchs erfolgte nach folgender Formel:

c = Zellzahl, D100 % = Meßbereich, Dx = Anstieg der Kurve

2.4.1 Stimulanzien und Hemmstoffe des zellulären Sauerstoffverbrauchs

Concanavalin A (Con A)

Con A (SERVA Electrophoresis GmbH, Heidelberg, Deutschland) kam als Stimulans des zellulären Sauerstoffverbrauchs von PBMC und CD4+ T-Zellen zum Einsatz. Das Lektin wird aus einer Bohnenart, Canavalia ensiformis, gewonnen. Die Stammlösung, die auch als Arbeitslösung diente, wurde mit A. dest. in einer Konzentration von 5 mg/ml hergestellt.


[Seite 21↓]

Carbonylcyanid 4-Trifluoromethoxyphenylhydrazon (FCCP)

FCCP (Sigma Aldrich Chemie GmbH, Steinheim, Deutschland) ist ein H+-Ionophor und Entkoppler der OXPHOS in den Mitochondrien. Es hat die Fähigkeit, Plasma- und mitochondriale Membranen zu depolarisieren. Dadurch gelingt es Protonen (H+), die innere Mitochondrienmembran zu passieren, ohne die ATP-Synthese anzutreiben. Die Folge ist ein erhöhter Bedarf an Sauerstoff. FCCP wurde in DMSO (Sigma Aldrich Chemie GmbH, Steinheim, Deutschland) in einer Konzentration von 80 mM gelöst. Als Arbeitslösung diente eine 1 mM Lösung.

Myxothiazol

Myxothiazol (Sigma Aldrich Chemie GmbH, Steinheim, Deutschland) stammt vom Myxobakterium Myxococcus vulvus. Es blockiert selektiv und irreversibel den Komplex III der mitochondrialen Atmungskette (Thierbach und Reichenbach 1981). In Abhängigkeit von der Konzentration kann die ATP-Synthese stufenweise bis zur Vollständigkeit unterdrückt werden. Myxothiazol wurde in DMSO in einer Konzentration von 1 mM gelöst. Die Stammlösung sowie die 10- und 100fachen Verdünnungen dienten als Arbeitslösungen.

2.5 Zellaktivierung

2.5.1 Unspezifische Zellaktivierung mit Phorbol-12-Myristat-13-Acetat (PMA) und Ionomycin zur Induktion der Zytokinsynthese bei CD4+ T-Zellen

Nach der Sauerstoffverbrauchsmessung wurden unbehandelte und Myxothiazol-behandelte CD4+ T-Zellen auf eine Konzentration von 4x106/ml eingestellt. Dann erfolgte die PMA- und Ionomycin-Zugabe (Sigma Aldrich Chemie GmbH, Steinheim, Deutschland). Die Zellen wurden über 6 h im Brutschrank (37 °C, 5 % CO2, wasserdampfgesättigte Atmosphäre) (Kendro Laboratory Products GmbH, Osterode, Deutschland) in 1,5 ml-Reaktionsgefäßen (Eppendorf, Hamburg, Deutschland) inkubiert. Zur intrazellulären Anreicherung der Zytokine wurde nach 3 h Brefeldin A (Sigma Aldrich Chemie GmbH, Steinheim, Deutschland) zugesetzt. Brefeldin A ist ein Macrolid-Antibiotikum aus Penicillium brefeldianum. Es unterbindet spezifisch die Translokation von Proteinen vom endoplasmatischen Retikulum zum Golgi-Apparat.

PMA wurde in 70%igem Ethanol (Merck KGaA, Darmstadt, Deutschland) in einer Konzentration von 1 mg/ml gelöst und in einer Endkonzentration von 10 ng/ml eingesetzt. Ionomycin wurde in DMSO in einer Konzentration von 1 mg/ml gelöst und in einer [Seite 22↓]Endkonzentration von 1 µg/ml eingesetzt. Brefeldin A wurde in 70%igem Ethanol in einer Konzentration von 5 mg/ml gelöst und in einer Endkonzentration von 10 µg/ml eingesetzt.

2.5.2 Spezifische Zellaktivierung mit anti-human CD3- und CD28-Antikörpern zur Induktion der Proliferation bei CD4+ T-Zellen

Um die Proliferation zu stimulieren, wurden unbehandelte und Myxothiazol-behandelte CD4+ T-Zellen mit immobilisierten anti-human CD3- (Klon UCHT1, Isotyp mIgG1, Deutsches Rheuma-Forschungszentrum Berlin) und löslichen anti-human CD28-Antikörpern (5 µg/ml) (Klon CD28.2, Isotyp mIgG1, κ, Becton Dickinson GmbH, Heidelberg, Deutschland) stimuliert. Die Kultivierung erfolgte in 96-Loch-Zellkulturplatten (Flachboden, Greiner Bio-One GmbH, Frickenhausen, Deutschland) über 96 h im Brutschrank. Die anti-human CD3-Antikörper waren immobilisiert. Sie wurden in einer Konzentration von 10 µg/ml in PBS (Deutsches Rheuma-Forschungszentrum Berlin) gelöst und durch fünfstündige Inkubation im Brutschrank an den Oberflächen der Zellkulturplatten befestigt. Die CFDA, SE-markierte Zellsuspension (s. Pkt. 2.7.4) wurde auf eine Konzentration von 2x106/ml eingestellt und zu je 250 µl in die inneren Vertiefungen der Zellkulturplatte gegeben. Zum Schutz vor Verdunstung und zur Feuchtigkeitsoptimierung wurden die äußeren Vertiefungen mit zellfreiem Medium gefüllt.

2.5.3 Spezifische Zellaktivierung der CD14+ Monozyten mit Bakterien

Zur Untersuchung der Phagozytoseaktivität von unbehandelten und Myxothiazol-behandelten CD14+ Monozyten wurde ein Phagotest®-Kit (Orpegen Pharma, Heidelberg, Deutschland) verwendet. Das Prinzip beruht darauf, daß Monozyten mit FITC-markierten Escherichia coli-Bakterien bei 37 °C inkubiert werden. FITC dient der durchflußzytometrischen Identifizierung des prozentualen Anteils der phagozytierenden Zellen. Ein Kontrollansatz bleibt auf Eis stehen. Durch die Zugabe einer QuenchlösungTM wird die Phagozytose abgestoppt. Außerdem erlaubt sie die Unterscheidung zwischen phagozytierten und adhärierten Bakterien. Die Erythrozyten werden mit einem LysepufferTM entfernt. Vor der durchflußzytometrischen Analyse wird DNA-Färbelösung dazugegeben. Dadurch werden Aggregationseffekte von Bakterien oder Zellen ausgeschlossen. Datenaquisition und Quantifizierung der Phagozytoseaktivität wurden nach Angaben des Herstellers durchgeführt. Die Inkubationszeit von 10 min wurde aus Gründen der Optimierung auf 1 h verlängert.


[Seite 23↓]

2.6  Zellkultivierung

Die Arbeit mit Zellkulturen und die Zellpräparationen erfolgten an einer Sterilwerkbank (Kendro Laboratory Products GmbH, Osterode, Deutschland).

Zur amperometrischen Messung des Sauerstoffverbrauchs wurden die Zellen in Borsook-Eagle-Medium (BE) ohne oder mit 10 mM Glukose (Merck KGaA, Darmstadt, Deutschland) kultiviert. Das Borsook-Medium enthält als wichtige Bestandteile 19 L-Aminosäuren (alle Sigma Aldrich Chemie GmbH, Steinheim, Deutschland) (Borsook et al. 1971). Das Eagle-Medium ist eine Natriumbicarbonat-freie Lösung aus Hanks’ Salzen (alle Sigma Aldrich Chemie GmbH, Steinheim, Deutschland) (Eagle 1955). Glukose erlaubt neben der Energiegewinnung über die OXPHOS auch die Energiegewinnung über die Glykolyse.

Bei der PMA-Ionomycin-Stimulation erfolgte die Zugabe von 10 % FCS (v/v) (Sigma Aldrich Chemie GmbH, Steinheim, Deutschland), 100 I. E. Penicillin/ml (PAA Laboratories GmbH, Pasching, Österreich), 100 µg Streptomycin/ml (PAA Laboratories GmbH, Pasching, Österreich) und 50 mM β-Mercaptoethanol (Sigma Aldrich Chemie GmbH, Steinheim, Deutschland) zu BE ohne Glukose. Dadurch wird eine optimale zelluläre Mikroumgebung geschaffen und mikrobielles Wachstum unterbunden. Im weiteren Verlauf der Experimente stellte sich heraus, daß eine stärkere PMA-Ionomycin-Stimulation möglich war, wenn BE durch RPMI 1640 (Invitrogen GmbH, Karlsruhe, Deutschland) ersetzt wurde.

Die Titration der T-Zellatmung mit Myxothiazol wurde in RPMI 1640 ohne oder mit 11,1 mM Glukose durchgeführt, weil die Zellen nur in diesem Medium gleichzeitig Myxothiazol-behandelt und stimuliert wurden. Während der Proliferationsexperimente wurden die Zellen ebenfalls darin kultiviert, wobei 10 % FCS (v/v), 100 I. E. Penicillin/ml, 100 µg Streptomycin/ml und 50 mM β-Mercaptoethanol hinzugefügt wurden.

Zum Vergleich des Sauerstoffverbauchs und der Titration der Atmung mit Myxothiazol wurden Monozyten in RPMI 1640 ohne oder mit 11,1 mM Glukose kultiviert. Beim Phagozytosetest wurde dem Medium 10 % (v/v) humanes Serum, Typ AB (PAA Laboratories GmbH, Pasching, Österreich) hinzugefügt.

Alle eingesetzten Seren wurden 30 min bei 56 °C hitzeinaktiviert, um Antikörper, Enzymaktivitäten und die Komplementbindungskapazität zu inaktivieren. Bei der sich anschließenden Sterilfiltration wurden störende Fette entfernt.


[Seite 24↓]

2.7  Fluoreszenzfärbungen

2.7.1 Fixierung von Zellen in Suspension

Nach der PMA-Ionomycin-Stimulation wurden die Zellen mit PBS gewaschen (10 min, 300 g,
4 °C). Das Zellpellet wurde in 2%igem Formaldehyd (1 ml/107 Zellen) (Merck KGaA, Darmstadt, Deutschland) resuspendiert und 20 min bei 21 °C fixiert. Durch Waschen (10 min, 300 g, 4 °C) mit PBA (Deutsches Rheuma-Forschungszentrum Berlin) wurde die Fixierung gestoppt. Bis zur Weiterverarbeitung wurde das Zellpellet bei 4 °C in PBA aufbewahrt.

2.7.2 Intrazelluläre Immunfluoreszenzfärbung von Zytokinen

Die intrazelluläre Zytokinfärbung basierte auf dem Paraformaldehyd-Saponin-Prozedere, das von Sander et al. (1991) beschrieben und durch die Anwendung eines Hemmers des intrazellulären Proteintransports verbessert wurde (Jung et al. 1993). Dabei werden die Zellen nach sechsstündiger in vitro Aktivierung mit PMA und Ionomycin in Anwesenheit eines Proteintransporthemmers geerntet, fixiert und permeabilisiert. Da die Zellen Proteine nicht sezernieren können, werden bei der späteren Analyse Signale meßbar, die normalerweise durch die physiologische Sekretion nicht mehr vorhanden wären.

Zur Permeabilisierung wurden 1x106 fixierte Zellen mit PBA gewaschen (8 min, 500 g, 4 °C), dem 0,5 % (w/v) Saponin (Sigma Aldrich Chemie GmbH, Steinheim, Deutschland) hinzugefügt wurden. Das Zellpellet wurde anschließend 15 min bei Zimmertemperatur im Dunkeln in 100 µl Färbelösung inkubiert. Diese enthielt 0,5 mg polyklonales IgG und die folgenden Fluorochrom-markierten Antikörper: 0,25 µg anti-human IL-2-FITC (Klon MQ1-17H12, Isotyp rIgG2a, Becton Dickinson GmbH, Heidelberg, Deutschland), 0,25 µg anti-human IFN-γ-Cy5 (Klon 4SB3, Isotyp mIgG1, Deutsches Rheuma-Forschungszentrum Berlin), 0,15 µg anti-human IL-4-Cy5 (Klon 4D9, Isotyp mIgG1, Deutsches Rheuma-Forschungszentrum Berlin) und 0,5 µg anti-human TNF-α-FITC (Klon MAb11, Isotyp mIgG1, Becton Dickinson GmbH, Heidelberg, Deutschland). Die Färbung wurde durch Waschen (8 min, 500 g, 4 °C) mit 21 °C-warmer PBA-Saponin-Lösung gestoppt. Dabei wurden überschüssige Antikörper aus dem Zellinneren entfernt. Das Zellpellet wurde in PBA resuspendiert und bis zur durchflußzytometrischen Analyse bei 4 °C aufbewahrt.

2.7.3 Extrazelluläre Immunfluoreszenzfärbung von Zelloberflächenmolekülen

Zur durchflußzytometrischen Validierung der magnetisch aktivierten Zellsortierung wurden die CD4- und CD14-Oberflächenantigene der Zellen unmittelbar nach der magnetisch aktivierten [Seite 25↓]Zelltrennung mit Fluorochrom-markierten Antikörpern (6 µg/ml anti-human CD4-FITC, Klon TT1, Isotyp mIgG1 und 24 µg/ml anti-human CD14-FITC, Klon TM1, Isotyp mIgG1, beide Deutsches Rheuma-Forschungszentrum Berlin) oder MultiTest-ReagenzTM (Becton Dickinson GmbH, Heidelberg, Deutschland) gefärbt. Die Färbung wurde für 10 min auf Eis in einem Gesamtvolumen von 100 µl und mit einer Zellzahl von 1x106 durchgeführt. Sie wurde anschließend durch Waschen (8 min, 500 g, 4 °C) mit eiskaltem PBS/BSA abgestoppt. Bis zur durchflußzytometrischen Analyse wurden die Zellen auf Eis gelagert.

2.7.4 Färbung mit Carboxyfluoresceindiacetatsuccinimidylester (CFDA, SE)

Um die Proliferation von CD4+ T-Zellen durchflußzytometrisch zu analysieren, wurde die Ausgangszellgeneration mit CFDA, SE (Mo Bi Tec GmbH, Göttingen, Deutschland) markiert. Der Fluoreszenzfarbstoff lagert sich spontan und irreversibel an zytosolische und Oberflächenproteine von Zellen an. Durch Zellteilung nimmt die initiale Fluoreszenz ab. So können Tochterzellgenerationen von der Ausgangszellgeneration abgegrenzt werden. Der Farbstoff wurde in DMSO 5 mM gelöst. Die Konzentration in der Färbelösung betrug 1,5 µM. Die Zellen wurden in PBS auf eine Konzentration von 1x107/ml eingestellt und 3,5 min bei
21 °C gefärbt. Die Reaktion wurde durch Waschen (300 g, 10 min, 4 °C) mit FCS-haltigem RPMI 1640 gestoppt.

2.7.5 Färbung mit Propidiumjodid

Um bei der durchflußzytometrischen Analyse lebender Zellen tote Zellen ausschließen zu können, wurde Propidiumjodid (PJ) (Sigma Aldrich Chemie GmbH, Steinheim, Deutschland) unmittelbar vor der Analyse in einer Konzentration von 1 µg/ml der Zellsuspension zugesetzt. Der Fluoreszenzfarbstoff interkaliert zwischen die Basenpaare der DNA und ermöglicht so die Identifizierung bzw. den Ausschluß toter oder sterbender Zellen mit rupturierten Zellmembranen. Nach Anregung zeigen diese Zellen eine rote Fluoreszenz, die ihre Erkennung möglich macht. PJ wurde in einer Konzentration von 1 mg/ml in A. dest. gelöst. Die Arbeitslösung war eine 10fache Verdünnung davon.

2.8 Durchflußzytometrie

Unter Zuhilfenahme der Angaben von Schmitz und Rothe (1994) soll an dieser Stelle das Prinzip der Durchflußzytometrie nur kurz skizziert werden. Bei dem optischen Meßverfahren werden Fluoreszenz- und Streulichteigenschaften einzelner Zellen genutzt, die bei Kontakt mit einem Laserstrahl entstehen. Zur Analyse werden die Zellen, deren Oberflächenantigene [Seite 26↓]und/oder intrazelluläre Strukturen mit Fluorochrom-konjugierten Antikörpern markiert werden können, durch Druckluft einer hydrodynamischen Fokussierung zugeführt und wie an einer Perlenkette an dem Laserstrahl vorbeigeleitet. Bei Kontakt mit dem Laserstrahl werden die Elektronen des Fluoreszenzfarbstoffs angeregt und auf ein höheres Energieniveau angehoben. Anschließend fallen sie unter Energieabgabe auf ihr energetisches Ausgangsniveau zurück. Dabei wird Licht abgegeben, dessen Intensität sich proportional zur Menge an gebundenen Antikörpern je Zelle verhält. Die Analyse von mehreren Fluoreszenzfarbstoffen ist gleichzeitig möglich, weil sie sich durch eine gemeinsame Wellenlänge anregen lassen, aber unterschiedliche und charakteristische Emmissionsspektren zeigen (Tab. 1).

Tab. 1: Verwendete Fluoreszenzfarbstoffe

Fluorochrome

Exzitation [nm]

Fluoreszenz [nm]

Abkürzung

Allophycocyanin

650

660

APC

Annexin V

488

515

-

Carboxyfluorescein-diacetatsuccinimidylester

488

538

CFDA, SE

Fluorescein-Iosothiocyanat

495

525

FITC

Indodicarbocyanin

651

674

Cy5

Peridin-Chlorophyll-Protein

470

680

PerCP

Propidiumjodid

350, 536

611

PJ

Phycoerythrin

488, 565

578

PE

Zusätzlich wird durch unterschiedliche physikalische Zelleigenschaften wie Querschnittsfläche und Refraktionsindex Lichtbrechung und -streuung unterschiedlicher Qualität und Quantität erzeugt. Die Lichtstreuung im Kleinwinkelbereich (0-10°) des einfallenden Laserstrahls wird als Vorwärtsstreulicht oder Forward Light Scatter (FSC) bezeichnet, die im 90°-Bereich als Seitwärtsstreulicht oder Side Scatter (SSC). Das Vorwärtsstreulicht korreliert mit der Zellgröße, das Seitwärtsstreulicht mit der Granularität und Membranfaltung (Abb. 7).

Für die durchflußzytometrische Analyse wurde ein FACS-CaliburTM (Becton Dickinson GmbH, Bergisch Gladbach Deutschland) verwendet, das mit einem Rechner zur Datenakquisition und
-analyse verbunden war. Bei jeder Probe wurden die Daten von mindestens 10.000 Zellen aufgenommen. Die Auswertung erfolgte mit den Softwareprogrammen CellQuestTM (Version [Seite 27↓]3.3, BD Biosciences, San José, USA) und FCS ExpressTM (Version 1.0, De Novo Software, Thornhill, Kanada). Die Daten wurden als eindimensionale Histogramme oder als zweidimensionale Punkt-Bilder (Dot-plots) dargestellt und analysiert.

Abb. 7: Prinzip der Streulicht- und Fluoreszenzmessung am Durchflußzytometer.

2.9 Nachweis von HIF-1α-mRNA mittels semiquantitativer PCR

DNA-Fragmente werden zur weiteren Analyse in großen Mengen benötigt. Die PCR ist eine Methode zur Amplifikation von DNA-Abschnitten mit schon bekannter Sequenz. Sie wurde in den 80er Jahren des vergangenen Jahrhunderts von Mullis und Kollegen entwickelt (Mullis et al. 1986). Im wesentlichen sind in einem PCR-Ansatz vier Komponenten enthalten: (1) Eine isolierte Nukleinsäure aus Zellen oder Geweben. Sie enthält das zu amplifizierende DNA-Fragment. (2) Zwei Oligonukleotide (Primer) rahmen das Fragment ein. Hinzu kommen (3) eine hitzebeständige DNA-Polymerase und (4) die Nukleotide Adenin, Guanin, Cytosin und Thymin. Innerhalb eines PCR-Zyklusses werden drei Teilschritte mit jeweils unterschiedlichen Temperaturen durchlaufen. Während des ersten Schritts bei über 90 °C wird die doppelsträngige DNA denaturiert. Es liegen nur noch DNA-Einzelstränge vor. An diese lagern sich im zweiten Schritt bei über 50 °C die Primer an. Im dritten und letzten Schritt bei über 70 °C kopiert die DNA-Polymerase den durch die Primer eingegrenzten Abschnitt auf der DNA. Am Ende von n PCR-Zyklen enthält das Reaktionsgemisch theoretisch 2n Kopien des betreffenden DNA-Abschnitts.

2.9.1 Isolierung der Gesamt-RNA

Die Isolierung der Gesamt-RNA mittels RNeasy® Mini Kit (Qiagen, Milden, Deutschland) wurde nach Angaben des Herstellers durchgeführt. Dazu gehörten die Zellysis, die Homogenisierung der Lysate, der optionale DNase-Verdau mit einem RNase-freien DNase-Set [Seite 28↓](Qiagen, Milden, Deutschland), die Eluierung der RNA und die spectrophotometrische Bestimmung der RNA-Menge an einem BioanalyzerTM (G2938B, Agilent Technologies Deutschland GmbH, Waldbronn, Deutschland). Ausgangspunkt waren unbehandelte und Myxothiazol-behandelte PMA-Ionomycin-stimulierte CD4+ T-Zellen.

2.9.2 Umschreibung der RNA in cDNA

Die Umschreibung der RNA in cDNA (complementary oder copy DNA) erfolgte nach Angaben des Herstellers des TaqMan® Reverse Transcription Reagents-Kits (Applied Biosystems, Darmstadt, Deutschland). Einzusetzen waren 400 ng isolierte RNA. Das Prinzip beruht darauf, daß die mRNA durch eine reverse Transkriptase in cDNA umgeschrieben wird. Die gewonnene cDNA dient als Matrize für die PCR und wird sofort weiterverarbeitet.

2.9.3 Einstellung der cDNA-Menge

Um einen validen semiquantitativen Vergleich der PCR-Produktmengen zu ermöglichen, war der Einsatz gleicher Ausgangsmengen an cDNA notwendig. Die Einstellung der cDNA-Ausgangsmengen erfolgte anhand der Analyse der Amplifikationsprodukte aus einer PCR, bei der als interner Standard β-Actin-spezifische Sequenzen amplifiziert wurden.

2.9.4 Amplifikation der cDNA

In Tabelle 2 sind die ausgewählten spezifischen Primer für die Amplifikation der HIF-1α- und β-Actin-cDNA gezeigt. Deren DNA-Sequenzen wurden mit Hilfe des Softwareprogramms Oligo® Primer Analysis (National Biosciences, Inc., Plymoth, USA) computergestützt ermittelt.

Tab. 2: Primer zur Amplifikation der HIF-1α- und β-Actin-cDNA

cDNA

Primer

Primersequenz (5’ nach 3’)

Produktlänge

Quelle

β-Actin

forward

reverse

GTGGGGCGCCCCAGGCACCA

CTCCTTAATGTCACGCACGATTTC

489 bp

TIB MOLBIOL Syntheselabor, Berlin, Deutschland

HIF-1α

forward

reverse

AGATACTCAAAGTCGGACAGCC

TTTCTGCTGCCTTGTATAGGAG

453 bp

TIB MOLBIOL Syntheselabor, Berlin, Deutschland

Zur Amplifikation der cDNA wurden auf Eis in einem 0,2 µl-Thermo-StripTM (Rapidozym, Berlin, Deutschland) folgende Substanzen zusammengegeben (Σ = 18 µl): 9,8 µl A. dest., 0,5 µl Taq-Polymerase (5 U/µl) (Bioline GmbH, Luckenwalde, Deutschland), 1 µl Primer forward (10 [Seite 29↓]µM), 1 µl Primer reverse (10 µM), 0,5 µl cDNA, 0,2 µl dNTPs (25 mM), 1 µl MgCl2 (25 mM), 2 µl 10x PCR-Puffer und 2 µl Betain (5 M) (Sigma Aldrich Chemie GmbH, Steinheim, Deutschland). Ein mitgeführter Kontrollansatz enthielt A. dest. anstelle der cDNA. In einem PCR-CyclerTM (Eppendorf, Hamburg, Deutschland) wurde anschließend folgender Zyklus 20-35mal durchlaufen: 5 min 95 °C (Totaldenaturierung), 30 s 95 °C (Zyklusdenaturierung), 30 s 60 °C (Primeranlagerung), 60 s 72 °C (Elongation), 10 min 72 °C (Endelongation), hold 4 °C (Halt). Die Proben wurden auf Eis gestellt und sofort weiterverarbeitet.

2.9.5 Analyse der Amplifikationsprodukte

Die PCR-Produkte wurden in einem 1,5%igen (w/v) Agarosegel (Invitrogen GmbH, Karlsruhe, Deutschland) elektrophoretisch aufgetrennt. Zur Sichtbarmachung der DNA-Fragmente unter UV-Licht enthielt das Agarosegel Ethidiumbromid (Merck KGaA, Darmstadt, Deutschland). Die Laufweiten der verschiedenen DNA-Fragmente wurden anhand eines mitgeführten Molekulargewichtsmarkers (DNA Molecular Weight Marker VI, Roche Diagnostics GmbH, Mannheim, Deutschland) bestimmt. Das Agarosegel wurde mit einer Geldokumentationsanlage (Hama GmbH & Co. KG, Monheim, Deutschland) fotografiert. Die Fotos wurden visuell ausgewertet.

2.10 Nachweis des HIF-1α-Proteins mittels Western Blot-Analyse

Bei der Western-Blot-Analyse werden Proteine gelelektrophoretisch aufgetrennt und danach auf eine Membran transferiert und fixiert. Die Membran wird mit einem Primärantikörper gegen das gesuchte Protein inkubiert. Ein Sekundärantikörper lagert sich in einem zweiten Inkubationsschritt an den Primärantikörper an. Mittels einer enzymkatalysierten Farb- oder Lichtreaktion wird das auf der Membran fixierte Protein sichtbar gemacht.

2.10.1 Tris-Glycin-SDS-Polyacrylamidgel-Elektrophorese

Ausgangspunkt waren unbehandelte und Myxothiazol-behandelte PMA-Ionomycin-stimulierte CD4+ T-Zellen. Die Zellen wurden pelletiert (1 min, 16.000 g, 4 °C) und mit SDS-Gel-Ladepuffer (A. dest. mit 60 mM Tris, 25 % (v/v) Glycerol, 2 % (w/v) SDS, 14,4 mM ME und 0,1 % (w/v) Bromphenolblau) lysiert. Um eine vollständige Denaturierung und Entfaltung aller Proteine zu sichern, wurden unmittelbar vor dem Auftragen alle Proben für 10 min in einen Wärmeblock (Techne Dri-Block® DB 2A, Novodirect GmbH, Kehl am Rhein, Deutschland) bei 95 °C erhitzt.

Lauf- und Sammelgel wurden nach einer Rezeptur von Sambrook et al. (1989) hergestellt. Sie [Seite 30↓]polymerisierten in einer Miniatur-Elektrophoresezelle (Mini-Protean II electrophoresis cell-Kit, Bio-Rad Laboratories GmbH, München, Deutschland) aus. Das Laufgel war ein 10%iges SDS-Polyacrylamidgel. Pro Geltasche wurde das Lysat von 1 Mio. Zellen aufgetragen. Der mitgeführte Marker (Kaleidoscope Prestained Standard, Bio-Rad Laboratories GmbH, München, Deutschland) und die Positivkontrolle, CoCl2-behandeltes HeLa-Zellysat (Becton Dickinson GmbH, Heidelberg, Deutschland), wurden zu jeweils 10 µl aufgetragen.

2.10.2 Western-Blot

Der Western-Blot wurde in einer Mini Tank Blotting Kammer (Bio-Rad Laboratories GmbH, München, Deutschland) durchgeführt. Zur Sichtbarmachung der Proteinbanden wurden die PVDF-Membranen (0,45 µm, Millipore GmbH, Schwalbach, Deutschland) 5 min mit einer Färbelösung aus 0,3 % Ponceau S (Sigma Aldrich GmbH, Steinheim, Deutschland) und 0,3 % TCA (Carl Roth GmbH & Co. KG, Karlsruhe, Deutschland) gefärbt.

2.10.3 Zugabe der Antikörper und Detektion

Um die Membranen für unspezifische Bindungen des Antikörpers zu blockieren, wurden sie 2 h mit Magermilchpulverlösung (AppliChem GmbH, Darmstadt, Deutschland) behandelt. Als Primärantikörper wurde anti-human HIF-1α (Klon 54, Isotyp mIgG1, Becton Dickinson GmbH, Heidelberg, Deutschland) verwendet, als Sekundärantikörper anti-Maus IgG, konjugiert mit Meerrettich-Peroxidase. Der Sekundärantikörper und die Reagenzien für die Enzymreaktion wurden dem ECLTM Western Blotting Analysis System-Testkit (Amersham Biosciences Europe GmbH, Freiburg, Deutschland) entnommen. Mit dem durch Chemolumineszenz freigesetzten Licht der Enzymreaktion wurde ein Autoradiografiefilm (Amersham Biosciences GmbH, Freiburg, Deutschland) belichtet und in einer Entwicklermaschine (Eastman Kodak Company, Rochester, USA) vollautomatisch entwickelt. Die Fotos wurden visuell ausgewertet.

2.10.4 β-Actin-Abgleich

Der β-Actin-Abgleich diente zum Nachweis dafür, daß sich in jeder Geltasche die gleiche Menge Zellmaterial befand. Antikörperzugabe und Detektion waren wie für den HIF-1α-Nachweis beschrieben. Als Primärantikörper wurde ein anti-human β-Actin-Antikörper (Klon AC-15, Isotyp mIgG1, Sigma Aldrich Chemie GmbH, Steinheim, Deutschland) eingesetzt.

2.11 Verwendete Pufferlösungen

PBS: A. dest. mit 136,89 mM NaCl, 2,68 mM KCl, 1,47 mM KH2PO4, 8,10 mM Na2HPO4, [Seite 31↓](alle Carl Roth GmbH & Co. KG, Karlsruhe, Deutschland), pH 7,2

PBA: PBS mit 0,5 % (w/v) BSA (PAA Laboratories GmbH, Pasching, Österreich) und 0,02 % (w/v) NaN3 (Sigma Aldrich Chemie GmbH, Steinheim, Deutschland)

PBS/BSA: PBS mit 0,5 % (w/v) BSA

2.12 Statistische Auswertung

Alle gewonnen Daten wurden mit Hilfe der Softwareprogramme SPSS (Version 11.0, SPSS, Inc., Chicago, USA) und Microsoft Excel (Version 2000, Microsoft Corporation, USA) erfaßt, statistisch ausgewertet und als Mittelwerte ± Standardfehler (S.E.M.) angegeben. Die statistische Signifikanz von Unterschieden zwischen Datengruppen bei unabhängigen Stichproben wurde mit dem nichtparametrischen Mann-Whitney-U-Test, die bei abhängigen mit dem nichtparametrischen Wilcoxon-Test erfaßt. Unterschiede wurden als statistisch signifikant bewertet, wenn die Irrtumswahrscheinlichkeit p ≤ 0,05 war.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
06.06.2005