Material und Methoden

↓28

5.1  Material

5.1.1  Chemikalien

N-[2-Hydroxyethyl]piperazin-N’-

 

[2-ethansulfonsäure] (HEPES)

Serva, Heidelberg

2-[N-Morpholino]ethansulfonsäure (MES)

Merck, Darmstadt

2‘-Desoxynukleosid-5‘-triphosphat (dNTP)

Boehringer Mannheim

Acrylamid/Bisacrylamid 37,5:1

Appligene

Agar-Agar

Roth, Karlsruh

Ameisensäure

Fluka, Steinheim

Ammoniumpersulfat

Serva, Heidelberg

Ampecillin (Amp)

Ratiopharm

Anhydrotetracyclin (aTc)

Acros Organics, USA

Bacto-Trypton

Oxoid, UK

Borsäure

Fluka, Steinheim

Bromphenolblau

Merck, Darmstadt

Coomassie Brillant Blue R250

Roth, Karlsruh

Diethylpyrocarbonat (DEPC)

Sigma, München

di-Natriumhydrogenphosphat-Dihydrat

Merck, Darmstadt

Dithiothreitol (DTT)

Applichem, Darmstadt

Essigsäure

Merck, Darmstadt

Ethanol absolut

J.T. Backer, Holland

Ethidiumbromid

Merck, Darmstadt

Ethylendiamintetraessigsäure (EDTA)

Sigma, München

Glucose

Merck, Darmstadt

Glycerol

Roth, Karlsruh

Glycin

Serva, Heidelberg

Guanidin-Hydrochlorid

Applichem, Darmstadt

Hefe-Extrakt

Oxoid, UK

Imidazol

Applichem, Darmstadt

Iodacetamid

Merck, Darmstadt

Kaliumchlorid

Merck, Darmstadt

L-Arginin-Hydrochlorid

Applichem, Darmstadt

L-Glutathion (GSH)

Applichem, Darmstadt

L-Glutathion (GSSG)

Applichem, Darmstadt

Magnesiumchlorid

Merck, Darmstadt

Magnesiumsulfat

Laborchemie Apolda

Methanol

J.T. Backer, Holland

Milchpulver

Roth, Karlsruh

Natriumcarbonat

Merck, Darmstadt

Natriumchlorid

Merck, Darmstadt

Natriumdihydrogenphosphat

Merck, Darmstadt

Natriumdihydrogenphosphat-Dihydrat

Merck, Darmstadt

Natriumformat

Fluka, Steinheim

Natriumhydrogencarbonat

Merck, Darmstadt

Natriumhydrogenphosphat

Merck, Darmstadt

Natriumhydroxid

Merck, Darmstadt

Paraffinöl

Laborchemie Apolda

Saccharose

Merck, Darmstadt

Salzsäure

Merck, Darmstadt

Schwefelsäure

Merck, Darmstadt

Natriumdodecylsulfat (SDS)

Merck, Darmstadt

N,N,N‘,N‘-Tetramethylethylendiamin (TEMED)

Merck, Darmstadt

Tris-Base

Roth, Karlsruh

Triton X-100

Serva, Heidelberg

Tween 20

Roth, Karlsruh

Universal Agarose

Peqlab, Erlangen

↓29

Alle verwendeten Chemikalien wiesen einen hohen Reinheitsgrad (analytical grade) auf.

5.1.2 Lösungen, Puffer und Nährmedien für Arbeiten mit E. coli

Glycerol

steril autoklaviert

Anhydrotetracyclin (aTc)

5 mg/ml in DMF

Puffer für Periplasmaaufschluss

Periplasmapuffer

100 mM Tris-HCl, pH 8,0

1 mM EDTA

500 mM Saccharose

steril filtriert

Puffer zur Isolierung von Einschlusskörperchen

↓30

Zelllysepuffer

50 mM Tris-HCl, pH 8,0

2 mM EDTA

100 µg/ml Lysozym

0,5 % (v/v) Triton X-100

Waschpuffer A.

50 mM Tris-HCl, pH 8,0

2 mM EDTA

0,5 % (v/v) Triton X-100

0,5 M NaCl

Waschpuffer B.

50 mM Tris-HCl, pH 8,0

2 mM EDTA

Renaturierungspuffer

50 mM Tris-HCl, pH 8,0

2 mM EDTA

0,4 M L-Argenin-Hydrochlorid

3 mM GSH

0,9 mM GSSG

Nährmedien

SOC

20 g/l Bacto-Trypton

5 g/l Hefe-Extrakt

8,6 mM NaCl

10 mM MgCl2

10 mM MgSO4

steril autoklaviert:

20 mM Glucose (steril filtriert)

LB (Luria-Bertani)

10 g/l Bacto-Trypton

5 g/l Hefe-Extrakt

171 mM NaCl

LB mit Agar-Agar

LB

15 g/l Agar-Agar

LB-ls (low salt)

10 g/l Bacto-Trypton

5 g/l Hefe-Extrakt

86 mM NaCl

Alle Medien haben einen pH von 7,5 und sind steril autoklaviert.

5.1.3 Puffer und Lösungen für Proteinexperimente

↓31

10 x PBS (phosphate buffered saline)

1,5 M NaCl

92,7 mM Na2HPO4 * 2H20

16,2 mM NaH2PO4 * 2H20

pH 7,5

steril autoklaviert

TTBS (tween tris buffered saline)

100 mM Tris-HCl, pH 7,5

154 mM NaCl

0,1% (v/v) Tween 20

Peptidspotanalysen

TTBS Peptidspotpuffer

20 mM Tris-HCl pH 7,5

500 mM NaCl

0,01 % (v/v) Tween 20

steril filtriert

ELISA

ELISA-Bindungspuffer

15 mM Na2CO3

35 mM NaHCO3

eine Spatelspitze Phenolrot

pH 9,6, filtriert

ELISA-Waschpuffer

1 x PBS

0,5% (v/v) Tween 20

SPR an Biacore

↓32

HBS (HEPES buffered saline)

10 mM HEPES

150 mM NaCl

3 mM EDTA

0,005% (v/v) Surfactant P20

pH 7,4 (Biacore, Uppsala, Schweden)

Borat-Puffer

0,1 M Borsäure, pH 8,5

Natriumformat-Puffer

0,1 M Natriumformat, pH 4,3

Glycin-Puffer, pH 1,5

Biacore, Uppsala, Schweden

Proteinreinigung

Equilibrierungspuffer

50 mM Natriumphosphat, pH 8,0

300 mM NaCl

Waschpuffer 1

50 mM Natriumphosphat, pH 8,0

500 mM NaCl

20 % (v/v) Glycerol

5 mM Imidazol

0,1 % (v/v) Tween 20

0,5 % (v/v) Triton X-100

Waschpuffer 2

50 mM Natriumphosphat, pH 8,0

300 mM NaCl

10 % (v/v) Glycerol

5 mM Imidazol

Elutionspuffer

50 mM Natriumphosphat, pH 8,0

300 mM NaCl

10 % (v/v) Glycerol

200 mM Imidazol

Regenerationspuffer

20 mM MES, pH 5,0

100 mM NaCl

Lagerungslösung

20 % (v/v) Ethanol

Alle Lösungen wurden steril filtriert, entgast und bei 4°C gelagert.

Puffer, Lösungen und Gele für die SDS-Polyacrylamidelektrophorese

↓33

TE (Tris-EDTA)

10 mM Tris-Base

1 mM EDTA

pH 8,3

Sammelgel

5% (v/v) Acrylamid/Bisacrylamid, 37,5:1

190 mM Tris-HCl, pH 8,8

0,1 % (v/w) SDS

0,1 % (v/w) Ammoniumpersulfat

0,1 % (v/v) TEMED

Trenngel

12 / 15% (v/v) Acrylamid/Bisacrylamid, 37,5:1

390 mM Tris-HCl, pH 8,8

0,1 % (v/w) SDS

0,1 % (v/w) Ammoniumpersulfat

0,04 % (v/v) TEMED

Lade-Puffer, reduzierend

60 mM Tris-HCl, pH 8,8

2% (v/w) SDS

0,003% (v/w) Bromphenolblau

5% (v/v) Glycerol

1,5% (v/w) DTT

Lade-Puffer, nicht reduzierend

60 mM Tris-HCl, pH 8,8

2% (v/w) SDS

0,003% (v/w) Bromphenolblau

5% (v/v) Glycerol

5 mM Iodacetamid

10 x Laemmli-Puffer

250 mM Tris-Base

200 mM Glycin

0,1% (v/w) SDS

pH 8,3

Elektrophorese-Blotpuffer

25 mM Tris-Base

0,2 M Glycin

20% (v/v)Methanol

Coomassie-Färbelösung

0,1% (v/v) Coomassie Brilliant-Blau R-250

7% (v/v) Essigsäure

30% (v/v) Ethanol

filtriert

Coomassie-Entfärbelösung

30% (v/v) Ethanol

7% (v/v) Essigsäure

Coomassie-Fixierer

7% (v/v) Essigsäure

2% (v/v) Glycerol

5.1.4 Puffer und Lösungen für DNA-Experimente

DEPC behandeltes Wasser

0,1% (v/v) DEPC in destilliertem Wasser, autoklaviert

Puffer, Lösungen und Agarosegele für die Elektrophorese

6 x DNA-Probenpuffer

0,25 % (v/w) Bromphenolblau

30 mM EDTA, pH 8,0

30% (v/v) Glycerol

10 x TBE (Tris-Borat, EDTA)

1 M Tris-HCl, pH 8,3

1 M Borsäure

20 mM EDTA

pH 8,3

Ethidiumbromidlösung

10 mg/ml Ethidiumbromid in Wasser

0,8 - 2 % Agarosegele

2,4 - 6 g Agarose

218 µg Ethidiumbromid

ad 300 ml 1 x TBE

5.1.5 Synthetische Oligonukleotide

Primer für PCR, Klonierung und Sequenzierung

↓34

VLHpaIkorB

5'TCCAGATGTTAACTGCTCACTGGATGGTGGGAAGATGGATACAGTCGGTCAGCATCAGCGCGTTTGATCTCGAGCTTGGTGCCTCCTCC3'

9E10oriBstEIIB

5'TGAGGAGACGGTGACCGAGGCTCC3'

9E10oripASK85XbaIF

5'ACAAAATCTAGATAACGAGGGCAAAAAATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCCGAGGTGCACCTGGTGGAGTCTGG3'

pASKVHFOR

5'TAGTTCGACAAAAATCTAGATAACGAGGG3'

pASK88NcoIF

5'ATAATAACCATGGAGAAAATAAAGTG3'

pASK85OmpA

5'GACAGCTATCGCGATTGCAGTGGC3'

Die Primer 9E10oripASK85XbaIF und VLHpaIkorB sind mit HPLC gereinigt worden.

Primer für Mutagenese

XbaIH3QF

5'ACAAAAATCTAGATAACGAGGGCAAAAAATGAAAAAGACCGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCCGAGGTGCAGCTGGTGG3'

VHCDR2germB

5'GGAGATGGTGAAGCGGCCCTTCACAGAGTCTGGATAGTACGTGTAAGAACCACCGCTGCTAATGGTTGC3'

VHFR3germF

5'GGGCCGCTTCACCATCTCCCGTGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCTCTCTGAAGTCTG3'

VHCDR3FR4germB

5'AGAGGAGACGGTGACCGAGGTGCCTTGACCCCAGTAGTCCATAGCATAGTAATGTAGCTAGAACCGTAGTAATAGAATTCGCTGTGGCGTGCACAGTAATAC3'

VHH31SF

5'GCAGCCTCTGGATTCACTTTCAGTTCGTACGGCATGTCTTGGG3'

VHH31SB

5'CCCAAGACATGCCGTACGAACTGAAAGTGAATCCAGAGGCTGC3'

9E10VHG52SB

5'GGGTGTAGGTACCACGTGAAGAGATGGTTGCGACCCATCC3'

9E10VHG52SF

5'GGAGTGGGTCGCACCATCTCTTCACGTGGTACCTACACCC3'

VHS100hY9E10B

5'GGAGACGGTGACCGAGGCTCCTTGGCCCCAGTAGTCCATGCATAGTAATAG3'

VLI30PstI

5'CCATCTCCTGCAGAGCCAGCGAAAGTGTTGATAATTATGGCATCTCTTTTATGAACTGG3'

VLA51B

5'GGTTGGATGCAGCATAGATGAGG3'

VLI51A/R54QFor

5'p-CTCATCTATGCTGCATCCAACCAAGGCTCC3'

VLM78T83S91B

5'TTTGATCTCGAGCTTGGTGCCGCCGCCGAACGTCCACGGAACCTCCTTGGATTGCTGACAGAAATACATTGCAGTATCATCCTCCTCCATAGGATGG3'

VLT91SF

5'p-GTCAGCAATCCAAGGAGGTTCCGTGG3'

VH2H/Yfor
(Griebel, 2005)

5'TGGTACTTACACGTACTATCCAGACAGTGTGAAGGGACGA3'

VH2R/Gfor
(Griebel, 2005)

5'TTGGTTCCGGAGGTACTTACACCCACTATCCAGACAGTGT3'

H/Yfirstfor
(Griebel, 2005)

5'GTCTTGGGTTCGCCAGACTCCAGACAAGAGGCTGGAGTGGGTCGCAACCATTGGTAGTCGTGGTACTTACACGTACTATC3'

R/Gfirstfor
(Griebel, 2005)

5'GTCTTGGGTTCGCCAGACTCCAGACAAGAGGCTGAAGTGGGTCGCAACCATTGGTTCCGGAGGTACTTAC3'

9E10-2ndfor
(Griebel, 2005)

5'CTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTCACTATGGCATGTCTTGGGTTCGCCAGACTC3'

9E10-3rdfor
(Griebel, 2005)

5'GAGGTGCACCTGGTGGAGTCTGGGGGAGACTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGC3'

↓35

Die Mutageneseprimer VLI30PstI und VLA51B sind Gel filtriert, alle anderen mittels HPLC gereinigt. Die hier aufgelisteten Oligonukleotide sind von der BioTeZ Berlin-Buch GmbH hergestellt worden und im mit DEPC behandelten Wasser, wie vom Hersteller empfohlen, gelöst.

5.1.6 Synthetische Peptide

myc-tag-Peptid

NH2-EQKLISEEDLN-COOH

Thermohybaid, Ulm

biotinyliertes myc-tag Peptid

Biotin-GGEQKLISEEDLN-COOH

Rudolf Volkmer, Charité-Universitätsmedizin Berlin

Cys-myc-tag-Peptid

NH2-CGGEQKLISEEDLN-COOH

Peter Henklein, Charité-Universitätsmedizin Berlin

c-myc(408-427)-Peptid

NH2-AEEQKLISEEDLLRKRREQL-COOH

Peter Henklein, Charité-Universitätsmedizin Berlin

Cys-c-myc(408-427)-Peptid

NH2-CAEEQKLISEEDLLRKRREQL-COOH

Peter Henklein, Charité-Universitätsmedizin Berlin

randomisiert, basierend auf c-myc(408-427)-Peptid

NH2-LDIKLQERESRKLRQEEAEL-COOH

Peter Henklein, Charité-Universitätsmedizin Berlin

Alle Peptide sind HPLC gereinigt, massenspektrometrisch analysiert und weisen einen Reinheitsgrad von mindestens 85% (Thermohybaid) bzw. 70-75% auf.

5.1.7 Plasmid und Bakterienstämme

Plasmid

↓36

Plasmid

Genotyp

Herkunft

pASK85-9E10

Tetp/o, anti-humanes-c myc 9E10-VH- und VL-Gen, γ1-His6, κ, OmpA- und PhoA-Signalpeptide, f1 ori, AmpR, ColEI ori

pASK85: A. Skerra (1994)

9E10-Klonierung: U. Griebel (2005)

Bakterienstämme

Stamm

Genotyp

Herkunft

JM83

F- ara, Δ(pro-lac), rpsL, thi, Φ8ÕlacZΔM15, λ-

A. Skerra (TU München)

XL-1-Blue

supE44, endA1, recA1, hsdR17, gyrA46, thi-1, relA1 lac-, lac[FproAB lacIqZΔM15 Tn10(tetr)]

Stratagene

BL21-Gold

E. coli B F- dcm+ Hte ompT hsdS(rB -mB -) gal endA Tetr

Stratagene

5.1.8 Kits, Proteine und sonstige Substanzen

Kits

QIAprep Spin-Plasmidkit

Qiagen, Hilden

QIAquick Gel-Extraktionskit

Qiagen, Hilden

QIAquick PCR-Reinigungskit

Qiagen, Hilden

Biacore Thiol-Kopplungs-Kit

Biacore, Uppsala, Schweden

Restriktionsendonukleasen

↓37

AfI III

NEB (New England Biolabs)

Apa I

Boehringer Mannheim

Bsi WI

NEB

Bsp EI

NEB

Bst EII

NEB

Eco RI

NEB

Hind III

Boehringer Mannheim

Kpn I

NEB

Nco I

Boehringer Mannheim

Pst I

NEB

Sfa NI

NEB

Sty I

Boehringer Mannheim

Xba I

Boehringer Mannheim

Xho I

NEB

Xho II

NEB

Polymerasen und Ligase

Pfu-DNA-Polymerase

Promega

T4-Ligase

Roche

Taq-DNA-Polymerase

Quantum

Antikörper und sonstige Proteine

anti-c-myc-9E10-Fab

Hybridom, G. Winter, Cambridge, Expression und Reinigung, H. Tanzmann u. Ch. Scholz, Charité, Berlin

anti-His(6)-tag-HRP-Konjugat

Upstate

anti-Maus-IgG1-kappa-HRP-Konjugat

DPC Biermann, Bad Nauheim

anti-Maus-Ig-HRP-Konjugat

Amersham Life Science

anti-Maus-IgG(Fab)-HRP-Konjugat

Sigma-Aldrich

Molekularmassenmarker Rainbow low/high

Amersham Life Science

ImmunoPure Avidin

Pierce

Lysozym

Sigma-Aldrich

Sonstige Substanzen

↓38

2-Log DNA Ladder

NEB

Smart DNA Ladder

Eurogentec

UP99619 Uptilight HRP Blot-Substrat

Interchim

Gelafusal

Biotest Pharma, Dreieich

10 x Spots Blocking Buffer

Sigma-Aldrich

Talon (Co2+-Sepharose)

Clontech

TMB Substrat-Lösung Seramunblau

Seramun, Dolgenbrodt

5.2 Methoden

5.2.1  Herstellung der 9E10-Rückmutanten

5.2.1.1  Ortsgerichtete Mutagenese mittels PCR

Die Rückmutationen in den variablen Regionen des 9E10 im pASK85 (Griebel, 2005) wurden mit Hilfe der PCR durch Einbau der gewünschten Punktmutationen in den PCR-Primer erzielt. Hierzu wurden zwei Ansätze verfolgt. Erstens, Amplifikation einzelner DNA-Fragmente mit anschließendem Einbau in den Vektor und zweitens, Amplifikation des gesamten pASK85-Vektors.

1. Amplifikation einzelner DNA-Fragmente aus dem pASK85-9E10

Der in Tabelle 5.1. angegebene allgemeine PCR-Ansatz wurde für ein Reaktionsvolumen von 100 µl zusammengestellt.

↓39

Tabelle 5.1. : PCR-Ansatz und Syntheseprogramm für die Herstellung der Konstrukte HH31S, GH52S, SH100hY, FL30I, LKeimbahn und HKeimbahn .

PCR-Ansatz:

Syntheseprogramm:

 

Endkonzentration

Temperatur

Zeit

Zyklen

DEPC behandeltes H2O

ad 100 µl

Denaturierung 95°C

2 min

1

10 x Taq-Puffer

1 x

Denaturierung 95°C

60 sec



30

dNTPs (10 mM jedes)

200 µM jedes

Annealing
50°C

60 sec

Primer I (10 pmol/µl)

0,5 µM

Synthese
72°C

60 sec

Primer II (10 pmol/µl)

0,5 µM

Endsynthese
72°C

5 min

1

Taq/Pfu-Gemisch (20 U : 1 U)

0,02 U/µl

    

pASK85-9E10
(100-200 ng/µl)

1-2 ng/µl

    

Nachdem die Ansätze mit einem Tropfen Paraffinöl verschlossen worden waren, wurde die Synthese der DNA in einem Thermocycler (Varius TCV 5*9 von Landgraf, Hannover) nach dem Syntheseprogramm in Tabelle 5.1. gestartet. Zur Vermeidung von Kontaminationen wurde ein Kontrollansatz ohne Vektor mitgeführt.

Für die Herstellung der Rückmutanten HH31S, GH52S, SH100hY, FL30I, LKeimbahn und HKeimbahn wurden die in Tabelle 5.2. aufgeführten Primer genutzt. Die Amplifikation einzelner Genabschnitte bzw. ganzer Gene aus dem pASK85-9E10 erfolgte in einer bzw. zwei PCR-Reaktionen nach dem PCR-Ansatz und dem Syntheseprogramm in Tabelle 5.1.. Die Einzelrückmutanten RH53G, HH58Y wurden in vier aufeinanderfolgenden PCR-Reaktionen nach dem PCR-Ansatz und dem Syntheseprogramm der Tabelle 5.1. hergestellt. In den Tabellen 5.3. und 5.4 werden Angaben zu den verwendeten Primern, der Templatemenge, der Annealingtemperatur im Thermocycler sowie der Größe der amplifizierten Fragmente in jeder PCR-Reaktion gemacht. Im Anschluss daran erfolgten die Trennung der PCR-Proben mittels Agarosegelelektrophorese und die Isolation der gewünschten DNA-Banden aus dem Gel (Tabellen 5.3. - 5.4.) mit dem QIAquick Gel-Extraktionskit des Herstellers Qiagen.

↓40

Tabelle 5.2.: In der PCR eingesetzte Primer für die Herstellung der Konstrukte HH31S, GH52S, SH100hY, FL30I, LKeimbahn und HKeimbahn und Größe der amplifizierten DNA-Fragmente.

Konstrukt

Primer für PCR 1.

Endprodukt

Primer für PCR 2.

Endprodukt

HH31S

pASKVHFor,
VHH31Sback

207 bp

9E10oriBstEIIB,
VhH31SFor

317 bp

GH52S

pASKVHFor,
9E10VHG52SB

266 bp

9E10oriBstEIIB,
9E10VHG52SF

247 bp

SH100hY

pASKVHFor
VHS100hY9E10B

470 bp

/

/

FL30I

VLI30Pst1
VLHpaIkorB

ca. 300 bp

/

/

LKeimbahn

VLI30PstIF
VLA51B

113 bp

VLI51A/R54QFor
VLM78T83S91B

184 bp

HKeimbahn

XbaIH3Qfor
VHCDR2germB
Template: pASK85-9E10(VHH31S)

304 bp

VHFR3germF
VHCDR3FR4germB

187 bp

Tabelle 5.3. : Herstellung von RH53G

PCR

Primer

Template

Annealingtemperatur

Endfragment

1.

9E10oriBstEIIB
VH2R/Gfor

55 °C

230 bp

2.

9E10oriBstEIIB
R/Gfirstfor

2 µl PCR 1. Produkt

50 °C

280 bp

3.

9E10oriBstEIIB
9E102ndfor

2 µl PCR 2. Produkt

48 °C

330 bp

4.

9E10oriBstEIIB
9E103rdfor

20 µl PCR 3. Produkt

48 °C

381 bp

Tabelle 5.4. : Herstellung von HH58Y

PCR

Primer

Template

Annealingtemperatur

Endfragment

1.

9E10oriBstEIIB
VH2H/Yfor

50 °C

220 bp

2.

9E10oriBstEIIB
H/Yfirstfor

2 µl PCR 1. Produkt

40 °C

280 bp

3.

9E10oriBstEIIB
9E102ndfor

5 µl PCR 2. Produkt

48 °C

330 bp

4.

9E10oriBstEIIB
9E103rdfor

20 µl PCR 3. Produkt

48 °C

381 bp

↓41

Die Primer sind von U. Griebel charakterisiert und bereitgestellt worden (Griebel, 2005).

Die PCR-Produkte zur Synthese der Konstrukte RH53G, HH58Y, SH100hY und FL30I waren nun für den Restriktionsverdau und den Einbau in den pASK85-9E10 fertig. Die einzeln amplifizierten DNA-Fragmente für die Synthese von HH31S, GH52S, LKeimbahn und HKeimbahn mussten für den Einbau in den Vektor über die Restriktionsschnittorte XbaI/BstEII für VH und PstI/XhoI für VL zu einem Fragment assembliert werden. In einer Agarosegelelektrophorese wurden die Konzentrationen der gereinigten DNA-Fragmente 207 und 317 bp (HH31S-Synthese) und der Fragmente 266 und 247 bp (GH52S-Synthese) durch Auftrennung von 0,1, 0,3 und 1µl der Proben abgeschätzt. Die PCR-Ausbeuten der gereinigten Fragmente 207 und 317 bp betrugen jeweils ca. 1,5 µg und die der Fragmente 266 und 247 bp schätzungsweise 1,5 µg bzw. 480 ng. Die Ausbeuten der Banden 113 und 184 bp zur Synthese von LKeimbahn lagen bei jeweils 150 ng, die der Banden 304 und 187 bp zur Synthese von HKeimbahn bei jeweils 360 ng.

Die gereinigten und zum Teil komplementären PCR-Produkte 1.und 2. für die Synthese der Rückmutanten HH31S, GH52S LKeimbahn und HKeimbahn wurden in einer Assemblierungs-PCR (Tabellen 5.5. und 5.6.) zu einem Fragment zusammengeführt und mit den Primerpaaren pASKVHFOR/9E10oriBstEIIB (HH31S, GH52S), VLI30PstIF/VLM78T83S91B (LKeimbahn) und XbaIH3QFor/VHCDR3FR4germB (HKeimbahn) vervielfältigt. Dafür mussten die Fragmente äquimolar in der Assemblierungsreaktion eingesetzt werden. Als Kontrolle wurden Ansätze ohne die Produkte aus der PCR 1. und 2. mitgeführt. Nach wiederholter Auftrennung der amplifizierten Assemblierungsprodukte im Agarosegel wurden die DNA-Fragmente einer Größe von 479 bp (HH31S und GH52S), 275 bp (LKeimbahn) und 472 bp (HKeimbahn) mit Hilfe des QIAquick Gel-Extraktionskits isoliert.

↓42

Tabelle 5.5. : Ansatz für eine Assemblierungs-PCR zur Herstellung der Konstrukte HH31S, GH52S, LKeimbahn und HKeimbahn .

Assemblierung:

PCR:

Mix 1

Endkonzentration

Mix 2

Endkonzentration

DEPC behandeltes H2O

ad 50 µl

DEPC behandeltes H2O

ad 50 µl

10 x Taq-Puffer

1 x

10 x Taq-Puffer

1 x

DNTPs (10 mM jedes)

200 µM jedes

dNTPs (10 mM jedes)

400 µM jedes

Produkt aus PCR 1.

ca. 2 ng/µl

Primer I (10 pmol/µl)

1 µM

Produkt aus PCR 2.

ca. 2 ng/µl

Primer II (10 pmol/µl)

1 µM

Taq/Pfu-Gemisch (20:1)

0,02 U/µl

Taq/Pfu-Gemisch (20:1)

0,04 U/µl

Tabelle 5.6. : Syntheseprogramm für die Assemblierungs-PCR. * 40°C für die Synthese von LKei m bahn und HKei m bahn.

Syntheseprogramm:

Mix 1

Temperatur

Zeit

Zyklen

 

Denaturierung

95°C

3 min

1

 

Denaturierung
Annealing
Synthese

95°C
57°C*
72°C

60 sec
30 sec
120 sec


7

 

Zugabe von Mix 2

95°C

5 min

1

 

Denaturierung
Annealing
Synthese

95°C
54°C*
72°C

60 sec
60 sec
60 sec


25

 

Endsynthese

72°C

5 min

1

 

Für den Einbau in den pASK85-9E10 wurde das gesamte aus dem Agarosegel extrahierte PCR-Produkt zur Synthese von HH31S, GH52S, SH100hY und HKeimbahn mit den Restriktionsenzymen BstEII/XbaI zur Synthese von RH53G und HH58Y mit SexAI/BstEII und zur Synthese von FL30I und LKeimbahn mit PstI/XhoI nach dem Protokoll des jeweiligen Herstellers verdaut. Die Ausbeuten nach dem Verdau lagen bei 1,5 µg (HH31S), 0,6 µg (GH52S), 2,4 µg (SH100hY), 0,5 µg (RH53G), 0,9 µg (HH58Y), 0,15 µg (FL30I), 0,3 µg (LKeimbahn) und 1,2 µg (HKeimbahn) gereinigter DNA.Der pASK85-9E10 wurde aus den XL-1-Zellen nach dem Protokoll von Qiagen (QIAprep Spin-Plasmidkit) isoliert undentsprechend der einzubauenden Kassette mit Restriktasen verdaut. Dieses ergab eine Ausbeute von ca. 6 µg Vektor-DNA nach dem Verdau mit PstI/XhoI und SexAI/BstEII bzw. ca. 9 µg Vektor-DNA nach dem Verdau BstEII/XbaI.

2. Amplifikation des gesamten pASK85-9E10

↓43

Die Amplifikation des gesamten Vektors mit nur einem mutierten Primer ermöglichte eine schnelle Herstellung des Konstruktes pASK85-9E10(TL91S). Eine PCR-Reaktion wurde nach dem folgenden Ansatz mit dem 5' phosphorylierten Primer VLT91SF und dem frisch aus den XL-1-Zellen isolierten pASK85-9E10 durchgeführt (Tabelle 5.7.).

Tabelle 5.7. : PCR-Ansatz und Syntheseprogramm zur Herstellung des Konstruktes TL91S.

PCR-Ansatz:

Syntheseprogramm:

Endkonzentration

Temperatur

Zeit

Zyklen

DEPC behandeltes H2O

ad 100 µl

Denaturierung
95°C
Annealing
50°C
Synthese
72°C

1 min

2 min

2 min



1

10 x Taq-Puffer

1 x

dNTPs (10 mM jedes)

500 µM jedes

VLT91SF (10 pmol/µl) bzw. Kontrolle ohne Primer

1 µM

Denaturierung
94°C
Annealing
54°C

1 min

2 min



8

Taq/Pfu-Gemisch (20:1)

0,08 U/µl

Synthese
72°C

1 min

pASK85-9E10 (100-200 ng/µl)

2-3 ng/µl

Endsynthese
72°C

5 min

1

Anschließend erfolgte die Reinigung des PCR-Produkts mit dem QIAquick PCR-Reinigungskit, dann die Abtrennung der DNA von den QIAsäulen mit 30 µl Elutionspuffer und zum Schluss die Verbindung der neu synthetisierten DNA zu einem Strang mit der T4-DNA-Ligase in einem Ansatz von 30 µl. Das nun aus einem parentalen und neu synthetisierten Strang bestehende Plasmid wurde dann mit DpnI inkubiert, was zu einem Verdau des methylierten parentalen Stranges führte. (Tabelle 5.8.). Ein Kontrollansatz ohne den Primer VLT91SF wurde zum Vergleich dem gleichen Procedere unterzogen.

↓44

Tabelle 5.8. : Ansatz für die Ligation der DNA und für den Verdau der methylierten parentalen DNA für die Herstellung von TL91S.

 

Menge

PCR-Produkt / Kontrolle

25 µl

10 x Ligase Puffer

3 µl

T4-DNA-Ligase 1 U/µl

2 U

1,5 h 37°C und 10 min 65°C

DpnI 10 U/µl

10 U

30 min 37°C

5.2.1.2 Ligation in pASK85-9E10

Der Einbau der mutierten DNA-Kassetten in den pASK85-9E10 erfolgte mit Hilfe der T4-DNA-Ligase nach Angaben des Herstellers in 10 µl Ansätzen mit 70-140 ng Gesamt-DNA im Verhältnis 1,3 : 1. Zur Kontrolle wurden Ansätze mit dem verdauten Vektor ohne die mutierte DNA-Kassette mitgeführt. Die Konstruktion von LKeimbahn/HKeimbahn im pASK85 war durch den Einbau der LKeimbahn-Kassette, die zuvor mit PstI/XhoI aus dem pASK85-9E10(LKeimbahn) herausgeschnitten worden war, in den mit gleichen Restriktasen verdauten pASK85-9E10(HKeimbahn)-Vektor möglich.

5.2.1.3 Transformation in superkompetente XL-1-Zellen

Die Transformation der superkompetenten XL-1-Zellen von Stratagene mit dem pASK85-9E10(x) (x = Rückmutante z. B. HH31S) erfolgte nach Angaben des Herstellers. Die durchschnittliche Transformationseffizienz der auf LB-Agarselektionsplatten (100 µg/ml Amp) ausplattierten Zellen lag bei 106 - 108 Kolonien (cfu = colony forming units)/µg DNA. Für die Transformation von pASK85-9E10(TL91S) wurden 2 µl des DpnI verdauten Ansatzes (bzw. Kontrollansatz) mit 100 µl XL-1-Zellen vermischt, und es wurde weiter nach Protokoll verfahren.

5.2.1.4 Selektion der mutierten DNA

↓45

Sechs separat wachsende Klone wurden nach jeder Transformation von den Selektionsplatten gepickt und in 5 ml LB (200µg/ml Amp) bei 37°C über Nacht angezogen. Später wurde die Plasmid-DNA mit Hilfe des QIAprep Spin-Plasmidkits aus den Zellen isoliert, wobei ein anderer Teil der Zellen zuvor entnommen und in 10% Glycerin bei -70°C in NUNC-Kryoröhrchen eingefroren wurde. Die mutierten variablen Regionen des 9E10 im pASK85 wurden über einen für jede Rückmutante spezifischen Restriktionsverdau identifiziert. Der Verdau mit den Enzymen in Tabelle 5.9. wurde nach Angaben des Herstellers durchgeführt und durch eine Agarosegelelektrophorese belegt. Die Kontrolle des Restriktionsverdaus erfolgte mit pASK85-9E10.

Tabelle 5.9. : Identifikation der mutierten Regionen in den Plasmiden pASK85-9E10(x) mit Restriktionsenzymen.

pASK85-9E10(x)

Restriktionsenzym

pASK85-9E10(x)

Restriktionsenzym

HH31S

Bsi WI

FL30I

Sfa NI

GH52S

Kpn I

TL91S

Sty I

RH53G

Bsp EI

LKeimbahn/H9E10

Xho II

HH58Y

AfI III

L9E10/HKeimbahn

AfI III und Eco RI

SH100hY

Sty I

LKeimbahn/HKeimbahn

Xho II und AfI III

Zellen mit der jeweiligen rückmutierten 9E10-DNA im pASK85 wurden aufgetaut, in 5 ml LB (100 µg/ml Amp) bei 37°C auf dem Schüttler über Nacht angezogen und im analytischen Maßstab auf Expression der mutierten Gene getestet. Nicht mit dem Vektor transformierte Zellen wurden ohne Amp kultiviert und dienten der Kontrolle. Den Übernachtkulturen wurden 500 µl entnommen und 10 ml frischem LB-Medium (100 µg/ml Amp) zugeimpft. Die Zellen wuchsen bei 37°C bis zur einer OD600nm = 0,5 auf dem Schüttler und wurden anschließend mit 0,2 µg/ml aTc bei 22°C für 2,5 h inkubiert. Nach der Expression wurden die Zellen bei 5000 x g für 5 min in der Zentrifuge geerntet. Das Zellpellet wurde in 100 µl Periplasmapuffer auf Eis 30 min lang inkubiert. Zum Schluss wurde die lösliche Fraktion von der unlöslichen des periplasmatischen Aufschlusses durch Zentrifugieren (25000 x g, 20 min, 4°C) getrennt. Die unlösliche Fraktion wurde in 100 µl TE-Puffer gegeben und bei 95°C für 10 min im 5 x Ladepuffer (nicht reduzierend) für Analysen mittels SDS-PAGE inkubiert. Weitere Analysen für den Nachweis der synthetisierten Fab-Fragmente erfolgten in der SDS-PAGE und im Western-Blot.

↓46

Das VH- bzw. VL-Gen in den Plasmiden von Zellklonen mit positiven Ergebnissen in den Restriktions- und Expressionsexperimenten wurde zur Kontrolle sequenziert.

5.2.1.5 Sequenzierung der DNA

Die Kontrollsequenzierungen der variablen Regionen des 9E10 und seiner Rückmutanten im pASK85 erfolgten mit den Sequenzierungsprimern pASK85OmpA und pASK88NcoIFOR und waren Teil einer Dienstleistung von Martin Meixner am ABI373 BigDye-Terminator (HU Berlin). Im Fall von pASK85-9E10(TL91S) wurden die schwere und leichte variable Region sequenziert, während bei den restlichen Konstrukten nur die jeweils mutierte variable Region der Sequenzierung unterzogen wurde.

5.2.2 Präparative Fab-Synthese in E. coli

5.2.2.1  Fab-Expression

50-100 ng des Vektors pASK85-9E10(x) wurden in CaCl2 kompetente XL-1-Zellen transformiert (5.2.6.), die Zellen auf LB-Agarplatten mit 100 µg/ml Amp ausplattiert und bei 37°C für 16 h inkubiert. Anschließend wurden 50 ml LB-Medium mit 200 µg/ml Amp mit einem separat wachsenden Klon von der Agarplatte angeimpft und bei 30 °C für 22 h auf einem Schüttler inkubiert. Nach der Inkubation wurden die Zellen bei 5000 x g 10 min zetrifugiert und in 50 ml frischen LB-Medium resuspendiert. Die Zellen wurden auf 2 x 2000 ml LB-Medium mit 200 µg/ml Amp aufgeteilt und einer nachfolgenden Kultivierung für 18 h bei 22°C auf einem Schüttler unterzogen. Die Induktion der Fab-Expression wurde durch Zugabe von aTc auf eine Endkonzentration von 0,2 µg/ml bei einer OD600nm = 0,8 der Zellkultur gestartet und bei gleicher Temperatur für 2,5 h geschüttelt.

5.2.2.2 Fab-Isolierung aus dem Periplasma

↓47

Die geernteten Zellen (5000xg, 10 min, 4°C) wurden in 40 ml kaltem Periplasmapuffer aufgenommen und auf Eis 30 min lang inkubiert. Der osmotische Schock bewirkt eine Freisetzung der löslichen periplasmatischen Bestandteile der Zelle. Die lösliche Fraktion des Periplasmaaufschlusses wurde bei 4°C in zwei Schritten von der unlöslichen Fraktion, die aus den Sphäroplasten und den unlöslichen Bestandteilen des Periplasmas besteht, mittels Zentrifugation (5000 x g, 10 min und 25000 x g, 20 min) getrennt und bei 4°C gegen den Equilibrierungspuffer der chromatographischen Säule in Schläuchen (Visking) mit einer Ausschlussgrenze von 12 kD über Nacht dialysiert. Der abschließend nochmals zentrifugierte Überstand der Probe (25000 x g, 20 min bei 4°C) war nun bereit für die anschließende Affinitätschromatographie.

5.2.2.3 In vitro Fab-Rückfaltung

Ziel der in vitro Rückfaltung war es, die Fab-Ausbeuten zu steigern, wofür die Zellen in 2 x 500 ml Flüssigmedium, wie oben beschrieben, kultiviert und nach der Expression geerntet wurden. Der komplette Zellaufschluss erfolgte in 10 ml Zelllysepuffer auf Eis mit Hilfe einer Ultraschallsonde (6 min, höchste Stufe, Labsonic U, Braun). Die Probe wurde dann bei 25000 x g 20 min bei 4°C zentrifugiert, und der Überstand wurde gegen 5 l 50 mM Tris-HCl versetzt mit 2 mM EDTA (pH 8,0) bei 4°C über Nacht dialysiert (Visking 12 kD MWCO). Das Pellet aus der Zentrifugation wurde zweimal in 10 ml Waschpuffer A. und einmal in 10 ml Waschpuffer B. 30 min gewaschen, wobei zwischen den Waschschritten eine Zentrifugation erfolgte (25000 x g, 1 h, 4°C). Das gewaschene Pellet, das unter anderem die Einschlusskörperchen enthält, wurde mit dem dialysierten Überstand, der einen großen Teil der leichten Kette beinhaltet, vereinigt und 1 h nach Zugabe von Guanidin-Hydrochlorid auf 6 M und DTT auf 10 mM Endkonzentration in 20 ml Endvolumen bei RT gerührt. Das DTT im Ansatz wurde im zweifachen Dialyseschritt (24 h) bei 4°C gegen 1 l 6 M Guanidin-Hydrochlorid pH 5,5 verdünnt. Die denaturierte Proteinprobe wurde nun gegen 5 l Renaturierungspuffer 160 h bei 10°C und für 24 h gegen PBS dialysiert. Die lösliche Fraktion mit dem rückgefalteten Protein konnte durch zweifache Zentrifugation (25000 x g, 30 min und 1 h) von dem Präzipitat getrennt werden und war anschließend vorgefertigt für die Reinigung. Ein Teil der in dieser Arbeit charakterisierten LKeimbahn/HKeimbahn Fab-Konstrukte wurde von Ch. Scholz im größeren Maßstab in E. coli exprimiert, aus Einschlusskörperchen rückgefaltet und gereinigt.

5.2.3 Reinigung von Fab mittels Metallaffinitätschromatographie

Die Reinigung der 9E10 HH31S Fab-Fragmente erfolgte über die Immobilisierung des His-tag an Co2+-Sepharose (Talon) an einer Chromatographieanlage von Pharmacia bei 4°C. Das Volumen der Talon-Säule betrug 2 ml und wies eine Proteinbindekapazität von 5 mg auf. An der Chromatographieanlage wurde das Verhalten der Fab-Fragmente getestet, des Weiteren wurden die Reinigungsbedingungen optimiert. Die Reinigung der übrigen Fab-Rückmutanten als auch des rekombinanten 9E10-Fab erfolgte identisch unter den optimierten Bedingungen für die Reinigung des 9E10 HH31S-Fab, jedoch an selbst hergestellten Säulen, bestehend aus einer 15 ml Einwegspritze (Sarstedt) und Filtern (HR16, Pharmacia). Die selbst hergestellten Säulen wurden über eine Pumpe betrieben. Die Reinigung an den selbst hergestellten Talon-Säulen mit einem Volumen von 0,6 ml und einer Proteinbindekapazität von 1,5 mg erlaubte eine schnellere und parallele Reinigung der Fab-Konstrukte. Nach dem Auftragen der dialysierten Proben auf die vorequilibrierte chromatographische Säule und dem Waschen der Säule wurde das Protein mit 200 mM Imidazol im Elutionspuffer von der Säule eluiert (Tabelle 5.10.). Das Eluat wurde gegen 5 l PBS bei 4°C für 20 h dialysiert, durch Zentrifugation (Centricon 30 kD MWCO) eingeengt, und die Proteinkonzentration wurde durch Messung der Absorption bei 280 nm bestimmt. Dazu wurde mit dem Programm Vector NTI für jedes Konstrukt die Konzentration an Fab errechnet, die bei 280 nm eine Absorption von 1 ergibt (Tabelle 5.11.).

↓48

Die gereinigten Fab-Fragmente wurden abschließend in einer SDS-PAGE und in einem Western-Blot (5.2.6.) charakterisiert und bei -20°C gelagert. Die ELISA-, SPR- und Peptidspot-Analysen (5.2.4.)belegten zudem die Funktionalität der gereinigten Fragmente.

Tabelle 5.10. : Reinigungsschema. *1Die Mengenangaben beziehen sich auf die Reinigung der Proben mit selbst hergestellten Säulen. *2Zeigt den Waschpuffer für eine Reinigung an der Chromatographieanlage und *3 die Waschpuffer für eine Reinigung an selbst hergestellten Säulen.

Schritt

Puffer

Geschwindigkeit

Dauer / Menge *1

Equilibrierung

Equilibrierungspuffer

0,5 ml/min

40 min / 10 ml

Beladen mit der Probe

Probe im Equilibrierungspuffer

0,3 ml/min

über Nacht (ca. 15 h) zirkulierend

Waschen

Waschpuffer 2*2

0,5 ml/min

bis OD280nm an Basislinie

Waschpuffer 1*3

0,5 ml/min

1 x 10 ml

Waschpuffer 2*3

0,5 ml/min

3 x 10 ml

Elution

Elutionspuffer

0,5 ml/min

Änderung der OD280nm/ 5 ml

Regeneration

Regenerationspuffer
destilliertes Wasser
Lagerungslösung

0,5 ml/min

80 min / 2 x 10 ml
40 min / 10 ml
30 min / 5 ml

Tabelle 5.11. : Absorption der Fab-Fragmente bei 280 nm.

Fab

1 A(280 nm)

L9E10/HKeimbahn,
LKeimbahn/HKeimbahn

0,59 mg/ml

9E10,
HH31S, GH52S, RH53G,
FL30I, TL91S,
LKeimbahn/H9E10

0,61 mg/ml

HH58Y, SH100hY

0,6 mg/ml

5.2.4 Biochemische Charakterisierung von 9E10-Fab und Rückmutanten

5.2.4.1  Peptidspot-Analysen

↓49

Die Methode der parallelen chemischen Synthese von Peptidspots auf Zellulosemembranen (Frank et al., 1991, Frank, 1992) wurde verwendet, um mit Hilfe solcher Peptidspots die Bindung des 9E10-Fab und seiner rückmutierten Fab-Fragmente an humane c-myc-Peptide mit unterschiedlicher Länge als auch an Einzel- und Mehrfachsubstituenten des myc-Peptides zu charakterisieren. Peptidsynthese und Bindungsstudien wurden auf ein und derselben Membran durchgeführt. Hierfür wurden die Peptide von Gerd Hansen in der Arbeitsgruppe von W. Höhne nach der Methode der Spotsynthese (Frank 1996; Kramer 1998) an Whatman 50 Cellulose (Whatman, Mainstone, England) sequentiell vom C- zum N-Terminus am Auto-Spot Roboter ASP 222 (Abimed) synthetisiert. Die schrittweise Kopplung der Aminosäuren der Peptide an gewählten Positionen der Membranen (Spots) erfolgte nach dem Prinzip der Säureamidausbildung mit einem an Zellulose veresterten β-Alanin(2)-Linker. Um die für die Bindung kritischen Seitenreste identifizieren zu können, wurden Substitutionsanalysen an den Peptiden durchgeführt, wofür jeweils eine Aminosäure an jeder Position des Peptides durch die zwanzig proteinogenen L-Aminosäuren ausgetauscht wurde und wo pro Peptidspot ein Austausch stattfand. Auf der Membran erscheint in der äußeren linken Spalte und nochmals in jeder Zeile (Höhe) die Wildtypsequenz.

Bindungsassays

Für die Bindungsanalysen wurden die Peptidspotmembranen je 5 min in 96% Ethanol, destilliertem Wasser und im TTBS-Peptidspotpuffer vorbehandelt. Die Blockierung der freien Bindungsflächen auf der Membran erfolgte mit 2 x Spots Blocking Buffer in 0,1 M Tris-HCl pH 7,5 für zwei Stunden bei Raumtemperatur. Nach einem dreifachen Waschschritt für 5 min in TTBS fand die Inkubation mit 9E10-Fab (bzw. Rückmutanten) und einem HRP-gekoppelten anti-Maus-Ig (1:500) in 6 ml TTBS und 3 % Gelafusal für 1,5 Stunden bei 22 ± 1°C statt. Die Mengen an eingesetztem Fab variierten zwischen 6 bis 220 µg und 3,5 mg für das in vitro rückgefaltete HKeimbahn/LKeimbahn-Fab. Nachdem die behandelten Membranen nach oben beschriebener Prozedur gewaschen und in 4 ml Chemilumineszenz-Substratlösung, basierend auf Luminol (Uptilight HRP Blot-Substrat), kurz geschwenkt wurden, erfolgte die Detektierung der Bindungssignale über die chemilumineszente Reaktion der immobilisierten Peroxidase am LumiImager (Boehringer Mannheim, Mannheim). Die Auswertung der Signale fand mit den Programmen Lumi Analyst Version 3.0 und ImageJ (www.rsb.info.nih.gov/ij) statt. Vergleichende Analysen zum Bindungsverhalten der Rückmutanten und des 9E10-Fab wurden unter gleichen Bedingungen und auf Peptidspotmembranen aus einer Synthesecharge durchgeführt. Variationen in den Konzentrationen der eingesetzten Fabs sind auf die Affinität der Fabs und Empfindlichkeit dieser Methode zurückzuführen. In Kontrollexperimenten zur Bindung des Nachweisantikörpers an die Peptide wurden die Peptidspotmembranen, wie oben beschrieben, jedoch ohne Fab, mit dem HRP-gekoppelten anti-Maus-Ig inkubiert. Die Lumineszenzreaktion wurde 10 min lang detektiert. In den Experimenten zur Reproduzierbarkeit der Bindungsintensitäten in den Substitutionsanalysen wurden 22 µg des periplasmatisch löslichen LKeimbahn/H9E10-Fab und 130 µg des in vitro rückgefalteten Fab eingesetzt.

5.2.4.2 KD-Bestimmung im ELISA

Die synthetischen Peptide myc-tag und c-myc(408-427) wurden auf ihre Bindung an das 9E10-Fab (bzw. Rückmutanten) in Lösung getestet (Friguet, 1985). Mikrotiterplatten (Nunc) wurden mit 5 µg/ml Avidin in 50 mM Beschichtungspuffer beschichtet und für 2 Stunden bei Raumtemperatur inkubiert. Die Platten wurden mit Waschpuffer fünfmal gewaschen und mit 5 µg/ml N-terminal biotinyliertem myc-tag-Peptid in PBS für 21 Stunden bei 4°C inkubiert. Anschließend erfolgte ein erneutes Waschen der Platten. Die Blockierung der freien Bindungsstellen wurde mit 5% Milchpulver in PBS durchgeführt (1 h, RT). Nach wiederholtem Waschen der Platten wurde das myc-tag-Peptid in Konzentrationen ab 1 mM bzw. 2 mM (in der Messung mit 9E10-RH53G) vorgelegt und in den weiteren Reaktionsgefäßen der Platte in Fünfer-Schritten verdünnt. Die Anfangskonzentration des c-myc(408-427)-Peptides lag bei 0,02 mM (Messung mit 9E10), 0,1 mM (Messung mit GH52S, SH100hY und FL30I), 1 mM (Messung mit LKeimbahn/H9E10), 1,5 mM (Messung mit L9E10/HKeimbahn) und 6 mM (Messung mit LKeimbahn/HKeimbahn). Anschließend kamen 3 µg/ml 9E10-Fab oder 6-34 µg/ml Rückmutanten auf ein Totalvolumen von 50 µl PBS mit 5% MP für 2 Stunden bei 25°C im Inkubator hinzu. Einem weiteren Waschvorgang, wie er bereits früher durchgeführt wurde, schloss sich dann die Inkubation mit einer 1:500 Verdünnung des anti-Maus-Ig HRP-markierten Antikörpers in 5 % MP/PBS für 1 Stunde bei 25°C im Inkubator an.Die Peroxidase wurde durch Zugabe von 50 µl TMB-Substrat-Lösung aktiviert, und die Kinetik der Reaktion wurde bei A620 nm (450 nm Referenzfilter) am Photometer (Anthos HT2) gemessen. Zum Vergleich erfolgte auch eine Endpunktbestimmung, und zwar wurde dafür zuerst die Peroxidaseaktivität durch Zugabe von 50 µl 1 M Schwefelsäure abgestoppt und dann die Absorption bei 450 nm (Referenz 620 nm) gemessen.

↓50

Die Dissoziationsgleichgewichtskonstante KD wurde nach der Formel:

ΔA620nm = (Amax620nm*KD / (KonzentrationPeptid+KD)) + Off errechnet, wobei Off den Wert der Basislinie darstellt.

Der kompetitive ELISA zur Bestimmung des KD der Bindung der Fab-Fragmente an das 20-mer Peptid wurde mit 100 µg/ml c-myc(408-427)-Peptid beschichtet und mit 1 x Spots Bl o cking Buffer in PBS geblockt. Die eingesetzten Konzentrationen der Fabs betrugen 0.3 µg/ml für 9E10 und 3-50 µg/ml für die Rückmutanten. Weitere Experimente zur Kontrolle der spezifischen Bindung von Fab der kompletten Keimbahnrückmutante des 9E10 an das c-myc(408-427)-Peptid wurden mit einem randomisierten myc-Peptid (LDIKLQERESRKLRQEEAEL) in unterschiedlichen Konzentrationen durchgeführt.

5.2.4.3 Bestimmung der kinetischen Konstanten und KD mittels SPR

↓51

An einem Sensorchip an der Biacore 2000 (Uppsala, Schweden) wurde mit Hilfe der Oberflächenplasmonresonanz (SPR) (Jonsson et al., 1991) die Wechselwirkung des 9E10-Fab (bzw. Rückmutanten) mit den Peptiden myc-tag und c-myc (408-427) in Echtzeit verfolgt. Das myc-tag abgeleitete Peptid CGGEQKLISEEDLN und das Peptid LIEDNEYTARQGAβAC für die Negativkontrolle, sowie das c-myc(408-427) abgeleitete Peptid CAEEQKLISEEDLLRKRREQL und das Peptid TSTEPQYGPGENLβAC für die Negativkontrolle wurden auf der Oberfläche des CM5-Chips (Biacore) über die Thiol-Gruppen der N-terminalen Cysteine nach der Ligand-Thiol-Methode nach Protokoll (Biacore Thiol-Kopplungs-Kit) unter Verwendung des Borat- und Natriumformiat-Puffers immobilisiert. Der Anteil der kovalent an die Chipoberfläche gekoppelten Peptide entsprach je 873, 926, 1213 und 717 Resonanzeinheiten (RU). Die Bindungsexperimente erfolgten bei einer Durchflussrate des HBS-Puffers von 10 µl/min und 1 µl/min (Sättigungsexperiment) bei 23°C. Für die myc-tag-Peptid-Bindungsstudien wurde 9E10-Fab in Konzentrationen von 0,05 bis 0,97 µM (fünf verschiedene Konzentrationen) eingesetzt. Für die rekombinant hergestellten Fab-Fragmente wurden Konzentrationen von 0,06 (dreimal) und 0,04 µM (dreimal) für 9E10, von 0,1 bis 3 µM (fünf verschiedene Konzentrationen) für 9E10 HH31S, von 2 bis 11 µM (acht verschiedene Konzentrationen) für 9E10 RH53G, von 0,1 bis 2,5 µM (fünf verschiedene Konzentrationen) für 9E10 HH58Y und von 0,5 bis 3,6 µM (sechs verschiedene Konzentrationen) für 9E10 TL91S eingesetzt. Die Tests mit dem c-myc(408-427)-Peptid erforderten Fab-Konzentrationen von 0,5 bis 15 nM (sechs verschiedene Konzentrationen) für 9E10 (aus der Proteolyse des IgG) sowie für die rekombinant hergestellten Fabs von 0,1 bis 2,8 µM (sechs verschiedene Konzentrationen) für 9E10 GH52S, von 0,01 bis 1,3 µM (sechs verschiedene Konzentrationen) für 9E10 SH100hY, von 5 bis 60 nM (sieben verschiedene Konzentrationen) für 9E10 FL30I, von 0,05 bis 1,5 µM (sechs verschiedene Konzentrationen) für LKeimbahn/H9E10, von 1 bis 3 µM (sechs verschiedene Konzentrationen) für L9E10/HKeimbahn und von 2 bis 7 µM (fünf verschiedene Konzentrationen) für LKeimbahn/HKeimbahn. In den Sättigungsexperimenten an der mit dem myc-tag-Peptid beschichteten Chipoberfläche wurden sechs Konzentrationen von 0,01 bis 4 µM an 9E10-Fab (aus der IgG-Proteolyse) eingesetzt. Das injizierte Volumen lag bei 20 µl bzw. 15 µl (Sättigungsexperiment). Der Sensorchip ließ sich mit 100 nM NaOH im Falle der Bindung der Fabs an das myc-tag-Peptid und mit Glycin-Puffer (pH 1,5) im Falle der Bindung an das c-myc(408-427)-Peptid regenerieren. Die Bestimmung der kinetischen Konstanten kon und koff erfolgte mit der Biaevaluation Software. Dafür wurden die Sensorgramme für die Negativkontrolle von der Positivkontrolle subtrahiert. Die kinetischen Konstanten wurden durch globales mathematisches Fitten (simultane Anpassung an mehrere Messungen bei unterschiedlichen Antikörperkonzentrationen) der Assoziations- und Dissoziationsbereiche der Kurven errechnet. Aus den kinetischen Konstanten konnte die Konstante KD berechnet werden (KD = koff/kon). Aus den Sättigungsexperimenten konnte KD über eine Abtragung von 1/RU gegen 1/[Fab] nach Lineweaver und Burk errechnet werden. KD ergab sich aus dem Anstieg (m = KD/RUmax) der linearen Geraden (1/RU = m * (1/[Fab]) + n, n = 1/RUmax).

5.2.5 Modellierung der Bindung des c-myc(410-427)-Peptides an 9E10

Die Bindung des um vier Aminosäuren C-terminal verlängerten myc-Peptides an den 9E10-Antikörper wurde in einem Modell dargestellt. Dieses Modell basiert auf den Daten der Kristallstrukturanalyse des 9E10-Fab im Komplex mit dem myc-tag-Peptid (410-420) (N. Krauß et al., 2007) und der Überlagerung des Peptidrückgrates (Cα-Atome 410-420) des myc-tag-Peptides mit entsprechenden Cα-Atomen aus den in der PDB-Datenbank verfügbaren Strukturen des humanen c-Myc-Proteins (1NKP, Nair et al., 2003 und 1A93, Lavigne et al., 1998). Mit den Atomkoordinaten aus der Überlagerung wurde in dem Programm „O“ (Jones et al., 1991) eine Peptidbindung zwischen den Resten 420 und 421 geknüpft und eine Energieminimierung durchgeführt (N. Krauß). Mit dem Programm Pymol (http://www.pymol.org) wurde der Rest NP420 zu L mutiert und das nun vollständige Peptid im Komplex mit dem 9E10-Fab nochmals einer abschließenden Energieberechnung im Vakuum mit GROMOS96 43B1 (Gunsteren et al., 1996) im Swisspdbviewer unterzogen (www.expasy.ch/spdbv). Im Endergebnis zeigt dieses Modell eine mögliche Interaktion des C-Terminus(421-427) des c-myc(410-427)-Peptides an den 9E10.

5.2.6 Standardmethoden

Transformation in XL-1, JM83 und BL21-Gold kompetente Zellen

Die Zellen XL-1, JM83 und BL21-Gold wurden nach einer CaCl2-Methode kompetent gemacht. Hierzu wurden die Zellen in 100 ml LB-ls bis zu einer OD550nm = 0,48 bei 37°C auf dem Schüttler angezogen und durch Zentrifugation (5000 x g, 4°C, 10 min) geerntet. Dann wurde das Zellpellet vorsichtig in 80 ml eiskalter MgCl2-Lösung (100 mM) resuspendiert und wie beschrieben zentrifugiert. Im nächsten Schritt erfolgte eine erneute Resuspension in 40 ml 50 mM CaCl2-Lösung auf Eis mit einer 30-minütigen Inkubation und anschließenden Zentrifugation. Zum Schluss wurden die Zellen in 4 ml eiskalten 50 mM CaCl2-Lösung und 15% Glycerol aufgenommen und in 100 µl Aliquote bei -70°C gelagert. Zur Transformation wurden die Zellen auf Eis aufgetaut, und es wurde 0,5 µl des Expressionsvektors pASK85-9E10(x) (100-200 ng/µl) hinzugegeben und 30 min auf Eis, 5 min im 37°C Wasserbad und wiederum 2 min auf Eis inkubiert. Die nun transformierten Zellen wurden mit 37°C warmen 1 ml SOC-Medium gemischt und 20 min bei 37°C geschüttelt. 10 µl und 100 µl des Ansatzes wurden abschließend auf LB-Agarselektionsplatten mit 100 µg/ml Amp ausplattiert und bei 37°C inkubiert.

DNA-Auftrennung in der Agarosegelelektrophorese

↓52

Die DNA-Probe wurde zuerst mit DNA-Probenpuffer versetzt und anschließend in Agarosegelen (0,8 - 2 %) mit 1 µg/ml Ethidiumbromid im TBE-Puffer bei 15 V/cm aufgetrennt. Zur Konzentrations- und Größenabschätzung wurden die DNA-Marker 2-Log DNA Ladder oder Smart DNA Ladder bei jeder Auftrennung hinzugefügt.

Proteinauftrennung in der SDS-PAGE

Die Proteinproben wurden mit Ladepuffer (reduzierend bzw. nicht reduzierend) verdünnt und bei 95°C für 5 min im Thermoblock denaturiert. Die Auftrennung der Proben im SDS-Polyacrylamidgel, bestehend aus einem Sammelgel (5% Acrylamid) und einem Trenngel (12 oder 15% Acrylamid), erfolgte bei 2 bzw. 4 mA/cm im Laemmli-Puffer. Die Anfärbung der Proteine im Gel geschah mit Coomassieblau durch eine 30 min Inkubation bei RT in der Coomassie-Färbelösung mit anschließendem Waschen in der Coomassie-Entfärbelösung und Fixierung mit Coomassie-Fixierer. Das Gel konnte abschließend auf Filterpapier im Geltrockner (BioRad) getrocknet werden.

Nachweis von Proteinen im Western-Blot

Die in der SDS-PAGE aufgetrennten Proteine wurden auf eine mit Elektrophorese-Blotpuffer benetzte PVDF-Membran (Millipore, Eschborn) mit Hilfe eines Semi-Dry-Elektroblots (0,8 mA/cm2, 15 min) von BioRad transferiert. Das Blocken der freien Bindungsstellen auf der Membran erfolgte mit 5% MP in TTBS für eine Stunde unter leichtem Schwenken bei Raumtemperatur. Nach dem Waschen (3 x 5 min in TTBS) wurde nach einer Stunde bei Raumtemperatur bzw. über Nacht bei 4°C der His-tag mit einem anti-His(6) HRP-markierten Antikörper (2 µg/ml in 5% MP/TTBS), die murinen Fab-Antikörperdomänen mit einem anti-Maus-IgG(Fab) HRP-markierten Antikörper (2 µg/ml in 5% MP/TTBS) und die κ-Region der leichten Kette des 9E10 mit einem anti-Maus-IgG-kappa HRP-markierten Antikörper (2 µg/ml in 5% MP/TTBS) nachgewiesen. Entwickelt wurde nach dem Waschen mit präzipitierendem TMB-Substrat von Seramun. Das abschließende Spülen der Membran mit destilliertem Wasser stoppte die Reaktion.

5.2.7 Keimbahngensequenzanalyse mit Datenbanken

↓53

Die Identifizierung der höchsthomologen Keimbahngensegmente zu den 9E10 variablen Regionen VH und VL war mit den Datenbanken IMGT (www.imgt.cnusc.fr) und NCBI (www.ncbi.nlm.nih.gov) möglich. Der Aminosäueresequenzvergleich der 9E10 variablen Regionen VH und VL mit den Sequenzen bekannter Antikörper erfolgte mit der R.U.Bi.C-Datenbank (www.rubic.rdg.ac.uk).

5.2.8 Programm für Moleküldarstellungen

Die Darstellung von Molekülstrukturen erfolgte mit den Programm WebLab ViewerPro 4.2 von Molecular Simulations Inc.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
30.03.2007