<?xml version="1.0" encoding="ISO-8859-1"?><cms:container xmlns:cms="http://edoc.hu-berlin.de/diml/module/cms"><cms:document><cms:meta><cms:entry id="front" part="front" ref="front" type="front"/><cms:entry type="title">T-cell mediated suppression of neuroblastoma following fractalkine gene therapy is amplified by targeted IL-2</cms:entry><cms:entry type="author">Yan Zeng, aus Chongqing, V.R.China</cms:entry><cms:entry id="N10072" part="N10072" ref="N10072" type="preface">Preface</cms:entry><cms:entry id="N10079" part="N10072" ref="N10079" type="citenumber">1</cms:entry><cms:entry id="I_Ref124344199" part="N10072" ref="I_Ref124344199" type="link"/><cms:entry id="I_Ref124344202" part="N10072" ref="I_Ref124344202" type="link"/><cms:entry id="I_Ref124344203" part="N10072" ref="I_Ref124344203" type="link"/><cms:entry id="I_Ref124344204" part="N10072" ref="I_Ref124344204" type="link"/><cms:entry id="chapter1" part="chapter1" ref="chapter1" type="chapter">1</cms:entry><cms:entry id="N1009B" part="chapter1" ref="N1009B" type="helpercitenumber">1</cms:entry><cms:entry id="N100A3" part="chapter1" ref="N100A3" type="citenumber">2</cms:entry><cms:entry id="N100AF" part="chapter1" ref="N100AF" type="citenumber">3</cms:entry><cms:entry id="N100B2" part="chapter1" ref="N100B2" type="mm">605#112</cms:entry><cms:entry id="N10102" part="chapter1" ref="N10102" type="citenumber">4</cms:entry><cms:entry id="N10114" part="chapter1" ref="N10114" type="citenumber">5</cms:entry><cms:entry ref="chapter2" type="chapter">2</cms:entry><cms:entry ref="N10127" type="helpercitenumber">5</cms:entry><cms:entry ref="N1012A" type="section">2.1</cms:entry><cms:entry ref="N10133" type="section">2.2</cms:entry><cms:entry ref="N1013A" type="citenumber">6</cms:entry><cms:entry ref="N1014B" type="section">2.3</cms:entry><cms:entry ref="N10150" type="subsection">2.3.1</cms:entry><cms:entry ref="N1015F" type="subsection">2.3.2</cms:entry><cms:entry ref="N10166" type="citenumber">7</cms:entry><cms:entry ref="N10178" type="section">2.4</cms:entry><cms:entry ref="N10193" type="section">2.5</cms:entry><cms:entry ref="N101AC" type="citenumber">8</cms:entry><cms:entry ref="N101AF" type="mm">439#45</cms:entry><cms:entry ref="N101B5" type="section">2.6</cms:entry><cms:entry ref="N101C7" type="section">2.7</cms:entry><cms:entry id="chapter3" part="chapter3" ref="chapter3" type="chapter">3</cms:entry><cms:entry id="N101D8" part="chapter3" ref="N101D8" type="citenumber">9</cms:entry><cms:entry id="N101DE" part="chapter3" ref="N101DE" type="mm">605#178</cms:entry><cms:entry id="N101EA" part="chapter3" ref="N101EA" type="section">3.1</cms:entry><cms:entry id="N101F9" part="chapter3" ref="N101F9" type="section">3.2</cms:entry><cms:entry id="N10200" part="chapter3" ref="N10200" type="citenumber">10</cms:entry><cms:entry id="N10206" part="chapter3" ref="N10206" type="mm">377#209</cms:entry><cms:entry id="N10217" part="chapter3" ref="N10217" type="citenumber">11</cms:entry><cms:entry id="N1021A" part="chapter3" ref="N1021A" type="mm">604#242</cms:entry><cms:entry id="N1022A" part="chapter3" ref="N1022A" type="section">3.3</cms:entry><cms:entry id="N10234" part="chapter3" ref="N10234" type="mm">423#248</cms:entry><cms:entry id="N10248" part="chapter3" ref="N10248" type="citenumber">12</cms:entry><cms:entry id="N10254" part="chapter3" ref="N10254" type="mm">587#364</cms:entry><cms:entry id="N10261" part="chapter3" ref="N10261" type="section">3.4</cms:entry><cms:entry id="N10271" part="chapter3" ref="N10271" type="citenumber">13</cms:entry><cms:entry id="N10274" part="chapter3" ref="N10274" type="mm">605#324</cms:entry><cms:entry id="N1028E" part="chapter3" ref="N1028E" type="mm">605#226</cms:entry><cms:entry id="N1029E" part="chapter3" ref="N1029E" type="section">3.5</cms:entry><cms:entry id="N102A5" part="chapter3" ref="N102A5" type="citenumber">14</cms:entry><cms:entry id="N102B1" part="chapter3" ref="N102B1" type="mm">564#600</cms:entry><cms:entry id="N102C4" part="chapter3" ref="N102C4" type="section">3.6</cms:entry><cms:entry id="N102CE" part="chapter3" ref="N102CE" type="citenumber">15</cms:entry><cms:entry id="N102DA" part="chapter3" ref="N102DA" type="mm">604#328</cms:entry><cms:entry id="N102E7" part="chapter3" ref="N102E7" type="section">3.7</cms:entry><cms:entry id="N1030F" part="chapter3" ref="N1030F" type="citenumber">16</cms:entry><cms:entry id="N10312" part="chapter3" ref="N10312" type="mm">600#247</cms:entry><cms:entry id="N10347" part="chapter3" ref="N10347" type="mm">432#307</cms:entry><cms:entry id="chapter4" part="chapter4" ref="chapter4" type="chapter">4</cms:entry><cms:entry id="N1036E" part="chapter4" ref="N1036E" type="citenumber">17</cms:entry><cms:entry id="N10386" part="chapter4" ref="N10386" type="citenumber">18</cms:entry><cms:entry id="N103B6" part="chapter4" ref="N103B6" type="citenumber">19</cms:entry><cms:entry ref="N103D1" type="back"/><cms:entry id="N103D3" part="N103D3" ref="N103D3" type="abbreviation">Abkürzungsverzeichnis</cms:entry><cms:entry id="N103DA" part="N103D3" ref="N103DA" type="table"/><cms:entry id="N1066E" part="N1066E" ref="N1066E" type="bibliography">Literaturverzeichnis</cms:entry><cms:entry id="N10AA2" part="N10AA2" ref="N10AA2" type="declaration">Anteilserklärung</cms:entry><cms:entry id="N10B62" part="N10B62" ref="N10B62" type="acknowledgement">Acknowledgment</cms:entry><cms:entry id="N10B7A" part="N10B7A" ref="N10B7A" type="declaration">Eidestattliche Erklärung</cms:entry><cms:entry part="chapter2" type=":current"/><cms:entry type=":lang">de</cms:entry><cms:entry id=":contents" part="front" ref=":contents" type=":contents">Inhaltsverzeichnis</cms:entry><cms:entry type=":help"><url href="http://...">Hilfe</url></cms:entry></cms:meta><cms:content><chapter id="chapter2" label="2">
         <head>Material and Methods</head>
         <p><citenumber helper="true" id="N10127" start="5"/>Animals, cell lines, and the tumor model used for this study have been reported [2]. Furthermore, most of the methods used for the in vivo combination therapy strategy with FKN and targeted IL-2 including the construction of a plasmid encoding for mFKN and generation of a stable NXS2 cell clone expressing high levels of mFKN have been published [4]. New methods of unreported results are summarised in the following chapters.</p>
         <section id="N1012A" label="2.1">
            <head>FKN gene expression in NXS2 cells and neuroblastoma tissue was demonstrated by RT-PCR.</head>
            <p>Briefly, total RNA from parental NXS2 cells, mock-transfected NXS2 cells (NXS2 cells transfected with pIRES empty vector) and FKN-transfected cells or primary neuroblastoma tumors formed by these three cell lines was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Reverse transcription was performed with SuperScript (Invitrogen, USA) and cDNA was then used for PCR. PCR amplification was accomplished by using Taq polymerase for 30-35 cycles (95°C for 1 min, 56°C for 1 min, 72°C for 90 s). Primers for FKN are: 5&#8217;- GCTAGCATGGCTCCCTCGCCGCTCGCG-3&#8217; (sense) and 3&#8217;- GAATTCTCACACTGGCACCAGGACGTA-5&#8217; (antisense). Primers for GAPDH which is used as an internal control are: 5&#8217;- CATTGACCTCAACTACATGG -3&#8217; (sense) and 5&#8217;- CACACCCATCACAAACATGG 3&#8217; (antisense). The PCR products were analyzed by agarose gel electrophoresis (1.2%).</p>
         </section>
         <section id="N10133" label="2.2">
            <head>FKN protein expression in vitro and in vivo</head>
            <p>
               <citenumber id="N1013A" start="6"/>The secreted form of mFKN was measured by sandwich ELISA (R&amp;D, USA) according to the protocol provided by the company. Cell culture supernatants were collected from 10<sup>6</sup> parental NXS2 cells, mock transfected cells and NXS2-FKN35 after 24h. The expression of membrane-bound mFKN protein was demonstrated by flow cytometry. 10<sup>6</sup> parental NXS2 cells, mock transfected cells and NXS2-FKN cells were incubated with goat anti-mouse FKN polyclonal antibody (M-18, Santa Cruz, CA) (1 µg/10<sup>6</sup> cells) primary antibody and FITC labeled anti-goat IgG (Calbiochem, San Diego, CA) secondary antibody (10 µg/ml).</p>
            <p>In order to determine the FKN protein expression in vivo, primary neuroblastoma tumors were subjected to immunohistochemistry as previously reported [4].</p>
         </section>
         <section id="N1014B" label="2.3">
            <head>Determination of the chemotactic activity of FKN expressed by NXS2 cells in vitro and in vivo</head>
            <subsection id="N10150" label="2.3.1">
               <head>Migration assay</head>
               <p>2 x 10<sup>5</sup> splenocytes were resuspended in 100µl of serum free RPMI medium and loaded on top of a 5-µm microporous transwell membrane in a 24-well plate (Boyden Chamber; Costar Corp, Cambridge, MA). The bottom of the chamber contained the supernatants collected from NXS2-FKN cells. The migration was compared to serum free medium and recombinant mFKN (R&amp;D, MN, USA) used as negative and positive control, respectively. After 6 hours incubation (37°C, 5% CO<sub>2</sub>), transmigrated cells were manually counted in duplicate. In order to determine the specificity, functional blocking was performed by adding anti-FKN antibody (M-18, Santa Cruz, CA) into supernatants of FKN producing NXS2 cells at a final concentration of 2µg/ml and incubated for 1h at 37°C prior to the migration assay.</p>
            </subsection>
            <subsection id="N1015F" label="2.3.2">
               <head>Immunohistochemistry</head>
               <p>
                  <citenumber id="N10166" start="7"/>Tumor infiltrating leukocytes in primary tumors were determined 3 weeks after inoculation of 2 x 10<sup>6</sup> NXS2 parental cells, NXS2-mock cells, and NXS2-FKN cells in syngeneic A/J mice. Primary tumors were analyzed by immunohistochemistry as described [4]. Briefly, tumor tissues were cryosectioned into 5-µm slides and stored at &#8211;20°C. Slides were incubated with 2.5% blocking serum (goat serum, Vector, CA) and then were incubated with 1.25 µg/ml rat anti-mouse CD4 (RM4-5), CD8 (53-6.7) or CD45 (30-F11) (BDPharmingen, CA, USA), biotin labeled goat anti-rat IgG antibody (Calbiochem, San Diego, CA, USA) streptavidin-peroxidase (Elite ABC reagent, vector, CA). Slides were analyzed under light microscopy and quantification of infiltrating CD4<sup>+</sup>, CD8<sup>+</sup> and CD45<sup>+</sup> cells was performed by counting 10 fields at a magnification of 400 x.</p>
            </subsection>
         </section>
         <section id="N10178" label="2.4">
            <head>In vivo depletion of CD4<sup>+</sup> and CD8<sup>+</sup> T lymphocytes</head>
            <p>In order to assess the role of CD4<sup>+</sup> and CD8<sup>+</sup> T cell subpopulation in the induction of a systemic tumor-protective immunity induced by FKN and ch14.18-IL-2, T cell subpopulations were depleted using anti-CD4 (Gk1.5) and anti-CD8 (53-6.7) antibodies in vivo. Depletion of CD4<sup>+</sup> and CD8<sup>+</sup> T-cells in these mice was accomplished by intraperitoneal injection of 200 µg of anti-CD4, anti-CD8 or PBS on the days &#8211;1, 7 and 14. Mice bearing NXS2-mock cells were used as negative control.</p>
         </section>
         <section id="N10193" label="2.5">
            <head>Cytotoxicity assay </head>
            <p>Cytotoxicity was determined in a standard <sup>51</sup>Cr release assay. Briefly, 2 x 10<sup>6</sup> NXS2 target cells were labelled with 0.5 mCi sodium chromate 51 (PerkinElmer, MA, USA) for 2h at 37°C and seeded into flat bottom 96-well plates at a density of 5000 cells/100µl/well. Splenocytes isolated from each group were co-cultured with irradiated NXS2 (50 Gy, 15min) for 4 days and used as effector cells. Effector cells and target cells were added at various E:T ratios in triplicates to a final volume of 200 µl/well. Supernatants were collected after incubation (6h, 37°C 5% CO<sub>2</sub>) and <sup>51</sup>Cr release was determined in a gamma counter (1470 WIZARD, PerkinElmer, MA, USA). Maximum release was induced with 10% SDS (10µl/well). MHC-class I restriction was determined by addition of anti-H-2K<sup>K</sup> mAb (25 µg/ml, clone 36-7-5, BD PharMingen). Percent cytotoxicity was calculated using the following formular</p>
            <p>
               <citenumber id="N101AC" start="8"/>
               <mm entity="ID_d3e8474" file="image002.gif" id="N101AF" label="439#45"/>
            </p>
         </section>
         <section id="N101B5" label="2.6">
            <head>Flow cytometry</head>
            <p>Cell surface markers and intracellular cytokines expressed by splenocytes were examined by flow cytometry. Splenocytes were prepared as described for the cytotoxicity assay. Staining of surface activation markers was accomplished using 10<sup>6</sup> splenocytes, washed with FACS buffer (PBS, 0.1% BSA, 0.02% NaN3, PH 7.2) and incubated with 1 µg anti-CD3-FITC (145-2C11), anti-CD4-FITC (L3T4), anti-CD8-FITC (Ly-2), anti-CD4-PE (Gk1.5), anti-CD8-PE (53-6.7), anti-CD25-PE (3C7), and anti-CD69-PE (H1.2F3) (BDPharmingen, CA,USA) for 30 min at 4°C, respectively. Intracellular cytokines were analyzed after permeabilization of stimulated splenocytes. Briefly, cells (10<sup>6</sup>) were stimulated in the presence of 50 ng/ml PMA, 1µg/ml ionomycin and 2µM monensine (Sigma, Munich, Germany) (6h, 37°C, 5% CO<sub>2</sub>). After surface staining with 1 µg anti-CD4-FITC and anti-CD8-FITC (4°C, 30 min), cells were fixed with 1% paraformaldehyde in PBS at 4°C overnight, followed by intracellular staining with anti-IFN-&#947;-PE (XMG1.2) and anti-TNF-&#945;-PE (MP6-XT22) (BDPharmingen, CA,USA). Signals were measured with a FACS Calibur and analysed using CellQuest (Becton Dickinson, Mountain View, CA).</p>
         </section>
         <section id="N101C7" label="2.7">
            <head>Statistics</head>
            <p>The statistical significance of differential findings of in vitro assays and between liver weights of experimental groups of animals was determined by two-tailed Student&#8217;s t test. The differential findings of hepatic metastasis scores of liver metastases between experimental groups was determined by the non-parametric Wilcoxon signed rank test. Findings were regarded as significant if two-tailed p values were &lt;0.05.</p>
         </section>
      </chapter></cms:content></cms:document></cms:container>