4. Methoden

4.1. Mikromanipulation

4.1.1. Geschichte der Mikromanipulation

Bereits Ende des 19. Jahrhunderts nutzten Mikrobiologen mechanische Hilfsmittel, um unter mikroskopischer Sicht tierische embryonale Blastomeren zu untersuchen (Peterfi, Naturwissenschaften,1923).

Den entscheidenen Fortschritt bei der Entwicklung der Technik der Mikromanipulation erbrachten die Erfordernisse der in-vitro-Fertilisation im Rahmen der Reproduktionsmedizin. Dabei wird unter mikroskopischer Sicht das Spermium in eine Eizelle verbracht. Weitere Anwendungen der Mikromanipulation bestehen heute in der Zellkern-Isolierung aus Einzelzellen und gezieltem Einbringen von DNA in Zellen (Hardy K, Reproduction, 2002). Küppers et al. etablierten die Mikromanipulation zur Isolierung von Einzelzellen aus dem histologischen Schnitt zur Erforschung des Morbus Hodgkin (Küppers R, Mol Med Today, 1995). In Anlehnung an diese Technik isolierten wir Einzelzellen von primär kutanen Lymphomen, welche dann einer PCR-Analyse zugeführt wurden (Gellrich S, Biochemica, Boehringer Mannheim, 11/97).

Moderne Verfahren ermöglichen die Mikromanipulation lasergesteuert. Dabei können einzelne Zellen und größere Zellverbände unter Monitorkontrolle disseziert werden. Vorteilhaft ist dabei die Möglichkeit des Einsatzes von fluoreszenzoptischen Verfahren und die schnelle Gewebegewinnung, welches dann zur Herstellung von cDNA aus mRNA verwendet werden kann. Nachteilig ist jedoch die bisher niedrige Effizienz bezüglich der intakten DNA bei Einzelzellen. Möglicherweise läßt sich dieser Nachteil durch Optimierung der Energiebündelung am Laser optimieren (Schutze K, Cell Mol Biol (Noisy-le-grand), 1998).

4.1.2. Immunhistochemische Markierung

In Vorbereitung der Einzelzell-Isolierung ist es notwendig die Zellen immunhistochemisch durch einen Maus-Anti-Human-Antikörper zu markieren, z.B. gegen CD20, Kappa, Lambda oder CD30-Moleküle. Die genauen Angaben zum jeweiligen markierenden Primärantikörper werden in den betreffenden Abschnitten 3. und 5. genannt bzw. sind in den Publikationen detailiert nachzulesen. (Abbildung 10)

Zunächst wird von einer kryokonservierten Hautprobe ein 8µm bis 10µm dicker Schnitt hergestellt. Dieser wird ca. 10 Minuten mit Aceton fixiert und anschließend 1 Stunde mit dem Primärantikörper inkubiert. Nach Spülung der Schnitte in TBS-Pufferlösung erfolgt die Reaktion mit einem sekundären Antikörper einer anderen Spezies, z.B. Ziege-Anti-Maus-Antikörper über 30 Minuten. Der sekundäre Antikörper ist entweder mit Biotin oder alkalischer Phosphatase markiert. Die Verstärkungsreaktion [Seite 33↓]wird durch Reaktion des Biotin-Moleküls mit der alkalischen Phosphatase über einen Streptavidin-Komplex realisiert. Abschließend erfolgt die Farbreaktion (Rotfärbung) über 15 Minuten mit Chromogen (Neufuchsin/Naphtol-AS-Biphosphat). Bei Anwendung einer Peroxidase-Färbung ändert sich die Markierung des Sekundärantikörpers mit Natriumperjodat. Die eigentliche Färbung wird durch die Zugabe eines Enzyms erreicht, welches eine chemische Reaktion und damit die Färbung auslöst. Eine Gegenfärbung der Zellkerne wird mit Hämatoxylin-Lösung durchgeführt. Die bei diesen Arbeiten verwendeten KITs bzw. Antikörper wurden überwiegend von den Firmen DAKO und DIANOVA bezogen.

Die Präparate wurden bis zur Mikromanipulation in TRIS-HCl (0,5 M, pH 7,6)-Puffer bei 4°C aufbewahrt.

4.1.3. Hydraulische Mikromanipulation

Die Mikromanipulation erfordert ein Umkehrmikroskop (z.B. Nikon, Diaphot 300). Nach Einstellung und photographischer Dokumentation des gewünschten Ausschnittes erfolgt unter 600facher Vergrößerung die Isolierung der immunhistochemisch markierten Einzelzellen mittels einer aus glühendem Glas gezogenen (Micropipette Puller) und geschliffenen Kapillare (Pipette Grinder), welche durch einen hydraulischen Mikromanipulator (NARISHIGE MO-188) manuell gesteuert wird. Die so isolierte einzelne Zelle wird durch Erzeugung eines Unterdrucks in der Kapillare in die Glasröhre angesaugt. Anschließend erfolgt die Überführung der Einzelzelle in ein PCR-Röhrchen mit 20µl 1x PCR-Puffer ohne MgCl und 1ng/µl 5SrRNA durch Erzeugung eines Überdrucks. Die Zugabe von 5SrRNA soll das Adhärieren von DNA an der Gefäßwand verhindern. Es konnten jedoch auch erfolgreiche Experimente ohne Zugabe von 5SrRNA durchgeführt werden. Die Zellen werden bei –20°C bis zur Weiterverarbeitung gelagert. (Abbildung 10)


[Seite 34↓]

Abbildung 10

Abbildung 10


[Seite 35↓]

4.2.  Molekularbiologische Analyse

4.2.1. Einzelzell-PCR

Die in dieser Arbeit vorgestellten PCR-Analysen an Einzelzellen wurden generell an genomischer DNA vorgenommen. Prinzipiell ist die gleichzeitige Amplifikation verschiedener Gene aus der genomischen DNA einer einzelnen Zelle möglich. Bei der Untersuchung primär kutaner Lymphome wurde die PCR für folgende Gene etabliert: schwere Kette des Immunglobulins (VHDJH), leichte Ketten des Immunglobulins Kappa und Lambda (VLJL), T-Zell-Rezeptoren- γ und -ß (VJ), EBV-Genom.

Der eigentlichen PCR-Analyse ist ein Proteinverdau vorangestellt. Dabei wird die in Puffer befindliche Einzelzelle mit 0,5µl Proteinase K (Konzentration 0,5mg/ml) über 55 Minuten inkubiert. Danach erfolgt die Zugabe der PCR-Reagenzien bis zu einem Volumen von 50µl. Die Primer und Annealingtemperaturen sind der Tabelle V zu entnehmen.

Prinzipiell werden die PCR-Amplifikationen der Immunglobulin- und TCR-Gene in 2 Runden als seminested-PCR (halbgeschachtelte PCR) vorgenommen. Dabei werden interne Primer bei den B-Zell-Rezeptor-Genen in der 2. Runde am 3‘ –Ende und bei den T-Zell-Rezeptor-Genen am 5‘-Ende eingesetzt. Vom Produkt aus der ersten Runde der PCR wird 1µl in das Reaktionsgemisch der 2. Runde gegeben, wobei jetzt jede V-Familie einzeln amplifiziert wird. Die detailierten Reaktionsbedingungen sind in zahlreichen Publikationen veröffentlicht worden (siehe Abschnitt 10).

4.2.2. Darstellung der PCR-Produkte, Sequenzierung, Datenanalyse

Anschließend erfolgt die Visualisierung der Produkte mittels Gelelektrophorese auf einem 2% Agarose-Gel. (Abbildung 10)

Da es sich bei der Einzelzelle gewöhnlich um ein oder zwei Produkte handelt, kann das PCR-Produkt der 2. Runde direkt sequenziert werden. Dazu wird der Sequenzierer ABI 373 (Applied Biosystems) und der Ready Reaction DyeDeoxy Terminator Cycle Sequencing KIT (Perkin Elmer) verwendet. (Abbildung 10) Mit Software-Programmen können die Sequenzen untereinander aber auch innerhalb eines Gens verglichen werden (Sequence Navigator, Applied Biosystem). Die so erstellte Textdatei (ATCG) wird dann mit internationalen Datenbanken zur Identifizierung der passenden Keimbahngene bzw. der vorhandenen Mutationen verglichen (Advanced WU-BLAST2 Search, EMBL und IGMT(http://dove.embl-heidelberg.de/Blast2/; http://imgt.cines.fr:8104/textes/vquest/ ).

Parallel wird jede Sequenz mit einer laborinternen Bank verglichen zum Ausschluß von Kontaminationen und Feststellung von Klonalitäten. Jede neu gefundene Sequenz wird in die Labordatenbank eingegeben.

Die hier genutzten Primer für die Analyse der B-Zell-Rezeptor-Gene lassen sich für genomische DNA und für cDNA nutzen, welche aus Biopsien gewonnen wurden ohne Separierung von Einzelzellen. Die TCR-γ-Gene lassen sich nur auf genomischer Ebene, nicht aber aus cDNA amplifizieren, da der T-Zell-Rezeptor-γ nicht mehr auf der reifen T-Zelle exprimiert wird. TCR-β kann auch auf cDNA-Ebene mit den vorgestellten Primern amplifiziert werden.


[Seite innerhalb Tabelle 36↓]

Tabelle V: Bezeichnung und Gen-Sequenz der Primer und ihrer Annealing-Temperaturen für verschiedene Gene

Bezeichnung

Gen-Familie

Annealing 1. Runde

Annealing

2. Runde

Primer

Konzentration in der PCR-Reaktion

VH1

IgH VH 1, 7

59 ° C

61 ° C

CCT CAG TGA AGG TYT CCT GCA AGG C

0,2 μ M

VH2

IgH VH 2

59 ° C

61 ° C

GTC CTG CGC TGG TGA AAC CCA CAC A

0,2 μ M

VH3

IgH VH 3

59 ° C

61 °C

GGG GTC CCT GAG ACT CTC CTG TGC AG

0,2 μ M

VH4

IgH VH 4

59 ° C

61 ° C

GAC CCT GTC CCT CAC CTG CRC TGT C

0,2 μ M

VH5

IgH VH 5

59 ° C

61 ° C

AAA AAG CCC GGG GAG TCT CTG ARG A

0,2 μ M

VH6

IgH VH 6

59 ° C

61 ° C

ACC TGT GCC ATC TCC GGG GAC AGT G

0,2 μ M

JH1ext.

IgH JH 1,2,4,5 ext.

59 ° C

 

ACC TGA GGA GAC GGT GAC CAG GGT

0,2 μ M

JH3ext.

IgH JH 3 ext.

59 ° C

 

TAC CTG AAG AGA CGG TGA CCA TTG T

0,2 μ M

JH6ext.

IgH JH 6 ext.

59 ° C

 

ACC TGA GGA GAC GGT GAC CGT GGT

0,2 μ M

JH1int.

IgH JH 1,4,5 int.

 

61 ° C /65 ° C

GAC GGT GAC CAG GGT KCC CTG GCC

0,2 μ M

JH2int.

IgH JH 2 int.

 

61 ° C 65 ° C

GAC AGT GAC CAGGGT GCC ACG GCC

0,2 μ M

JH3int.

IgH JH 3 int.

 

61 ° C /65 ° C

GAC GGT GAC CAT TGT CCC TTG GCC

0,2 μ M

JH6int.

IgH JH 6 int.

 

61 ° C /65 ° C

GAC GGT GAC CGT GGT CCC TTK GCC

0,2 μ M

V κ 1

Igκ Vκ 1

59 ° C

61 ° C

GAC ATC C(AG )G(AT) TG ACC CAG TCT C(AT)TC

1,0 μ M

V κ 2

Igκ Vκ 2

59 °C

61 ° C

CAG WCT CCA CTC TCC CTG YCC GTC A

1,0 μ M

V κ 3

Igκ Vκ 3

59 ° C

61 °C

TTG TGW TGA CRC AGT CTC CAG SCA CC

1,0 μ M

V κ 4

Igκ Vκ 4

59 ° C

61 ° C

AGA CTC CCT GGC TGT GTC TCT GGG C

1,0 μ M

V κ 5

Igκ Vκ 5

59 ° C

61 ° C

CAG TCT CCA GCA TTC ATG TCA GCG A

1,0 μ M

V κ 6

Igκ Vκ 6

59 ° C

61 ° C

TTT CAG TCT GTG ACT CCA AAG GAG AA

1,0 μ M

J κ 1ext.

Igκ Jκ 1,2,4 ext.

59 ° C

 

ACT CAC GTT TGA TYT CCA SCT TGG TCC

1,0 μ M

J κ 3ext.

Igκ Jκ 3 ext.

59 ° C

 

GTA CTT ACG TTT GAT ATC CAC TTT GGT CC

1,0 μ M

J κ 5ext.

Igκ Jκ 5 ext.

59 ° C

 

GCT TAC GTT TAA TCT CCA GTC GTG TCC

1,0 μ M

J κ 1int.

Igκ Jκ 1,2 int.

 

61 ° C

TTG ATY TCC ASC TTG GTC CCY TGG C

1,0 μ M

J κ 3int.

Igκ Jκ 3 int.

 

61 ° C

TTG ATA TCC ACT TTG GTC CCA GGG C

1,0 μ M

J κ 4int.

Igκ Jκ 4 int.

 

61 ° C

TTG ATC TCC ACC TTG GTC CCT CGG C

1,0 μ M

J κ 5int.

Igκ Jκ 5 int.

 

61 ° C

TTA ATC TCC AGT CGT GTC CCT TGG C

1,0 μ M

V λ 1

Igλ Vλ 1

59 ° C

63 ° C

GGT CCT GGG CCC AGT CTG TG

1,0 μ M

V λ 2

Igλ Vλ 2

59 ° C

63 ° C

CAG TCT GCC CTG ACT CAG CCT

1,0 μ M

V λ 3a

Igλ Vλ 3a

59 ° C

63 ° C

CTC AGC CAC CCT CAG TGT CCG T

1,0 μ M

V λ 3b

Igλ Vλ 3b

59 ° C

63 ° C

CTC AGC CAC CCT CGG TGT CAG T

1,0 μ M

V λ 4

Igλ Vλ 4

59 ° C

63 ° C

TTT CTT CTG AGC TGA CTC AGG AC

1,0 μ M

V λ 6

Igλ Vλ 6

59 ° C

63 ° C

GAG TCT CCG GGG AAG ACG GTA

1,0 μ M

V λ 7

Igλ Vλ 7

59 ° C

63 ° C

GTG GTG ACT CAG GAG CCC TCA C

1,0 μ M

V λ 8

Igλ Vλ 8

59 ° C

63 ° C

ACT GTG GTG ACC CAG GAG CCA

1,0 μ M

V λ 9

Igλ Vλ 9

59 ° C

63 ° C

CCT GTG CTG ACT CAG CCA CCT

1,0 μ M

J λ 1ext.

Igλ Jλ 1 ext.

59 ° C

 

GCC ACT TAC CTA GGA CGG TGA C

1,0 μ M

J λ 2ext.

Igλ Jλ 2,3 ext.

59 ° C

 

GAA GAG ACT CAC CTA GGA CGG TC

1,0 μ M

J λ 6ext.

Igλ Jλ 6,7ext.

59 ° C

 

GGA GAC TYA CCG AGG ACG GTC

1,0 μ M

J λ 1int.

Igλ Jλ 1 int.

 

63 ° C

GGA CGG TGA CCT TGG TCC CAG T

1,0 μ M

J λ 2int.

Igλ Jλ 2,3,7 int.

 

63 ° C

GAC GGT CAG CTT GGT SCC TCC

1,0 μ M

J λ 6int.

Igλ Jλ 6 int.

 

63 ° C

GAC GGT CAC CTT GGT GCC ACT

1,0 μ M

Vgcons

TCR-γ V 1-8 ext.

58 ° C

 

CTA CAT CCA CTG GTA CCT

1,0 μ M

Vg9ext.

TCR-γ V 9 ext.

58 ° C

 

ATT GGT ATC GAG AGA GAC

1,0 μ M

Vg10/11ext.

TCR-γ V 10,11 ext.

58 ° C

 

CAC TGG TAC KKG CAG AAA C

1,0 μ M

Jg1/2

TCR-γ J 1,2 ext.

58 ° C

 

CAA CAA GTG TTG TTC CAC

1,0 μ M

Vgseq

TCR-γ V 1-8 int.

 

58 ° C

AGR CCC CAC AGC ATC TTC

1,0 μ M

Vg9

TCR-γ V 9 int

 

58 ° C

GGA AAG GAA TCT GGC ATT CCG

1,0 μ M

Vg10

TCR-γ V 10 int.

 

58 ° C

AAT CCG CAG CTC GAC GCA GCA

1,0 μ M

Vg11

TCR-γ V 11 int.

 

58 ^C

GCT CAA GAT TGC TCA GGT GGG

1,0 μ M

Jcons

TCR-γ J 1,2 int.

 

58 ° C

CAA CAA GTG TTG TTC CAC

1,0 μ M

V β 3

TCR-β V 3

58 ° C

58 ° C

GTA ACC CAG AGC TCG AGA TAT CTA

1,0 μ M

V β 5.1

TCR-β V 5.1

58 ° C

58 ° C

AGC TCT GAG CTG AAT GTG AAC GCC

1,0 μ M

V β 6

TCR-β V 6

58 ° C

58 ° C

TCT CAG GTG TGA TCC AAA TTC GGG

1,0 μ M

V β 22

TCR-β V 22

58 ° C

58 ° C

AAG TGA TCT TGC GCT GTG TCC CCA

1,0 μ M

J β I-1

TCR-β J 1 ext.

58 ° C

 

ACI GWG AGY CIR GTY CC

1,0 μ M

J β II-1

TCR-β J 2 ext.

58 ° C

 

ACI GTS AGC CKI GTG CC

1,0 μ M

JßI-1

TCR-β J 1 int.

 

58 ° C

WGA GYC IRG TYC CII IIC CAA A

1,0 μ M

Jß II-1

TCR-β J 2 int.

 

58 ° C

TSA GCC KIG TGC CIG SIC CGA A

1,0 μ M

EBV I

 

59 ° C

61 ° C

GAG GTC AGG TTA CTT ACC CCT GAA G

0,2 μ M

EBV II

 

59 ° C

61 ° C

TCT CAG GGT CCC CTC GGA CAG CTC C

0,2 μ M


[Seite 37↓]

4.2.3.  Keimbahn- und Mutationsanalysen

Nach Vorliegen der Nukleinsäure-Sequenz der identifizierten Gene wurden die Daten wissenschaftlich analysiert. Zu Beginn einer jeden Analyse erfolgt der Vergleich des gewonnenen Gens mit der analogen Keimbahn- Konfiguration der rearrangierten Gene über die genannten Datenbanken (http://dove.embl-heidelberg.de/Blast2/; http://imgt.cines.fr:8104/textes/vquest/ ). Der Auswahl der Gene (usage) wird bei der Pathogenese einiger Erkrankungen eine Bedeutung beigemessen. So werden beispielsweise die Gene VH1-69.1 und VH1-02 häufig von der Tumorzelle bei B-CLL-Patienten verwendet (Sakai A, Blood, 2000). Möglicherweise haben Zellen, welche dieses VH- Gen rearrangiert haben, eine erhöhte Anfälligkeit für den Erwerb genetischer Aberrationen. Ähnliches wird über Patienten mit Autoimmunerkrankungen berichtet. So wurde ein bevorzugtes VH-Gen-usage des Keimbahngenes VH3-11 bei SLE-Patienten nachgewiesen. Vermutlich führt die starke B-Zell-Aktivierung bei einem SLE-Schub zu einem veränderten VH- Gen-usage, wodurch Autoimmunität nicht mehr verhindert werden kann (Dorner T, J Immunol, 1999).

Im zweiten Schritt werden die Mutationen auf dem individuellen Gen untersucht. Dabei wird wiederum die Nukleotidfolge der Keimbahn mit der Sequenz des individuellen Gens verglichen. Die Beurteilung der Mutationen erfolgt dann nach verschiedenen Gesichtspunkten:

  1. Die N-Regionen, welche die Identität eines Gens maßgeblich kennzeichnen, werden identifiziert. (Abbildung 9)Bei mehrmaligem Auftreten des gleichen Gens innerhalb eines Patienten kann von einer klonalen Proliferation der untersuchten Zellen ausgegangen werden. Werden identische Gene in verschiedenen Patienten gefunden, kann bei sorgfältiger Führung einer internen Labor-Gen-Datenbank eine Kontaminationen schnell erkannt werden.
  2. Die Anzahl der Mutationen in verschiedenen Gen-Abschnitten (CDR, FR) wird ermittelt.
  3. Die Anzahl der Mutationen gegenüber der potentiell physiologischen B-Zelle wird im Analogieschluß zur individuellen Zelle errechnet.
  4. Fortlaufende Mutationen (ongoing mutations) und intraklonale Diversität werden untersucht.
  5. Die Qualität der Mutationen (silent, replacement, potentiell produktiv oder nicht produktiv) wird ermittelt.

Physiologische B-Zellen haben die Möglichkeit, im Keimzentrum des Lymphknotens zu mutieren. Zunächst ist die Mutationsmaschinerie in den noch proliferierenden Zentroblasten, welche sich in der dunklen Zone des Lymphknotens befinden, aktiviert. So können auch in physiologischen expandierten Zentroblasten geringe Unterschiede bei der Lokalisation von Mutationen gefunden werden, welche als intraklonale Diversität bezeichnet werden. (Kuppers R, EMBO J, 1993). Wird dieser Prozeß der fortlaufenden Mutationen im Verlauf betrachtet, spricht man von „ongoing mutations“. Aus den Zentroblasten entwickeln sich die zur Teilung unfähigen Zentrozyten, welche dann in der sogannten hellen Zone des Lymphknotens erscheinen und antigenabhängig selektioniert werden. (Hentges F. Clin Exp Immunol, 1994) Die physiologische Mutationsrate liegt bei 10-3 pro Basenpaar und Zellzyklus. In Lymphomen kann die Mutationsrate bis zu 1 Mutation pro Zellzyklus gesteigert sein (Kuppers R, EMBO J, 1993) Die Gedächtniszelle weist dann eine Mutationsrate von ca. 4% auf (Berek C, Cell, 1991).


[Seite 38↓]

Analog zu den physiologischen Entwicklungsstadien lassen sich entsprechend der Erläuterungen im Abschnitt 3.1. und der Abbildung 9 die lymphoproliferativen B-Zell-Erkrankungen aus genetischer Sicht in Pre-Keimzentrumszell, Keimzentrumszell- und Post-Keimzentrumszell-Lymphome einteilen.

Die antigene Selektion ist ein diffiziler Prozeß. Die einfache Tatsache, daß Mutationen auf dem Gen des Immunglobulins stattfinden, garantiert die Affinitätsreifung des später entstehenden Immunglobulins nicht. Offensichtlich spielt auch die Lokalisation der Mutation eine Rolle. So werden die V-Gene in verschiedene Abschnitte entsprechend ihrer Funktion gegenüber dem Antigen eingeteilt: 1. in die CDR’s (complementary determining regions), welche im Protein die Kontaktstellen zum Antigen darstellen und 2. in FR’s (Framework), welche die Stützfunktion des Proteins erfüllen. Obwohl von einer Akkumulation der Mutationen in den CDR’s ausgegangen wird, wissen wir heute, daß durchaus auch in den FR’s Mutationen auftreten können.

Der Erfolg der Affinitätsreifung hängt zusätzlich von den Auswirkungen der Mutationen auf die Kodierung der Aminosäure ab. Demnach unterscheidet man „Silent mutations“ (Mutationen ohne Änderung der Aminosäure) und „Replacement mutations“ (Mutationen, in deren Folge sich die Aminosäure ändert). Nur Austauschmutationen können einen Effekt bei der Affinitätsreifung des B-Lymphozyten erreichen. Bei rein zufälligen Mutationen mit gleichmäßiger Verteilung über die CDR’s und die FR’s unter Beachtung von 61 Aminosäurekodierungen ergeben sich 526 Mutationsmöglichkeiten, 74,5% würden zu Austausch- und 25,5% zu stummen Mutationen führen (Jukes TH, Nature, 1979). Die R/S-Ratio beträgt dann 2,9. Werte der R/S-Ratio größer 2,9 werden in dieser Berechnung als positive Selektion der stattgefundenen R-Mutationen beurteilt, Werte kleiner 2,9 als Mechanismus zur Erhaltung der Protein-Struktur. Da die R/S-Ratio (intrinsische R/S-Ratio) vom Triplet abhängig ist , z.B. in der CDR1 R/S-RatioATG= 9/0 und R/S-RatioCGA= 4/4, führen Mutationen hier überdurchschnittlich häufig zu Aminosäureaustauschen. Die erwartete R/S-Ratio kann dann höher sein. (Chang B, Immunol Today, 1994).

Die Methodik zur Berechnung von Wahrscheinlichkeiten für das Auftreten von R-Mutationen wurde durch weitere Modelle ergänzt. Gebräuchlich sind folgende Berechnungen (Shlomchik MJ, Proc Natl Acad Sci U S A, 1987):

q = Rf x CDR rel

n : [ R erw ] CDR = q x n

(„mehr R-Mutationen als erwartet“ spricht für antigene Selektion)

p = [ n!/ k!(n-k)! ] qk(1-q) n-k

(„geringe Wahrscheinlichkeit“ spricht für eine selektionierte Mutationsverteilung)

q: Wahrscheinlichkeit mit der eine im VH-Gen auftretende Mutation als R-Mutation in den CDR’s erwartet werden kann

Rf: Frequenz der Austauschmutationen = 0,745;

CDR rel : relative CDR-Größe zum gesamten VH;

n : Mutationen insgesamt in einem VH-Gen

[ R erw ] CDR : erwartete Anzahl der R-Mutationen

q x n : tatsächlich beobachtete Anzahl der R-Mutationen

k: Anzahl der beobachteten R-Mutationen in den CDR’s

p: Wahrscheinlichkeit von Mutationen


[Seite 39↓]

Um eine genauere Aussage über antigenbedingte Selektion zu erhalten, muß die R/S-Ratio mit der intrinsischen R/S-Ratio verglichen werden.

Als potentiell produktiv wird ein Gen bezeichnet, welches aufgrund seiner Nukleotid-Sequenz in eine Aminosäure transkribiert werden könnte. Demzufolge dürfen Stop-Codons nicht enthalten sein.

4.2.4. Klonierung

Besonders häufig konnten bei den T-Zell-Analysen biallelische Gen-Rearrangements nachgewiesen werden. Um die Gen- Sequenzen beider Allele eindeutig zu identifizieren, bedienten wir uns der Technik der TA-Klonierung mittels eines kommerziellen KIT (TA-Cloning®, Firma Invitrogen®). Im Anschluß wurden die Plasmide einer linearen PCR unterzogen, wobei jeweils ein spezifischer Primer des gesuchten PCR-Produktes oder ein plasmidspezifischer Primer (M13R oder T7) verwendet worden ist. Die Sequenzierungsauswertung der Gensequenzen erfolgte wie im Abschnitt 4.1.5. erläutert.

4.2.5. Fluoreszenz-Fragment-Analyse (FFA)

Die Primer Vg1 und Vg2 (V10/V11) oder Jg1/2 wurden am 5’-Ende mit dye 5-carboxy-fluorescein (FAM) fluoreszenzmarkiert. Die fluoreszenzmarkierten PCR-Produkte der FFA wurden auf dem Gerät ABI 310 PRISM (capillary) oder auf dem Gerät ABI 373A (PAGE) (PE Applied Biosystems, Weiterstadt, Deutschland) analysiert. Für die FFA auf dem ABI 310 PRISM wurden 12µl deionisiertes Formamid und 0,5µl Genescan 500 TMROX interner Standard (PE Applied Biosystems, Weiterstadt, Deutschland) zu 1µl PCR-Produkt zugegeben und bei 90°C 2 Minuten lang mit anschließender Eiskühlung denaturiert. Jeder Lauf wurde bei 60°C und 15kV mit einer 5Sekunden-Injektion und 36 Minuten Separationszeit in einer 47cm langen POP Kapillare durchgeführt (PE Applied Biosystems, Weiterstadt, Deutschland).

Für die Analyse auf dem ABI 373 wurden 5µl deionisiertes Formamid, 0,5µl EDTA, 0,5µl Gene Scan 2500TMROX interner Standard (PE Applied Biosystems, Weiterstadt, Deutschland) und 0,5µl Dextran-Blau zu 2µl markiertem PCR-Produkt dazugegeben, wie beschrieben denaturiert, auf ein 4,75% Polyacrylamid-Gel (LC 6 premixed gel, FMC Bioproducts, Rockland, USA) aufgetragen und mit der Software „GeneScan“ (PE Applied Biosystems, Weiterstadt, Germany) analysiert.

4.3. Etablierung der PCR für die schweren Ketten der Immunglobulingene am Beispiel des Sjögren-Syndroms (Gellrich S, Arthritis Rheum, 1999)

Das Sjögren-Syndrom ist eine chronisch inflammatorische Erkrankung mit lymphozytären Infiltraten in allen exokrinen Drüsen, vor allem des Gesichtes. Klinisch stehen deshalb trockene Augen und Schleimhäute von Nase und Mundhöhle im Vordergrund. Das Sjögren-Syndrom kann ohne Begleiterkrankung oder infolge einer Autoimmunerkrankung auftreten. (Vitali C, Arthritis Rheum, 1993). Es ist bekannt, daß das Sjögren-Syndrom häufiger mit lymphoproliferativen Neoplasien assoziiert ist. (McCurley TL, Hum Pathol, 1990). Wie im Abschnitt 3.1. beschrieben, kann eine chronische antigene Stimulierung, beim Sjögren-Syndrom sind Autoantigene vorstellbar, zu einer [Seite 40↓]Immundysregulation führen, in deren Folge sich ein B-Zell-Lymphom entwickeln kann. (Tzioufas AG, Clin Exp Rheumatol, 1990).

Ziel dieser Untersuchungen war es, eine repräsentative Anzahl von VH-D-JH Gen-Transkripten zu untersuchen hinsichtlich ihres VH-Gen-usage (Auswahl eines zu rearrangierenden VH-Gens aus den möglichen Keimbahngenen) und ihrer somatischen Mutationen sowie die Frage zu beantworten, ob es zu einem Zeitpunkt, an dem keine klinisch und histologisch nachweisbare Lymphommanifestation vorlag, klonale VH-Transkripte in verschiedenen Biopsien (Speicheldrüse und Lymphknoten) gab.

Im Rahmen der Etablierung der PCR für die B-Zell-Rezeptor-Gene und der Analyse von Lymphomen untersuchten wir cDNA aus Speicheldrüsen- und Lymphknotenbiopsien von 2 Patienten mit Sjögren-Syndrom. Beide Patienten hatten im Serum positive Titer für die Autoantikörper Ro/SSA, La/SSB und den Rheumafaktor. Klinisch konnte ein pathologischer Schirmer-Test demonstriert werden. In der Ultraschall-Untersuchung konnten vergrößerte Lymphknoten festgestellt werden, die histologisch jedoch keinen Anhalt für eine lymphoproliferative Erkrankung ergaben. Von einem Patient (IL) wurden Lippenbiopsie- und Lymphknotenmaterial untersucht, von einem zweiten Patienten (UW) eine Lippenbiopsie.

Aus dem Biopsiematerial wurde mRNA und anschließend cDNA mit Hilfe kommerzieller KITs (OligotexDirektmRNAKit, Quiagen, Chatswoth,CA; Superscript Preamoplification System, Gibco-BRL, Eggstein, Deutschland) präpariert. Die PCR für die IgH-Genfamilien wurde wie im Abschnitt 4.1.4. beschrieben durchgeführt. Für die klonspezifische PCR wurden spezielle Primer zur Bindung an der CDR3-Region entwickelt (Patient IL: 5’ GCCCCAGTAGTCAAGGCCCGTAGAT 3’; Patient UW: 5’ CGTCCATGTAGTAGAACCCCAGATCCC 3’) Klonierung und Sequenzierung erfolgten wie in den Abschnitten 4.1.5. und 4.1.6. beschrieben.

Im Ergebnis wurden 94 VH-D-JH Transkripte kloniert und sequenziert. Die B-Zell-Infiltrate zeigten ein polyklonales Spektrum. In 92 VH-Transkripten wurden somatische Mutationen gefunden. Aus der Lippenbiopsie des Patienten IL konnten 13 VH-Gene amplifiziert werden. Alle VH-Gene stammten von verschiedenen Keimbahngenen ab. Aus dem Lymphknoten wurden 44 VH-Gene amplifiziert. Aus der Lippenbiopsie des Patienten UW konnten 13 Amplifikate für das VH-Gen-Rearrangment gewonnen werden.

Von 94 zeigten 81 Transkripte Sequenzen somatische Mutationen. 13 Gene waren zu über 99% nahezu keimbahnidentisch. Nach der Analyse der R- und S- Mutationen kann festgestellt werden:

Es wurden mehr R-Mutationen in den CDR’s als in den FR’s gefunden. Die R/S-Ratio war vergleichbar mit dem theoretisch erwarteten Wert für die entsprechenden VH-Keimbahngene (intrinsische R/S-Ratio). Die R/S-Ratio in den FR’s war signifikant niedriger als in der erwarteten Kalkulation. R-Mutationen erschienen häufiger am Übergang von CDR1 zu FR1. Im Repertoire der VH-Gene konnte kein bevorzugtes VH-Gen-usage für ein Gen oder eine VH-Gen-Familie nachgewiesen werden. In allen 3 Proben wurden unproduktive Gene gefunden. Bei dem Patienten IL wurden 3 identische PCR-Produkte aus 2 PCR-Ansätzen aus der Lippenbiopsie detektiert. Dieses Gen wurde außerdem im Lymphknoten des Patienten nachgewiesen. Auch beim Patienten UW konnten 2 identische PCR-Produkte aus 2 PCR-Ansätzen amplifiziert werden. Mit Hilfe spezifischer Primer wurden keine Hinweise auf das Vorhandensein der Klone im Blut des jeweiligen Patienten gefunden.


[Seite 41↓]

Die somatischen Mutationen in den klonal auftretenden Genen beider Patienten wurden ausgewertet. Bei Patient IL wurden 23, 24, 25 und 27 Mutationen im individuellen klonalen VH –Gen nachgewiesen. Bei Patient UW waren 25 Mutationen zu finden. Damit bestand eine Keimbahnhomologie zu 89,2% bei Patient IL und zu 89,9% in Patient UW.

Die Daten zeigen, daß die Mehrzahl der Sequenzen polyklonal sind und somit das histologische Bild eines entzündlichen Infiltrates im Lymphknoten bestätigt wird. Sowohl das VH-Gen-usage als auch die Mutationsmuster reflektieren ein Bild wie es auch im peripheren Blut, in der atopischen Dermatitis und im Nabelschnurblut nachgewiesen worden ist (Mortari F, J Immunol, 1993; Brezinschek HP, J Immunol, 1995; Tilgner J, Clin Exp Immunol, 1997).

Die VH-Gen-Transkripte zeigten eine Anhäufung von somatischen Mutationen. Die R-Mutationen sind in der FR gewöhnlich weniger mutiert als in der Kalkulation erwartet, um die Struktur des Proteins zu gewährleisten. Bei nichtproduktiven Genen, welche keinem Selektionsdruck unterliegen, sollte die gefundene R/S-Ratio mit der kalkulierten erwarteten R/S-Ratio korrelieren (Kuppers R, Eur J Immunol, 1997; Braeuninger A, Proc Natl Acad Sci U S A, 1997). In unseren produktiv rearrangierten Genen war die R/S-Ratio in den FR’s mit 1,67 erniedrigt was für eine antigenabhängige Selektion der B-Lymphozyten durch Expression funktionell intakter Immunglobuline spricht.

Die klonalen Sequenzen, welche bei beiden Patienten durch unabhängige PCR-Experimente nachgewiesen wurden, sind nicht zwingenderweise auf eine beginnende lymphoproliferative Erkrankung zurückzuführen. Im physiologischen Keimzentrum eines Lymphknotens wurden ebenfalls gering expandierte, klonale B-Zellen nachgewiesen. Diese Zellen befinden sich offensichtlich gerade im Prozeß der Affinitätsreifung (Kuppers R, EMBO J, 1993). Bei ähnlichen Untersuchungen von B-Zell-Immunglobulingenen aus reaktiven Infiltraten primär kutaner T-Zell-Lymphome konnten jedoch keine klonalen Sequenzen gefunden werden (Golembowski S, J Cutan Pathol, 1999). Dagegen zeigten Bahler et al an Verlaufsbiopsien von Sjögren-Patienten das Vorliegen individueller klonaler Sequenzen, wobei besonders häufig die VH-Gene VH1-69 und VH3-7 mit diesen Sequenzen assoziiert waren (Bahler DW, Blood, 1998). Die klonalen B-Zellen der beiden untersuchten Patienten in dieser Arbeit verwendeten die beschriebenen VH-Gene nicht. Im Gegensatz zu den Daten von Bahler et al wurde in unseren klonalen Transkripten intraklonale Diversität nachgewiesen, welche für ongoing mutations sprechen.

Das Phänomen der intraklonalen Diversität wurde bereits in nodalen follikulären Lymphomen, MALT-Lymphomen und in primär kutanen B-Zell-Lymphomen nachgewiesen (Du M, Leukemia, 1996; Bahler DW, Proc Natl Acad Sci U S A, 1992; Gellrich S, J Invest Dermatol, 2001). Ob diese ongoing mutations ausschließlich unter antigenem Einfluß möglich sind, sollte kritisch beurteilt werden. Auch andere Gene, sogenannte Proto-Onkogene in diffusen großzelligen Lymphomen der Lymphknoten sind von dem Prozeß der funktionell aktiven Hypermutation betroffen und akkumulieren somatische Mutationen (Pasqualucci L, Proc Natl Acad Sci U S A, 1998; Pasqualucci L, Nature, 2001).

Ob es sich bei den klonalen B-Lymphozyten um Vorläufer lymphoproliferativer Erkankungen handelt oder ob diese klonal expandierten B-Zellen zur Lymphomentstehung beitragen können, wurde in dieser Arbeit nicht geklärt. Auf jeden Fall sollten die beiden Patienten IL und UW sehr engmaschig kontrolliert werden hinsichtlich der Manifestation von lymphoproliferativen Erkankungen.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
XDiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
02.06.2005