|
| [page 14↓] |
All materials used, chemicals and cell culture media, if not differently stated, were purchased from Sigma Chemical-Aldrich Co. (Taufkirchen, Germany).
The following table lists the tools and instruments that were used during the experiments:
|
|
Table 1: Tools and instruments used during the experiments.
Animal care and experiments were in conformity with the guidelines of the American Physiological Society and were approved by local authorities (animal experiments register No. G 0240/02, Landesamt für Arbeitsschutz, Gesundheitsschutz und technische Sicherheit Berlin).
Male Wistar rats (initial weight of 180-250 g, Charles River, Sulzfeld, Germany) were used in this study. Animals were housed in the center of the animal laboratory (Tucholsky-Straβe 2, 10117 Berlin, Germany), caged in pairs with free access to food and drinking water in a constant temperature room with a 12-hour dark/12-hour light cycle. The animals were visited daily, and the consumption of food and drinking water and body weight were monitored.
|
| [page 17↓] |
Monoclonal mouse hybrid granny cells of the OX-7 (company center of Applied Microbiology & Research, Salisbury, UK) and mAb 1-22-3 (Gift from Fuijo Shimizu, Nephrology, Niigata University Graduate School of Medical and Dental Sciences, Niigata, Japan) were used. The cells stored at -70°C were transferred under sterile conditions into the following culture medium (Biochrom AG, Berlin, Germany): RPMI 1640 supplemented with 9% fetal calf serum, 1.6% G-50 glucose solution, 0.3% HEPES, 100 U/ml Penicillin and 100 µg/ml Streptomycin in a culture bottle, incubated at 37°C/5% CO 2 and passaged at confluence. The cells were microscopically controlled every 48 hours by means of Tryptan Blue staining, which differentiates vital and non-vital cells. At the same time, the pH of the culture medium was determined. Every two days, the cell culture medium was changed and the cells proliferated. 35 ml cell suspension with 0.5x10 6 /ml cells were transferred into a miniPERM cell culture module (Heraeus Instruments, Hanau, Germany) and put on a lathe fixture (Heraeus Instruments, Hanau, Germany) for being mixed to achieve a better oxygen supply to the cells. When the cells in the culture module reached a density of 8x10 6 /ml, the contents of the culture modules were divided into 4 miniPERM culture modules. After incubation for 24 and/or 48 hours, the medium was changed according to cell growth and the pH of medium. If cell density reached 11.5 x10 6 /ml, 17 ml were taken out of the culture module and stored at 4°C for later purification. The cell culture module was filled up with culture medium again to a total volume of 35 ml.
To purify the IgG fraction, the cell culture suspension was mixed with binding buffer (20 mM sodium phosphate, pH 7.0). The mixture was filled to a pre-equilibrated Protein G column at a flow velocity of 0.5 ml/min. There is a strong affinity between IgG and protein G at pH 7. Then the IgG was eluted with elution buffer (0.1 mol/l glycine-HCl, pH 2.7) and neutralized with 1 mol/l Tris-HCl (pH 9). After extensive dialysis against PBS (Biochrom AG, Berlin, Germany) (pH 7.4) for 24 hours, the antibody concentration was adjusted to 1 mg/ml by reading the absorbance at 280 nm and stored at -70°C until use.
|
| [page 18↓] |
The acute anti-thy1 glomerulonephritis (aGN) model was induced by tail vein injection of monoclonal antibody OX-7 (1 mg/kg body weight in PBS) under light ether (Chinosolfabrik, Seelze, Germany) anesthesia. Control animals were injected with equal volumes of PBS.
In the anti-thy1-induced chronic glomerulosclerosis (cGS) model, before antibody injection, unilateral nephrectomy was performed under anesthesia of 0.1 mg ketanest/ 0.01 mg xylazin per 100 g body weight (ketamin 10%, WDT, Garbsen, Germany; Rompun 2%, Bayer Vital GmbH, Leverkusen, Germany). A small flank incision was made, then the right kidney was separated and removed after the right renal artery, vein and ureter were ligated at the renal pedicle. The monoclonal antibody mAb 1-22-3 was injected at a high dose of 5 mg/kg body weight in PBS three days after uni-nephrectomy. Control animals with and without uni-nephrectomy were injected with equal volumes of PBS.
All animals were fed a normal protein diet (Altromin No.1311, Altromin, Lage, Germany) for at least three days before the start of the experiment to allow equilibration. Dependent on body weight, the drugs were added to the food or the drinking water of treated animals. The calculated amount of the drugs was added to 1 kg flour of the standard rat food stated as above and mixed evenly. Then 600 ml water were added to the mixture and mixed, until a homogeneous dough developed. The dough was strongly rolled out about 1 cm thick and shaped by means of biscuit mold. The biscuits were dried with the help of a warm air fan. The average food and water consumptions of the animals from preliminary tests were about 25 g/day and 50 ml/day. The active substance quantity given is based on this consumption. In order to ensure that the calculated active substance quantity was actually ingested, the food and water consumptions of the treated group were controlled daily.
|
|
Table 2: Contents of the food (average content in 1 kg diet).
|
Contents of breeding diet | |
|
Raw protein |
22.50% |
|
Lysine |
1.20% |
|
Raw fat |
5% |
|
Raw fiber |
4.50% |
|
Raw ash |
6.50% |
|
Calcium |
0.90% |
|
Phosphorus |
0.70% |
|
Vitamin A |
15000 IE |
|
Vitamin D 3 |
600 IE |
|
Vitamin E |
75 mg |
|
Copper |
5 mg |
Bay 41-2272 (10 mg/kg body weight/day) was added to the food meal. This dose has previously been reported to reduce sufficiently the blood pressure in spontaneously hypertensive rats [52]. Bay 41-2272 was generously provided by Dr. Johannes-Peter Stasch, Pharma Research Center, Bayer AG, Wuppertal, Germany.
Hydralazine was given with the drinking water in a dose of 15 mg/kg body weight/day. The dosage was adjusted according to the blood pressure, which in the hydralazine-treated rats should be the same as that of Bay 41-2272-treated rats. Although the precise mechanism of action of hydralazine is not fully understood, it apparently lowers blood pressure by exerting a peripheral vasodilating effect through a direct relaxation of vascular smooth muscles, which might result from the inhibition of the release of Ca 2+ from the sarcoplasmic reticulum [54].
The NO-cGMP signaling cascade was separately analyzed in the injury phase of acute anti-thy1 glomerulonephritis (protocol 1), the matrix expansion phase of acute anti-thy1 glomerulonephritis (protocol 2) and the anti-thy1-induced chronic [page 20↓]glomerulosclerosis (protocol 3). The expression analysis of the NO-cGMP cascade included mRNA expression of eNOS and alpha1 and beta1 sGC. The activity of sGC was determined at basal level and in response to a defined amount of NO in freshly isolated glomeruli and cortical tissues ex vivo.
Six days before antibody injection, male Wistar rats were divided into the following groups:
Treatment with Bay 41-2272 was started 6 days before and continued until 24 hours after OX-7 injection. On the fifth day, systolic blood pressure was measured. On the sixth day, glomerulonephritis was induced and 24-hour urine specimens were collected. The animals were sacrificed 24 hours after disease induction, when mesangial cell lysis develops and inducible glomerular NO production is markedly elevated [55]. In the injury protocol, urinary protein, glomerular cell number, NO production and iNOS mRNA expression were analyzed as indicators of mesangial cell injury.
One day after antibody injection, male Wistar rats were assigned to the following groups:
Bay 41-2272 treatment was started 24 hours after anti-thy1 antibody injection for 6 days, when mesangial cell lysis is complete and the fibrotic response begins [56]. On [page 21↓] the fifth day, systolic blood pressure was measured. On the sixth day, 24-hour urine specimens were collected. The animals were sacrificed seven days after disease induction, when the fibrotic response peaks [16]. In this protocol, urinary protein and parameters of glomerular matrix expansion, including glomerular matrix score and expression of TGF-beta1, fibronectin and PAI-1, were measured. In addition, mRNA expression of P-selectin and immunohistological detection of glomerular macrophage infiltration and fibrinogen deposition were also analyzed.
A 24-hour proteinuria was measured one week after anti-thy1 antibody injection. On the basis of the actual 24-hour proteinuria achieved, the diseased animals were randomized and assigned to the following groups:
To avoid interference with the induction of the disease, Bay 41-2272 and hydralazine treatments were started one week after antibody injection. Systolic blood pressure was assessed in week 8 and the days before sacrifice. 24-hour proteinuria was measured after 1, 4, 8, 12 and 16 weeks. The animals were sacrificed 16 weeks after disease induction. Proteinuria, blood pressure, tissue fibrosis, macrophage infiltration and kidney function were determined. Glomerular and tubulointerstitial changes were analyzed separately. Glomeruli were isolated by a graded sieving technique. Since renal cortex consists mainly of tubulointerstitial tissue (>95%), it was used as representative of the tubulointerstitium. Analysis of fibrosis involved a histological scoring of the matrix accumulation and molecular analysis of the expression of the key fibrosis marker and mediator TGF-beta1, the matrix protein fibronectin and [page 22↓]the matrix degradation inhibitor PAI-1. Tubulointerstitial and glomerular macrophage infiltrations were analyzed by immunohistochemistry using an ED1-antibody. In addition, mRNA expression of the adhesion molecule P-selectin was measured. Blood creatinine and urea concentrations, calculated creatinine clearance and blood hematocrit served as markers of renal function.
For urine collection, the animals were individually housed in metabolic cages for 24 hours. The metabolic cages are equipped with a special funnel and cone design that effectively separates urine from feces, food remainder and water. To avoid excessive bacterial growth and an associated change of some examined parameters, 100 µl penicillin/Streptomycin (10000 U/10000 µg/ml) were pipetted into the urine collection tube. During their accommodation in metabolic cages, the animals had free access to food and drinking water. After 24 hours, urine was collected, centrifuged for 10 min at 10000 rpm to remove particulate matter and frozen for later measurements at -25°C.
At the end of the experiment, the rats were anaesthetized with ketamine and Xylazine and sacrificed. The animals were fixed in an upside-down position. Then the abdominal cavity was opened with a u-shaped cut from penis to both rib elbows endings. Blood was drawn from the lower abdominal aorta until the heartbeat stopped. Ice-cold sterile PBS was then injected, until the heart beat again. Under the liver, the large body artery and the lower vein were clamped and then the lower vein was cut. The kidney was perfused with 40 ml ice-cold sterile PBS under stable pressure. The blood-empty kidneys were then removed and stored in 50 ml ice-cold sterile PBS until further processing. The blood was filled into EDTA-coated tubes, centrifuged at 3000 rpm and 4°C for 10 min, aliquot according to measured parameters, e.g. urea, creatinine and cGMP [20 µl 5 mM IBMX (Alexis GmbH, Grünberg, Germany) was added to 980 µl of plasma to block cGMP degeneration], and they were frozen at -25°C.
|
| [page 23↓] |
The kidneys were separated from fats and capsules. A fifth of the total kidney was separated at a kidney pole. Different parts of the kidney pole were divided for fixing in 10% neutral buffered formalin (Merk, Darmstadt, Germany) and shock-frozen by liquid nitrogen for RNA investigation and then kept at -80°C. Then the remaining kidney tissue was halved and the renal pelvis was cut out with small curved shears. The kidney tissue was chopped up with a blade on an ice-cold glass until a homogeneous viscous mass developed, which was then passed through metal sieves and mechanically broken down to yield glomeruli. The tissue mass was transferred to the highest sieve with the mesh size of 160 µm, pressed by means of glass spatulas and washed with PBS. Tissues accumulated on the second sieve with the mesh size of 125 µm. The tissues were collected and flushed directly and vigorously with PBS several times. The glomeruli accumulated on the lowest sieve with the mesh size of 71 µm and were collected by means of indirect 300 ml PBS washing. The isolated glomeruli were then transferred into a 50 ml PBS tube and centrifuged for 5 min at 1900 rpm and 4°C.
Since renal cortex consists mainly of tubulointerstitial tissue (>95%), it was used as representative of the tubulointerstitium. The kidney cortex was chopped up with a blade on an ice-cold glass, and then 60 mg chopped cortex were taken into 6 ml culture medium at a density of 10 mg/ml for the cortical cell culture.
In protocol 1 (injury phase), basal and LPS-stimulated nitrite production of glomeruli was measured in glomerular culture with or without LPS. In protocol 2 (matrix expansion phase), glomerular TGF-beta1, fibronectin and PAI-1 production and basal and NO-stimulated sGC activity were measured in glomerular culture with or without DEA/NO; in addition, glomerular TGF-beta1 production in vitro in the presence of Bay 41-2272 was also analyzed. In protocol 3 (progression phase), TGF-beta1, fibronectin and PAI-1 production and basal and NO-stimulated sGC activity were measured in glomerular and tubulointerstitial culture with or without DEA/NO. Two or three samples from each animal were analyzed.
|
| [page 24↓] |
The culture medium was made from DMEM supplemented with 0.1 U/ml insulin, 100 U/ml penicillin and 100 μ g/ml streptomycin (Biochrom AG, Berlin, Germany). Cortical cell cultures were set as described above. The isolated and centrifuged glomeruli were resuspended in 5 ml culture medium. 10 µl were taken and extended on a Petri dish in the form of a line. Then glomeruli were microscopically counted and the concentration of glomeruli was adjusted to 2000 per ml. Glomerular concentrations were determined to achieve the comparability of different samples. After 48 hours of incubation at 37 ° C/5% CO 2 , supernatants were harvested and stored at -25°C until analysis of TGF-beta1, fibronectin or PAI-1 contents.
In order to prove the direct regulation of TGF-beta1 production by stimulated sGC independent of blood pressure, glomeruli from 6 normal and 8 nephritic rats (protocol 2) were resuspended in DMEM culture medium at a density of 2000 per ml. The sGC stimulator Bay 41-2272 was added in increasing concentrations: 0, 0.1, 1, 5 and 10 µM. After 48 hours of incubation at 37 ° C/5% CO 2 , supernatants were harvested and stored at -25°C until analysis of glomerular TGF-beta1 production.
In protocol 1 (injury), glomeruli were cultured at a density of 2000 per ml for 48 hours (basal NO glomerular production). Additional samples were cultured in the presence of 10 µg LPS from Escherichia. Coli (serotype 0127:B8) to stimulate inducible NO production (stimulated glomerular NO production). Nitrite served as indicator of NO production and was determined by the Griess reaction in glomerular culture supernatants.
150 µl cortical cells and glomeruli in DMEM were pipetted into a 96-well microplate for further cGMP assessment. The microplate with samples was first prewarmed at 37 ° C/5% CO 2 for one hour, then was added 20 µl 5 mM IBMX and incubated for 10 min to inhibit cGMP degradation. NO-mediated stimulation was studied by addition of 20 µl 1 mM DEA/NO (Alexis GmbH, Grünberg, Germany). After 10 min of incubation, the microplate was put on ice to stop the reaction and added 20 µl 5% dodecytrimethylammonium bromide to facilitate cell lysis. A microscopic evaluation with Trypan blue was carried out to check whether the cells were lysed. Lysed cells were stored at -80 ° C for cGMP ELISA.
|
| [page 25↓] |
The remaining glomeruli were homogenized in Trizol™ Reagent (Invitrogen life technologies, Carlsbad CA, USA). After 5 min of incubation at room temperature, the samples were stored at -80 ° C until RNA isolation.
Systolic blood pressure was measured in trained conscious animals by a tail cuff method with plethysmography [57]. The animals were fixed in a dark acrylic glass pipe. This pipe was kept at a moderate temperature in an ambient chamber. After 5 min acclimatization, a seal with an integrated sensor was put around the rats’ tails about 1 cm before the tail root, and in each case three measurements were made, whose values were averaged. Before the actual beginning of the experiment, the animals were accustomed to the procedure, in order to avoid misleadingly high values caused by stress.
Plasma creatinine and urea levels and creatinine clearance were determined as markers of the excretory kidney function and blood hematocrit was analyzed as the renal endocrine, erythropoietin-producing capacity. Plasma and urine creatinine and plasma urea were determined with the analyzer Hitachi 747-400 (Diamond Diagnostic Inc., Holliston, USA). For the determination, the method of Jaffé is used in this equipment, in which creatinine in alkaline solution and picrate form a yellow-orange colored complex which can be photometrically measured. The color of the complex relates directly to the concentration of creatinine. The creatinine clearance was calculated on the basis of: (Urinary creatinine x urine volume)/ (serum creatinine x collecting time 1440 min). Urea is measured with a kinetic UV test. At first urea reacts with water and is converted by urease into ammonium and carbon dioxide. Then the produced ammonium reacts with α -Ketoglutarat and NADH (nicotine amide adenine dinucleotid hydrogen). The conversion of NADH is afterwards kinetically measured. Hematocrit was determined by the percentage of blood cells in blood plasma after a 10 min/ 3000 rpm centrifugation.
|
| [page 26↓] |
Shortly before the anesthetized rats were sacrificed, the dorsal part of the tail was cut with a standardized incision (10 mm long, 1 mm deep) with a sterile razor blade. The bleeding time was then measured [58].
The total urinary protein was determined by the Pyrogallol red method in a color metric terminator point with the Pyrogallol-Red method kit (Biocon Diagnostik, Marienhagen, Germany). The Pyrogallol-red-molybdate complex used is bound to proteins. The binding causes a shift of the absorbance peak to 600 nm. The color intensity can directly reflect the total protein concentration [59]. Due to the presence of detergents in the reagents, different types of proteins give similar recoveries [60]. The sample concentration could be read by a standard curve consisting of six dilutions with protein concentrations from 0 to 5 g/l. 10 µl standard and/or sample were added to a 96-well microplate. Then 350 µl ready for use reagent were pipetted into each well. Standard dilutions, samples and empty value were measured in duplicate. After 10 min response time, the developed color product could be read photometrically with a wavelength of 570 nm on the plate reader. The protein concentrations of samples were calculated: A (absorbance) sample/A standard x urine volume x dilution=proteins in mg/day.
Nitrites are stable oxidative end products of NO and served as indicators of endogenous NO synthesis [3]. Nitrite levels in cell culture supernatants were measured by the Griess reaction [61]. 10 standard samples (50, 25, 20, 15, 10, 7.5, 5, 2.5, 1, 0 µM) were prepared with sodium nitrite. 50 µl of sample were then mixed with 100 µl Griess reagent [0.05% N-(1-naphthyl) ethylene diamine dihydrochloride, 0.5% sulfanilamide in 45% glacial acetic acid] in 96-well plates. After 10-min incubation in the dark, absorbance was read at 570 nm in an automated plate reader. Then basal and LPS-stimulated glomerular NO production were analyzed.
|
| [page 27↓] |
Kidney tissue was fixed with 10% neutral buffered formalin for 12 hours and then embedded in paraffin. The tissue was transferred to an embed automat after initial drainage in paraffin. The paraffin-impregnated tissue was poured in block and cut 2-3 µm thick with the microtome after hardening. All slides were dried afterwards for 24 hours at 37°C in the reheating furnace. The slides were deparaffinized before the stain procedure.
Uncoated slides were used for PAS staining. The slides were brought into xylene (J.T.Baker, Deventer, Holland) twice for 10 min and transferred afterwards for 2 min into the descending alcohol row (Herbeta-Arzneimittel, Berlin, Germany) (ethanol 100%, 100%, 96%, 96%, 80%, 50%, and distilled water).
For the immunohistological staining, the slides were transferred into fresh xylene twice for 10 min and into each unit of the descending alcohol row for 10 min. Subsequently, the deparaffinized slides were cooked in a pot with citrate buffer by pH 6.5 at 96°C for 10 min and kept in distilled water after cooling until the subsequent procedure. For the immunohistology, the slides remained in distilled water before the embedment with ImmuMount (Thermo Shandon, USA).
For this staining, the following solutions were first set:
After deparaffinization, the slides were placed in 1% periodic acid for 10 min. Then they were washed in running tap water for 5 min and afterwards briefly in disulphide solution. The slides were then brought into the Schiff reagent warmed to 40°C and incubated at 40°C for 20 min. Then the slides were dipped briefly in disulphide solution again and washed in running tap water for 10 min. After 5 min’s counterstain in Meyer’s [page 28↓]hematoxylin (Merk, Darmstadt, Germany), the slides were blued for 10 min in running tap water. Then the slides were transferred into the ascending alcohol row for 1 min (in distilled water, and ethanol 50%, 80%, 96%, 96%, 100%, 100%, and twice xylene) and covered up with Corbit-Balsam (R.Langenbrink, Emmendingen, Germany) (37°C). Stain result: Connective tissue: blue, Cytoplasm: pink, Nucleus: blue-black and Acidic Mucopolysaccharide: bright magenta.
Before the staining, tris-buffered saline (TBS) had to be manufactured. At first two master solutions were set. Master solution A: 0.5 mol/l Tris-solution, consisting of 60.55 g Tris (hydroxymethyl)-aminomethan /1 l distilled water. Master solution B: 1.5 mol/l NaCl solution, consisting of 87.66 g NaCl/1 l distilled water. The master solutions were kept at 4°C. TBS was set before use in the ratio of 1 part solution A +1 part solution B +8 parts distilled water, and then adjusted to pH 7.6 with 0.5 mol/l HCl.
The immunohistological staining of ED1 was accomplished with the paraffin slides in a humidified chamber. The slides were first deparaffinized and brought into the descending alcohol row and cooked in citrate buffer as described above. Then the sections on the slides were circled with a tallow pencil (DAKO Cytomation, Hamburg, Germany) and placed in TBS buffers. Then the sections were blocked with inactivated fetal calf serum for 30 min. The sections were incubated with the primary antibody Mouse anti-Rat ED1 (Serotec GmbH, Düsseldorf, Germany) for 30 min. The antibody was diluted 1:100 with an antibody dilution medium (1 part inactivated fetal calf serum, 1 part RPMI medium, 8 parts distilled water). There were three cuts on each slide. One cut served as negative control and was incubated only with antibody dilution medium instead of the primary antibody. They were rinsed with TBS buffer after the incubation. Then incubation with the secondary antibody Rabbit anti-Mouse-Ig (DAKO) followed for 30 min. After 30 min incubation with APAAP Mouse-Ig (DAKO), the sections were rinsed again with TBS buffer and incubated with the substrate fast red (DAKO) about 5 min. The color was microscopically controlled. Then the sections were rinsed with distilled water and placed in Mayer’s Hematoxylin as counterstaining for 1min. Then they were washed with running tap water for 10 min and covered up with ImmuMount. [page 29↓]Stain result: cell nucleus: blue-black, immunocomplexes: bright red.
The immunohistological staining of fibrinogen was accomplished with the paraffin slides in a humidified chamber. The slides were first deparaffinized and brought into the descending alcohol row and cooked in citrate buffer as described above. Then the sections on the slides were circled with a tallow pencil and placed in TBS buffers. Then the sections were blocked with 3% bovine albumin for 30 min. The sections were incubated with the primary antibody Rabbit anti-Human fibrinogen (DAKO Cytomation, Hamburg, Germany) for 30 min. The antibody was diluted 1:200 with an antibody diluent. There were three cuts on each slide. One cut served as negative control and was incubated only with antibody diluent instead of the primary antibody. They were rinsed with TBS buffer after the incubation. Then incubation with the secondary antibody Mouse anti-Rabbit-Ig (DAKO) followed for 30 min. And then incubation with the third antibody Rabbit anti-Mouse-Ig was executed for 30 min after TBS rinsing. After 30 min incubation with APAAP Mouse-Ig, the sections were rinsed again with TBS and incubated with the substrate fast red about 5 min. The color was microscopically controlled. Then the sections were rinsed with distilled water again and placed in Mayer’s Hematoxylin as counterstaining for 1 min. Then they were washed with running tap water for 10 min and covered up with ImmuMount. Stain result: cell nucleus: blue-black, immunocomplexes: bright red.
All microscopic examinations were performed in a blinded fashion. Three μ m sections of paraffin-embedded tissue were stained with PAS. In protocol 1, the number of cell nuclei was counted in 15 glomeruli of 80-100µm diameter from each animal for calculation of mesangial cell lysis [55]. In protocol 2, the histological evaluation was made by means of light microscopy according to the semiquantitative procedure [56]. The percentage of mesangial matrix-occupying area in 20 glomeruli from each rat was graded as: 0=0%, 1=0-25%, 2=26-50%, 3=51-75% and 4=76-100%. In protocol 3, glomerular matrix expansion was evaluated by rating the mesangial matrix-occupying area in 15 glomeruli from each rat, using the same scoring system as above. [page 30↓] Tubulointerstitial matrix deposition was determined in 15 randomly selected cortical areas per sample observed at x200 magnification, using the following scale: 0=normal, 1=lesions involving less than 10% of cortical area, 2=involving 10-30%, 3=involving 31-50% and 4=involving more than 50%, respectively. ED1 staining representing glomerular macrophage infiltration was counted in at least 15 glomerular sections from each rat, tubulointerstitial macrophage infiltration in at least 15 randomly selected cortical areas per sample observed at x200 magnification, respectively. Due to glomerular deposition of platelets as platelet-fibrinogen aggregates, glomerular fibrinogen staining was used as indirect indicator for glomerular platelet deposition, and glomerular fibrinogen deposition is expressed as the percentage of fibrinogen-positive areas in 15 glomeruli from each rat (0-100%) [58].
An ELISA technology was used for the assessment of the cytokine TGF-beta1, PAI-1, protein fibronectin and cGMP. TGF-beta1 was determined by an ELISA sandwich methodology. The sample is incubated in a microplate precoated with a capture antibody. The antigen in the sample binds with the capture antibody and becomes immobilized. After removal of the unbound antigen, enzyme conjugate is added and then binds with the immobilized antigen to form a sandwich of antibody-antigen-antibody/enzyme bound to the microplate. After the unbound antigen or antibody and free conjugate are washed off, a chromogenic enzyme substrate is added, and reacts with the bound enzyme and produces a color reaction. A quantitative determination of antigen or antibody concentrations is obtained by absorbance measurement of the colored reaction product using a spectrophotometric microwell reader.
PAI-1, fibronectin and cGMP were determined by competitive ELISA. In competitive ELISA of PAI-1 and fibronectin, the antigen is coated onto the inside wall of the microplate. The antigen from the test sample and the antigen coated on the microplate compete for a limited number of primary antibody-binding sites. An enzyme-labeled secondary antibody is added afterwards. In cGMP ELISA, the antibody is coated onto the inside wall of the microplate. The antigen from the test sample and the enzyme-labeled antigen conjugate compete for a limited number of immobilized antibody-binding sites. The amount of antigen-antibody-enzyme complex bound to the solid [page 31↓]phase (microplate) is inversely related to the concentration of antigen present in the sample. After the unbound enzyme antigen conjugate is washed off, chromogenic substrate is added. The bound enzyme conjugate reacts with the chromogenic substrate and produces a color reaction. A quantitative determination of antigen or antibody concentrations is obtained by absorbance measurement of the colored reaction product using a spectrophotometric microplate reader.
The TGF-beta1 concentrations were determined in the cell culture supernatant with a commercially available ELISA kit (TGF-beta1 Duoset™, R&D Systems, Wiesbaden, Germany). A 96-well microplate was coated with 100 µl capture antibody of mouse anti-TGF-beta1 (2 µg/ml) per well and left overnight at room temperature. Each well was aspirated and washed with wash buffer PBST (0.05% Tween20, Boehringer Ingelheim, Heidelberg, Germany, in PBS) and blotted against clean paper towels. The plate was then blocked by adding block buffer (5% Tween20, 5% Sucrose in PBS) and incubated at room temperature for 1 hour. Then the plate was washed again and ready for sample addition. Latent TGF-beta1 in the samples should be first activated to the immunoreactive form. 100 µl samples were acidified with 20 µl 1 mol/l HCl (Merck , Darmstadt, Germany), mixed thoroughly at room temperature for 10 min and then neutralized with 20 µl 1.2 mol/l NaOH/0.5 mol/l HEPES buffer. A standard solution of recombinant human TGF-beta1 (2000 pg/ml) was diluted with Reagent Diluent (1.4% delipidized bovine serum, 0.05% Tween20 in PBS) to form a seven-point standard curve using 2-fold serial dilutions from 2000 pg/ml to 0 pg/ml. 100 µl standard and the activated sample were pipetted into the precoated microplate and incubated for 2 hours at room temperature. Then the aspiration and wash of the microplate were repeated again. 100 µl detection antibody (300 ng/ml), chicken anti-human TGF-beta1, were added to each well and incubated for 2 hours at room temperature. Then the microplate was washed again. 100 µl streptavidin-HRP were added to each well and incubated 20 min at room temperature in the dark. After washing the microplate, 100 µl substrate solution (a mixture of H 2 O 2 and Tetramethylbenzidine) (Biochrom AG, Berlin, Germany) were added to each well and incubated for 20 min at room temperature. Finally, 50 µl 0.18 mol/l H 2 SO 4 (Merck , Darmstadt, Germany) were added to stop the reaction. And [page 32↓] the absorbance of each well was determined at a wavelength of 450 nm immediately. The measured values of the samples were computed according to the standard curve.
A 96-well microplate was coated and left overnight at 4°C with rat fibronectin antigen (200 µg/ml, Sigma, USA), which was dissolved in PBS. Then each well was aspirated and blocked by block buffer (10% bovines’ serum albumin in PBST) and incubated for 1 hour at 37°C. Then the plate was washed with PBST and ready for the addition of samples and standards. The samples can be diluted with DMEM. The fibronectin standard was diluted to concentrations of 2667, 1334, 667, 333, 167, 83, 42, 21, 10, 5, 3 and 0 ng/ml. 50 µl standards and samples were incubated with 50 µl rabbit anti-rat primary antibody (0.6 µg/ml, Chemicon International, Inc. Temecula, Canada) on another non-coated microplate for 1 hour at 37°C. Then 95 µl of the mixture were transferred onto the precoated plate and incubated for 1 hour at 37°C. After a wash phase, 100 µl peroxidase-conjugated secondary antibody (0.3 µg/ml peroxidase-conjugated Affini goat anti-rabbit IgG, Dianova, Hamburg, Germany) were added and incubated at 37°C for 1 hour. After washing, the OPD substrate-complex was added and incubated at room temperature in darkness for 30 min. Finally, the absorbance of each well was measured photometrically at a wavelength of 450 nm, and the concentrations were computed according to the standard curve.
In the same way as with the fibronectin ELISA, a 96-well microplate was first coated with 100 µl rat PAI-1-antigen (3.6 µg/ml, American diagnostica inc. Greenwich, USA) and left overnight at 4°C in PBS. After aspiration of each well, block buffer was added and incubated for 1 hour at 37°C. Then the plate was washed with PBST and ready for the addition of samples and standards. The samples can be diluted with DMEM. Standards were manufactured with concentrations of 1143, 846, 625, 463, 342, 254, 188, 139, 103, 76, 56, and 0 pg/µl. 50 µl standards and samples were incubated with 50 µl rabbit anti-rat primary antibody (100 µg/ml, Oxford Biomedical Research, Michigan, USA) on another non-coated microplate for 1 hour at 37°C. Then 95 µl of the mixture were transferred onto the antigen-coated plate and incubated for 1 hour at 37°C. After a [page 33↓]wash phase 100 µl peroxidase-conjugated secondary antibody were added and incubated for 1 hour. After washing, the OPD substrate-complex was added and incubated at room temperature in darkness for 30 min. Finally, the absorbance of each well was measured photometrically at a wavelength of 450 nm, and the concentrations were computed according to the standard curve.
The cGMP competitive enzymeimmunoassay system (Amersham, Freiburg, Germany) was used in the research. The kit includes novel lysis reagents in order to facilitate simple and rapid extraction of cGMP from cells. Lysis reagent 1 hydrolyses cell membranes to release intracellular cGMP. Lysis reagent 2 sequesters the key component in lysis reagent 1 and ensures cGMP is free for subsequent analysis. The assay is based on competition between unlabelled cGMP (from samples) and a fixed quantity of peroxidase-labeled cGMP for a limited number of binding sites on a cGMP-specific antibody.
The assay buffer working solutions and working standards (0, 2, 4, 8, 16, 32, 64, 128, 256, 512 fmol/well) were prepared as shown in kit. 10 μ l of the acetylation reagent were added to 100 µl standards and samples. 100 μ l rabbit anti-cGMP antibody were added to all wells precoated with donkey anti-rabbit IgG except the blank and NSB (non-specific binding) wells. Then 50 μ l standards and samples were pipetted into the appropriate wells. 150 μ l of assay buffer were pipetted into the NSB wells. The plate was incubated at 3-5 ° C for 2 hours. Then 100 µl diluted peroxidase-labeled cGMP conjugate were added to all wells except the blank. The plate was incubated at 3-5 ° C for 1 hour. Then all wells were aspirated and washed with wash buffer. Immediately, 200 μ l Tetramethylbenzidine substrate were pipetted into all wells. The plate was mixed on a microplate shaker for exactly 30 minutes at room temperature. Finally 100 μ l of 1 mol/l H 2 SO 4 were added to all wells to halt the reaction prior to end point determination. The optical density can be read at 450 nm within 30 minutes. Finally, the concentrations were computed according to the standard curve.
|
| [page 34↓] |
Before the assay, cells would be lysed. After the incubation of culture cells, 20 µl 5% dodecytrimethylammonium bromide were added to the cell culture and mixed on a microplate shaker for 10 min to facilitate cell lysis. This enabled the total (intra- and extracellular) cGMP to be measured. A microscopic evaluation with Trypan blue was carried out to check whether the cells were lysed. Lysed cells were then ready for the assay. The assay buffer working solutions and working standards (0, 2, 4, 8, 16, 32, 64, 128, 256, 512 fmol/well) were prepared as shown in kit. 10 μ l of the acetylation reagent were added to 100 µl standards and samples. 100 μ l rabbit anti-cGMP antibody were added to all wells precoated with donkey anti-rabbit IgG except the blank and NSB wells. Then 50 μ l standards and samples were pipetted into the appropriate wells. 50 µl diluted lysis reagent 1 and 100 μ l diluted lysis reagent 2 were pipetted into the NSB wells. The plate was incubated at 3-5 ° C for 2 hours. Then 100 µl diluted peroxidase-labeled cGMP conjugate were added to all wells except the blank. The plate was incubated at 3-5 ° C for 1 hour. All wells were aspirated and washed with wash buffer. Immediately, 200 μ l Tetramethylbenzidine substrate were pipetted into all wells. The plate was mixed on a microplate shaker for exactly 30 minutes at room temperature. Finally 100 μ l of 1 mol/l H 2 SO 4 were added to all wells to halt the reaction prior to end point determination. The optical density can be read at 450 nm within 30 minutes. Finally, the concentrations were computed according to the standard curve.
Total RNA was extracted by using Trizol Reagent according to the manufacturer’s instructions. 50-100 mg tissue were transferred into 1 ml Trizol reagent and homogenized with homogenizer for 30 sec. The samples were then incubated at room temperature for 5 min. 200 µl chloroform (Merck, Darmstadt, Germany) were added. After 15 sec vigorous vortex of samples, the mixture was incubated at room temperature for 3 min and then centrifuged at 14000 rpm and 4°C for 15 min. RNA remains exclusively in the upper aqueous phase. The aqueous phase was transferred carefully into a fresh tube (about 400-500 µl), and the remainder was discarded. 500 µl [page 35↓] isopropyl alcohol (J. T. Baker, Deventer, Holland) were added. The sample was mixed by gentle inversion and incubated for 10 min at room temperature. Then the sample was centrifuged again at 14000 rpm and 4°C for 10 min. The supernatant was removed and the remaining RNA pellet was washed with 1 ml 75% ethanol (Merck , Darmstadt, Germany), and then centrifuged at 14000 rpm and 4°C for 5 min. The supernatant was removed. The RNA pellet was dried in Laminar Flow for 5-10 min. Then the RNA pellet was dissolved in DEPC-treated water and incubated at 60°C in the thermal mixer for 10 min to ensure total resuspension.
Two investigation procedures to examine the quality and concentration of the isolated RNA content followed. The quality of the RNA was checked on 2% agrose gel electrophoresis. 1 µl RNA was dissolved in 9 µl DEPC-treated water. Then 8 µl bromine-phenol-blue (Carl Roth GmbH, Karlsruhe, Germany) were added and the sample was transferred into gel. The gel was run at 100 volts for 1 hour. Two bands, 18S and 28S ribosomal RNA bands, can be seen under ultraviolet light. The RNA was also spectrophotometrically quantified. 1 µl RNA was mixed with 99 µl DEPC-treated water. The zero value attitude of the spectrometer was made with DEPC-treated water. The sample was measured at a wavelength of 260 nm against zero. The RNA concentration was adjusted to 1 µg/µl with DEPC-treated water. Then the RNA was kept at -80°C until further analysis.
RT-PCR is a highly sensitive method for determining gene expression at the RNA level and for quantifying the strength of gene expression. “Two-step” RT-PCR was used in this research. A cDNA copy is created with reverse transcriptase from the RNA PCR Core kit (Roche, Applied Biosystems, New Jersey, USA).
|
|
Table 3: Mixture of reverse transcription components.
|
Components |
Volume (µl) |
|
MgCl 2 |
4 |
|
10xPCR Buffer |
2 |
|
DEPC-treated water |
2 |
|
dGTP |
2 |
|
2 |
|
|
dTTP |
2 |
|
dCTP |
2 |
|
RNase Inhibitor |
1 |
|
MuLV Reverse Transcriptase |
1 |
|
Random Hexamers |
1 |
|
RNA |
1 (conc. 1 µg/µl) |
The reverse transcription is carried out in a thermocycler using the following conditions. The cDNA obtained in this reaction is then used for the subsequent PCR.
Table 4: Procedure for reverse transcription.
|
25°C |
10 min |
|
42°C |
45 min |
|
95°C |
5 min |
|
4°C |
endlessly |
PCR is a method for oligonucleotide primer-directed enzymatic amplification of a specific DNA sequence of interest. The PCR product is amplified from a DNA template using a heat-stable DNA polymerase and an automated thermocycler to put the reaction through 30 or more cycles of denaturing, annealing of primers and polymerization. Quantitative analysis of changes in molecular targets with PCR plays a key role in scientific research.
The amount of PCR product increases logarithmically in the first few PCR cycles before reaching a plateau. To ensure accurate quantification of the sample concentration, only these first cycles should be considered. The later PCR cycles, which are usually run to ascertain the final amount of PCR product, do not easily permit to drawn conclusions as to starting concentrations. In conventional PCR, an endpoint analysis is carried out in the plateau phase of the PCR by examining the products by the staining of the sample separated by gel electrophoresis. In this research, PCR was checked with a LightCycler System called Real-time PCR [62, 63]. Real-time PCR [page 37↓]refers to the continuous monitoring of the progress of the amplification during the whole PCR reaction and allows measurements to be made during the log-linear phase of a PCR. Utilization of a dsDNA-binding dye, SYBR Green I (Roche Diagnostics GmbH, Mannheim, Germany), is more specific since it only fluoresces when bound to dsDNA. The LightCycler System typically measures fluorescence once every cycle, to monitor the increase in PCR product formation.
The LightCycler System is capable of providing sequence confirmation of the amplified product through an innovative function called melting curve analysis. Each dsDNA product has its own specific melting temperature (Tm). Checking the Tm of a PCR product can thus be compared with analyzing a PCR product by length in gel electrophoresis to examine the purification.
A relative quantification was used, which is based on the relative expression of a target gene versus a reference gene, GAPDH in this study. Amplification is described as N=N0*E∆CP (N: number of amplified molecules; N0: initial number of molecules; E: amplification efficiency; ∆CP: crossing point deviation expressing as ∆CP=CPtarget-CPGAPDH) [64]. In this quantification method, CP is defined as the point at which the fluorescence rises appreciably above the background fluorescence. Finally the N0 of samples were calculated and compared.
A mastermix of the following reaction components was prepared:
Table 5: Mixture of PCR components.
|
Components |
Volume (µl) |
|
MgCl 2 |
1.6 |
|
DEPC-treated water |
11.4 |
|
Template (sense) |
1.5 |
|
Template (antisense) |
1.5 |
|
SYBR Green |
2.0 (Conc. 0.5 µg/µl) |
|
cDNA |
2.0 |
[page 38↓]The template used (TIB Molbiol, Berlin, Germany):
|
Template |
Sequence |
Annealing/Melting Temperature |
|
GAPDH sense antisense |
5´-CCATCTTCCAGGAGCGAGAT-3´ 5´-GATGACCTTGCCCACAGCCT-3´ |
59°C/86°C |
|
eNOs sense antisense |
5´- TCCAGTAACACAGACAGTGC -3´ 5´- CAGGAAGTAAGTGAGAGCCTG -3´ |
61°C/88°C |
|
iNOS sense antisense |
5´- GCAGAATGTGACCATCATGG -3´ 5´- ACAACCTTGGTGTTGAAGGC -3´ |
60°C/86°C |
|
alpha1sGC sense antisense |
5´- CCACATCAACACAGGCTAAT -3´ 5´- GAAGTGCAAGGTTCAGTCTC -3´ |
62°C/86°C |
|
beta1sGC sense antisense |
5´- CGGATGCCACGGTATTGTCT -3´ 5´- CTCCTGGCTTGACGCACATT -3´ |
62°C/84°C |
|
P-selectin sense antisense |
5´- ACCATGACGTGTATCCAGCC -3´ 5´- CCTTCGTCACACATGAACTG -3´ |
61°C/79°C |
|
TGF-beta1 sense antisense |
5´-GGTGGCAGGCGAGAGCGCTGA-3´ 5´-GGCATGGTAGCCCTTGGGCT-3´ |
64°C/86°C |
|
PAI-1 sense antisense |
5´-CAGCATGTGGTCCAGGCCTCCAAA-3´ 5´-TGTGCCGCTCTCGTTCACCTCGATCT-3´ |
64°C/84°C |
|
Fibronectin sense antisense |
5´-GGTCCAAATCGGTCATGTTCCCA-3´ 5´-CGTAATGGGAAACCGTGTAAGGG-3´ |
64°C/86°C |
|
| [page 39↓] |
All values are expressed as mean ± standard error of the mean (SEM). Statistics were analyzed with SPSS 11.0. For normal distributive data analysis, one-way analysis of variance (ANOVA) and an unpaired student’s t -test were used. Regarding the abnormal distributive data, statistical analysis was performed using a Mann-Whitney- U -test. A p value <0.05 was considered significant.
| © Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme. | ||
| DiML DTD Version 4.0 | Zertifizierter Dokumentenserver der Humboldt-Universität zu Berlin | HTML generated: 17.05.2005 |