Kettritz, Ralph: Untersuchungen zu zellulären Mechanismen bei ANCA-assoziierten nekrotisierenden Vaskulitiden Grundlagen der Aktivierung und der Apoptose neutrophiler Granulozyten

15

Kapitel 2. Material und Methoden

2.1 Puffer und Reagenzien

Reagenzien und Verbrauchsmaterialien

Ethanol 99,5% wurde von Merck, Darmstadt bezogen; Tween-20 von Serva, Heidelberg; Tris(hydroxymethyl)aminomethan (Tris), Natriumdodecylsulfat (SDS) von Merck, Darmstadt; RNA-STAT von Tel-Test, Inc., Friendswood, TX, USA; Trizol von GibcoBRL, Eggenstein; Ultra-Pure DNA Grade-Agarose von BioRad, München; P:C:IA enthält Phenol, Chloroform und Isoamylalkohol im Verhältnis 25:24:1 und wurde von GibcoBRL, Eggenstein erworben; modifiziertes Wright-Giemsa und 4',6 Diamidino-2-Phenylindole (DAPI) von Sigma, Dreisenhofen; NP 40 von Amersham, Little Chalfont, UK; Tetramethylethylendiamid (TEMED) von BioRad, München; Rinderserumalbumin (BSA), Propidium-Jodid und Dnase-freie Rnase von Sigma, Dreisenhofen; Ponceau S-Lösung von Seromed, Berlin; Ethidiumbromid von GibcoBRL, Eggenstein; Proteinmarker (prestained low/high range) und BioRad Protein Assay von BioRad, München; DNA-Standard, 1 kB-Leiter von GibcoBRL, Eggenstein; RT (reverse transcriptase)-PCR Kit, inclusive der Glyceraldehyde-3-phosphate Dehydrogenase (G3PDH) Primer von Clontech, Palo Alto, CA;USA; Histopaque 1083 von Sigma, Dreisenhofen; 19G Venofix Flügelkanülen und 50 ml Perfusorspritzen von Braun, Melsungen; Plasmagel von Cell Products Inc., Buffalo, NY, USA; Pepsin von Worthington Biochemical Corp., Freehold, NJ, USA; p-Nitrophenyl Phosphat Disodium von Sigma, St Louis, MO, USA; Limulus Amoebocytenlysat-Assay von Bio Whittaker, Walkersville, MA, USA; Annexin V als ApoAlert Kit von Clontech, Palo Alto, CA, USA; Dynal RAM IgG1 CELLection Kit mit Dynabeads für Ratte anti-Maus IgG1 von Dynal A.S., Oslo, Norway; Enhanced Chemiluminescence Kit mit Western Blotting Detektionsreagenzien von Amersham Life Science, Little Chalfont, UK; Immunopure Fab Präparations Kit, Protein A Chromatographie-Säule und Protein G Sepharose 4 Fast Flow von Pierce, Rockford, IL, USA; Spectra/Por Dialysemembranen von Spectrum Medical Industries, Laguna Hills, CA, USA; PVDF-Membran von Millipore, Eschborn; 0,2 µM Spritzenfilter von Gelman Science, Ann Arbor, MI, USA; N-Hydroxysuccinimid-Biotin, gekoppelt an einen Abstandshalter (NHS-LC-Biotin), Avidin und 2-(4-Hydroxyazobenzen) Benzolsäure (HABA) Test von Pierce, Rockford, IL, USA; Ferrizytochrom C, Toluidin Blau O, Cytochalasin B, Poly-Hydroxyl-Äthyl-Meth-Acrylat (PolyHema), Poly-L-Lysin, Kollagen Typ I und Typ IV und Laminin von Sigma, Dreisenhofen oder St. Louis, MO, USA; Fibronektin von Boehringer Mannheim, Mannheim; Caspase1- (YVAD-cmk) und Caspase3- (z-DEVD-fmk) Inhibitor von Calbiochem, Bad Soden; Urea von BioRad, München; Träger-Ampholyte, Servalyt von Serva, Heidelberg

Puffer

Phosphate-buffered saline (PBS) ohne Ca++ und Mg++ sowie Hanks balanced sodium solution (HBSS) von Seromed, Berlin; TBE-Elektrophorese-Puffer hergestellt aus 1 M Tris, 1 M Borsäure, 20 mM Na2EDTA.2H2O; TBS-T (137 mM NaCL, 20 mM Tris-HCL pH 7,5, 0,2%(w/v) Tween 20); NTE-Lysis Puffer bestehend aus 100 mM NaCl, Tris-HCl, pH 7,5 10 mM, 1 mM EDTA, pH 7,9, 1% SDS; TE-Puffer besteht aus 10 mM Tris-HCl und 1 mM EDTA, pH 8,0; PCR II Puffer von Invitrogen, DeSchelp, NL


16

Stimuli und Inhibitoren

Rekombinantes humanes TNFalpha und rekombinantes Interleukin-8 von Genzyme Corp., Boston, MA, USA oder Rüsselsheim; rekombinantes Groalpha von Laboserve, Giessen; Formyl-Methionyl-Leucyl-Phenylalanin (FMLP) und Phorbol 12-Myrstate 13-Acetate (PMA) von Sigma, Dreisenhofen oder St. Louis, MO, USA; Staurosporin, Calphostin C, Genistein, SB 202190 und PD 98059 von Calbiochem, Bad Soden

Zellkultur

RPMI 1640 Medium mit 2,0 g/l NaHCO3, ohne L-Glutamin wurden versetzt mit 5 ml Glutamin/ Penicillin, Streptomycin (L-Glutamin 29,2 mg/ml, Penicillin G 10000 U/ml, Streptomycinsulfat 10000 µg/ml) (alle Substanzen von Seromed, Berlin); Fetal Calf Serum (FCS) von Seromed, Berlin; 12 x 75 mm Polypropylen-Röhrchen von Falcon, Heidelberg; 12- und 96-Loch Zellkulturplatte sowie Zellkulturflaschen von Costar, Bodenheim

Antikörper

MOPC21 IgG1_ von Sigma, Dreisenhofen; Alkalische Phosphatase-gekoppelter Maus-AK mit Spezifität gegen humane Fcgamma-Fragmente und menschliche IgG oder Fc-Teile von Jackson ImmunoResearch Lab, West Grove, PA; F(ab')2-Fragmente eines Ziegen-Antikörpers gegen menschliches oder murines IgG (F(ab')2) von Cappel, Organon Tecknika Corp., Durham, NC, USA; die Anti-Phosphotyrosin-Antikörper Py20 von Transduction Lab., Lexington, KY, USA und 1G2 von Boehringer Mannheim, Mannheim; Antikörper gegen humanes Bcl-2 entweder als monoklonaler Maus-Antikörper, Klon 124 von Dako, Hamburg oder als polyklonaler Ratten-Antikörper von Santa Cruz Biotechnology, Santa Cruz, CA, USA; monoklonaler Maus-Antikörper (IgG1_, Klon 3G8) gegen FcgammaIII Rezeptor (CD16) von Pharmingen, San Diego, CA, USA; die monoklonalen Maus-Antikörper (als intaktes IgG1_ oder als F(ab')2) gegen den FcgammaIIa-Rezeptor (CD32) von Medarex, West Lebanon, NH, USA; monoklonaler Maus-Antikörper gegen CD9, Klon ALB6 von Coulter-Immunotech, Hamburg; der polyklonale Ziegen-Antikörper gegen Ly-GDI von Santa Cruz Biotechnology, Santa Cruz, CA; USA; die Maus IgG1_ Negativ-Kontrolle und der FITC-gekoppelte Ziegen-Antikörper (F(ab')2) gegen Maus-Ig von Dako, Hamburg

Geräte

Blot-Apparatur von MilliBlot, Milipore, Eschborn; Densitometer Bio-Rad 580, BioRad, München; Elektrophoresekammer für Acrylamidgele, Mini-Protean II-Kammer, BioRad, München; Elektrophoresekammer für Agarosegele von Agagel, Biometra, Berlin; Thermocycler, PE 9600 von Perkin Elmer, Weiterstadt oder Norwalk, CT, USA; FACScan von Becton Dickinson, Heidelberg oder Mountain View, CA, USA; Dia-Flo Ultrafilters YM 100 von Amicon, Beverly, MA; Konfokales Mikroskopie System, Modell MRC 600 von BioRad, München; Mikroskop, Modell Diaphot, Nikon, Berlin; Ultrazentrifuge, Optima TL, Rotor: TLA 100.3 von Beckman, München


17

2.2 Isolierung von humanen neutrophilen Granulozyten

Gesunden Spendern wurden 45 ml Blut mit einer 19G Venofix Flügelkanüle entnommen. Das Blut wurde in einer heparinisierten 50 ml Perfusorspritze (Luer) gesammelt und mit 15 ml Plasmagel in der Spritze durch vorsichtiges Schwenken vermischt. Nach einer Stunde Sedimentationszeit bei Raumtemperatur wurde der Überstand über eine 19G Flügelkanüle in ein 50 ml Zentrifugenröhrchen aus Polypropylen überführt und mit 7 ml Histopaque 1083 unterschichtet. Nachfolgend erfolgte eine Zentrifugation für 30 min bei 1200 U/min und 4°C. Zur hypotonen Lyse der kontaminierenden Erythrozyten wurde der Überstand abgesaugt und das Zellpellet in 10 ml sterilem Aqua bidest resuspendiert. Nach 20 s wurden 3,33 ml 3,6% NaCl-Lösung zugegeben, um wieder isotone Bedingungen herzustellen. Es folgte eine weitere Zentrifugation für 8 min bei 1100 U/min und 4°C. Anschließend wurde der Überstand abgesaugt und das Pellet in HBSS (für die Versuche zur Bestimmung der Superoxid-Generation) oder in RPMI 1640 Medium (für die Untersuchungen zur Apoptose) resuspendiert.

2.3 Aktivierung neutrophiler Granulozyten durch ANCA

2.3.1 Präparation der intakten Immunglobuline und der Immunglobulin-Fragmente

Die in den Experimenten verwendeten humanen Immunglobuline wurden aus den Seren von 2 Patienten mit PR3-ANCA bei bioptisch gesicherter Wegener'scher Granulomatose (K.M., R.R) und von 2 Patienten mit MPO-ANCA-positiver mikroskopischer Polyangiitis (T.R., A.A.) isoliert. Gleichzeitig erfolgte die Präparation von Immunglobulinen aus dem Blut gesunder Spender. Wir versetzten die Seren mit einem gleichen Volumen von gesättigtem Ammoniumsulfat und dialysierten die Proben in einer Spectra/Por Membran über Nacht bei 4oC gegen 20 mM Natrium Phosphat Puffer, pH 7,0 (Bindungspuffer). Die Proben wurden durch einen 0,2 µM Spritzenfilter gefiltert und in eine Protein-G-Affinitätssäule geladen. Das gebundene Immunglobulin wurde mittels 0,1 M Glyzin-HCL Puffer, pH 2,75, (Elutionspuffer) von der Säule abgelöst. Der pH-Wert wurde unmittelbar anschließend durch Zusetzen von 1 M Tris-HCL, pH 9,0, auf 7,0 eingestellt. Die Konzentration des monoklonalen Maus-Antikörpers gegen humane PR3 (IgG1_), der früher in unseren Labor etabliert und charakterisiert wurde, erfolgte aus dem Zellkulturüberstand unter Verwendung eines Dia-Flo Ultrafilters YM 100 und die weitere Aufreinigung mittels Protein-G-Säulen-Chromatographie. Als Isotypen-Kontrolle für die Experimente mit diesem Antikörper diente ein muriner monoklonaler IgG1_, der in der Hybridom-Zellinie MOPC 21 produziert wurde.

F(ab')2 von humanen ANCA, vom monoklonalen Maus-Antikörper gegen humane PR3 und von Immunglobulinen gesunder Spender wurden nach der Methode von Lamoyi präpariert (Lamoyi, 1986). Dazu wurden die aufgereinigten Immunglobuline über Nacht gegen 0,1 M Natrium Azetat-Puffer (pH 7,0) dialysiert. Nachdem der pH-Wert der Lösung unmittelbar vor der Pepsinspaltung auf 4,25 (humane Immunglobuline) oder 4,0 (Maus-Antikörper) eingestellt wurde, erfolgte die Zugabe von Pepsin bei einer Enzym/Antikörper-Ratio von 1:33. Nach einer Inkubation des Gemisches für 7,5 h bei 37oC wurde die Reaktion gestoppt. Die Proben wurden erneut gegen Bindungspuffer dialysiert und mittels Säulen-Chromatographie aufgereinigt. Dabei erfolgten soviele


18

Läufe über die Säule (2-4), bis kein Elutionsgipfel (also kein kontaminierendes, ungespaltenes Immunglobulin) mehr meßbar war.

Fab-Fragmente von humanen ANCA wurden unter Verwendung des Immunopure-Fab-Präparations-Kit hergestellt. Die Papain-Spaltung erfolgte bei 37oC für 9 h, wonach die Proben gegen Protein-A-Bindungspuffer dialysiert wurden. Kontaminierende, intakte Immunglobuline wurden durch die Protein-A-Affinitätssäule entfernt (2-3 Läufe). Die Reinheit der F(ab')2- und Fab-Präparationen wurde mit Natriumlaurylsulfat-Polyacrylamid-Gelelektrophoresen (SDS-PAGE) und, wie im nächsten Abschnitt beschrieben, mittels ELISA nachgewiesen. Die humanen ANCA, der monoklonale Maus-Antikörper gegen humane PR3 und die korrespondierenden F(ab')2-Fragmente wurden auf Alkohol-permeabilisierten neutrophilen Granulozyten getestet und zeigten die entsprechenden c-ANCA- oder p-ANCA-Muster in der indirekten Immunfluoreszenz. Intakte ANCA wurden zusätzlich mittels ELISA auf ihre Reaktivität gegen aufgereinigte PR3 und MPO untersucht.

Die Proteinkonzentrationsmessungen der Antikörper und ihrer Fragmente erfolgten im Coomassie-Protein-Assay. Alle Immunglobulinpräparationen wurden auf Endotoxin getestet und waren im Limulus-Amoebozytenlysat-Assay bei einer Sensitivität von 0,1 ng/ml negativ.

2.3.2 ELISA zur Bestimmung der Reinheit der ANCA F(ab')2-und Fab-Fragmente

96-Loch-Platten wurden mit 0,75 µg/Loch affinitätsgereinigtem Ziegen-AK mit Spezifität gegen den Fc-Teil von menschlichem IgG beschichtet. Die zu testenden Antikörperfragmente wurden in 100 µl Puffer verdünnt (50 mM Natriumazetat, 100 mM Natriumchlorid, pH 6,0). Verbliebene Bindungstellen auf den Platten wurden mit 200 µl Blockierpuffer geblockt (PBS/0,05% Tween/0,5% Ziegenserum), und menschliche IgG oder Fc-Teile (aufsteigende Konzentrationen zwischen 1 ng - 5 µg), markiert mit Chromo Pure, wurden zu den wells gegeben. Ein µg/well ANCA F(ab')2- und Fab-Fragmente wurden simultan getestet. Nach einer Inkubation von 1 h bei Raumtemperatur wurden 100 µl/well eines Alkalische Phosphatase-gekoppelten Maus-AK mit Spezifität gegen humane Fcgamma-Fragmente zugegeben (Verdünnung von 1:20.000). Die Entwicklung erfolgte mit p-Nitrophenyl Phosphat Disodium, bevor der Optische-Dichte-Wert (OD) nach 1 h bei 405 nm bestimmt wurde. Der OD der ANCA F(ab')2- und Fab-Fragmente wurde mit der erstellten Standardkurve verglichen und zeigte, daß 1 µg ANCA F(ab')2-Fragmente mit 1-2 ng Fc-Teilen kontaminiert waren und daß 1 µg Fab-Fragmente weniger als 1 ng Fc-Teile enthielt.

2.3.3 Durchflußzytometrische Studien zu den Bindungseigenschaften von intakten ANCA und den F(ab')2- und Fab-Fragmenten

Die Durchflußzytometrie wurde eingesetzt, um die Bindungseigenschaften von intakten ANCA und den korrespondierenden F(ab')2- und Fab-Fragmenten sowie von den intakten Kontroll-Immunglobulinen und den entsprechenden F(ab')2-Fragmenten zu untersuchen. Es wurden weiterhin Bindungsstudien mit dem monoklonalen Maus-Antikörper gegen humane PR3 und dem korrespondierenden F(ab')2-Fragment durchgeführt. Die Antikörperpräparationen wurden dazu biotinyliert, und die Biotininkorporation wurde mit dem 2-(4-Hydroxyazobenzen)-Benzolsäure-(HABA)-Test kontrolliert. Das Verhältnis von Biotin zum Immunglobulin bzw.


19

Immunglobulinfragment war wie folgt: 6,0 für PR3-ANCA; 4,8 für PR3-ANCA-F(ab')2; 4,3 für PR3-ANCA-Fab und 3,8 für Kontroll-F(ab')2-Fragmente.

2,5x106 neutrophile Granulozyten wurden mit 1,33 ng/ml TNFalpha für 15 min bei 37oC geprimt und nachfolgend mit 50 µg biotinyliertem Antikörper in einem Gesamtvolumen von 500 µl HBSS für 20 min bei 4oC inkubiert. Ungebundener Antikörper wurde durch Waschen mit kaltem PBS entfernt. Die Zellen wurden mit 200 µl (2 µg) Fluorescein-Isothiozyanat (FITC)-konjugiertem Avidin für 20 min bei 4oC inkubiert, erneut gewaschen und in 1% Paraformaldehyd fixiert.

Die Bindung des intakten monoklonalen Maus-Antikörpers gegen humane PR3 und des korrespondierenden F(ab')2-Fragmentes (je 4 µg) wurde mittels indirekter Immunfluoreszenz unter Verwendung eines FITC-beladenen Schaf-F(ab')2-Fragmentes untersucht, das gegen Maus-IgG gerichtet ist (20 µg/ml). Der MOPC-21 Antikörper diente als Isotypenkontrolle. Die Durchflußzytometrie wurde an einem FACScan durchgeführt, wobei 10.000 Ereignisse aquiriert wurden.

2.3.4 Messung der Superoxid-Generation

Superoxid wurde im Standard-Assay der Superoxiddismutase-hemmbaren Ferrizytochrom-C-Reduktion gemessen. Dazu wurden die neutrophilen Granulozyten mit 5 µg/ml Cytochalasin-B für 15 min bei 4oC vorbehandelt (5 µg/107 Zellen). Das Priming von 2,5x106 Zellen erfolgte mit TNFalpha für 15 min bei 37oC. Dazu kamen 1 ng/ml TNFalpha (Genzyme Corp., Boston, MA) in den Experimenten mit monoklonalen Maus-Antikörpern gegen humane PR3 und 1,33 ng/ml in den Experimenten mit menschlichen ANCA-Präparationen zum Einsatz. Intakte Immunglobuline, F(ab')2, Fab oder Pufferkontrolle wurden zugegeben und für 30 min bei 37oC inkubiert. Das Gesamt-Assayvolumen betrug 500 µl, mit einer finalen Ferrizytochrom-C-Konzentration von 50 µM und einer Zellkonzentration von 2,5x106/ml. Die Reaktion wurde auf Eis gestoppt und die Zellen wurden in einer gekühlten Zentrifuge bei 1200 U/min pelletiert. Es erfolgte die Messung der Absorption des Überstandes bei 550 nm in den Proben mit und ohne 125 µg/ml SOD (Microplate Autoreader, Bio Tek Instruments). Natrium-Dithionit wurde zu den Proben ohne SOD zugegeben, um eine vollständige Reduktion des Ferrizytochroms zu bewirken, und die Absorption wude erneut bestimmt. Die Menge an generiertem Superoxid wurde über die Menge des reduzierten Ferrizytochroms berechnet, und die Ergebnisse wurden in nmol O2-/2,5x106 Zellen/30min angegeben. Jede Bedingung wurde in einer Doppelbestimmung getestet. Die basale Superoxid-Generation der TNFalpha-geprimten neutrophilen Granulozyten wurde in jedem einzelnen Experiment gemessen und von den Ergebnissen der stimulierten Proben subtrahiert.

2.3.5 Quervernetzung von ANCA-Antigenen

Nach dem Priming von 2,5x106 neutrophilen Granulozyten mit TNFalpha für 15 min bei 37oC wurden ANCA-Fab-Fragmente (125 µg/ml) oder F(ab')2-Fragmente des monoklonalen Maus-Antikörper gegen humane PR3 (4 µg/ml) für 10 min zugegeben. Danach wurden die ungebundenen Fragmente durch Waschen entfernt, und die Zellen wurden für weitere 30 min bei 37oC in der Anwesenheit von F(ab')2-Fragmenten eines Ziegen-Antikörpers gegen menschliches (15 µg/ml) or


20

murines (4 µg/ml) IgG (F(ab')2) inkubiert. In zwei Experimenten wurde eine zweite Methode verwendet, bei der biotinylierte ANCA-Fab-Fragmente (125 µg/ml) (Patient R.R.) mit Avidin (15 µg/ml) quervernetzt wurden. Als die basale, zu subtrahierende Superoxid-Generation wurde in diesen Experimenten das Waschen von TNFalpha-geprimten neutrophilen Granulozyten, die nur mit dem sekundären Antikörper bzw. dem Avidin inkubiert wurden, berücksichtigt.

2.3.6 Blockade des FcgammaIIa-Rezeptors

TNFalpha-behandelte neutrophile Granulozyten wurden mit sättigenden Dosen eines anti-FcgammaIIa-Rezeptor-Antikörpers (10 µg/ml intakter Antikörper oder dieselbe Menge Fab-Fragmente) inkubiert. Nach 15 min erfolgte die Zugabe der humanen PR3-ANCA (125 µg/ml) oder des monoklonalen Maus-Antikörpers gegen menschliche PR3 (4 µg/ml). Die Generation von Superoxid wurde, wie oben beschrieben, mit dem Standard-Assay der Superoxiddismutase-hemmbaren Ferrizytochrom-C-Reduktion gemessen. In zwei Experimenten wurde ein Zeitverlauf des Effektes der FcgammaIIa-Rezeptorblockade auf die ANCA-stimulierte Superoxid-Produktion (Patient K.M.; PR3-ANCA) erstellt. Dazu wurden TNFalpha-vorbehandelte (1.33 ng/ml) neutrophile Granulozyten entweder mit Fab-Fragmenten eines Anti-FcgammaIIa-Rezeptor-Antikörpers (10 µg/ml) oder mit einer Pufferkontrolle inkubiert, bevor die Stimulation mit 125 µg/ml PR3-ANCA erfolgte. Die Reaktion erfolgte bei 37oC und wurde nach 5, 15, 30 und 60 min gestoppt. Anschließend wurde die Menge an generiertem Superoxid bestimmt. Unspezifische Effekte der Rezeptorblockade wurden bei der Stimulation mit 50 ng/ml PMA und 10-7 M FMLP untersucht.

2.4 Zellkultur

2.4.1 Zellkulturbedingungen

10 µl Zellsuspension wurden mit 40 µl Trypanblau 0,5% gemischt und 10 µl dieser Mischung in eine Neubauer-Zählkammer pipettiert. Die Zellkonzentration wurde nach Auszählung von drei Proben auf 107 Zellen pro ml eingestellt. Bei allen Experimenten lag der Anteil vitaler Zellen, das heißt Trypanblau ausschließender Zellen bei über 95%. Die neutrophilen Granulozyten wurden bei einer Endkonzentration von 5 x 106 Zellen pro ml RPMI mit 10% FCS in einem Inkubator bei 37°C und 5% CO2 kultiviert. Die Kultivierung erfolgte in einem Gesamtvolumen von 500 µl, entweder in 12x75 mm Polypropylen-Zellkulturröhrchen oder in beschichteten 12-Loch-Kulturplatten. Wenn angegeben, erfolgte eine Stimulation der Zellen mit TNFalpha, Interleukin-8, Groalpha, FMLP oder PMA. In Experimenten zur Signaltransduktion wurden die Zellen mit Inhibitoren verschiedener Proteinkinasen für 15 min auf Eis vorinkubiert. Sämtliche Versuche wurden als Doppelbestimmungen ausgeführt und beinhalteten immer die entsprechenden Lösungsmittelkontrollen. Alle Präparationen und Arbeiten zur Zellkultur wurden unter der Sterilbank unter Verwendung von endotoxinfreien Reagenzien ausgeführt.


21

2.4.2 Beschichtung der Zellkulturplatten

In den Experimenten zum Effekt extrazellulärer Matrixsubstanzen auf die Apoptose wurden Zwölf-Loch-Zellkulturplatten aus Polystyren verwendet, während für den Adhäsionsassay 96-Loch-Platten aus Polystyren zum Einsatz kamen. Um Bedingungen zu erzielen, die eine Adhärenz der Zellen verhindern, erfolgte die Beschichtung mit PolyHema (50 mg/ml). Diese Technik wurde von Folkman erstmals beschrieben (Folkman und Moscona, 1978). Die folgenden Reagenzien wurden zur Beschichtung verwendet, um adhärente Kulturbedingungen zu erreichen: Fibronektin (10 µg/cm2), Laminin (2 µg/cm2), Kollagen I (10 µg/cm2), Kollagen IV (10 µg/cm2), und Poly-L-Lysin (10 µg/cm2). Die Beschichtung erfolgte nach den Empfehlungen des Herstellers.

2.5 Nachweis der Apoptose

2.5.1 Färbung mit Propidium-Jodid

Als eine Methode zur Bestimmung und Quantifizierung der Apoptose wurde die Färbung mit Propidium-Jodid eingesetzt. Dabei wurde der DNA-Gehalt in Ethanol-permeabilisierten Zellen bestimmt. Apoptose führt zu einer Aktivierung von Endonukleasen und somit zur internukleosomalen Spaltung von DNA. Die niedrigmolekularen DNA-Bruchstücke verlassen während des Wasch- und Färbevorganges die Zellen. Die Folge ist ein verminderter DNA-Gehalt apoptotischer Zellen verglichen mit nicht-apoptotischen Zellen. Frisch isolierte oder kultivierte Zellen wurden bei 1100 U/min und 4°C für 7 min zentrifugiert und vorsichtig in 300 µl PBS/0,5 mM EDTA resuspendiert. 900 µl 95% Ethanol (-20°C) wurden tropfenweise zugegeben, bevor die Zellsuspension für ein bis drei Tage bei -20°C aufbewahrt wurde. Danach wurden die Zellen pelletiert (1100 U/min, 4°C, 7 min) und in 200 µl PBS/0,5 mM EDTA/1% BSA resuspendiert. Es erfolgte die Zugabe von 200 µl PBS mit 16,0 µg DNase-freier RNase und 400 µl PBS mit 40 µg Propidium Jodid. Die Zellen wurden 15 min bei Raumtemperatur, in Dunkelheit und weitere 15 min auf Eis inkubiert. Um zu gewährleisten, daß die niedrigmolekularen DNA-Bruchstücke die permeabilisierten Zellen verlassen können, wurden die Proben für 6-8 h im Kühlschrank aufbewahrt.

Die Messungen der Apoptoserate erfolgte mit einem Durchflußzytometer FACScan (Fluorescence-activated cell sorter). Im Programm LysisII/Acquisition (Becton Dickinson) wurden pro Probe 10.000 Ereignisse eingelesen und gespeichert. Die Auswertung wurde mit der Software LysisII/Analysis vorgenommen. Zellgröße und Granularität wurden anhand der Lightscatter (FSC-Height und SSC-Height) ermittelt. Durch spezielle Gating-Techniken mit den Parametern FL2-Area und FL2-Width erfolgte der Ausschluß von Zell-Doublets und -Triplets. Der auf Einzelzellebene bestimmte DNA-Gehalt korreliert mit der Fluoreszensintensität des Propidium-Jodids im Kanal FL-2.

2.5.2 Färbung mit Annexin

Ein frühes Apoptosezeichen ist die Translokation von Phosphatidylserin von der Innenseite der Plasmamembran auf die Zelloberfläche. FITC-markiertes Annexin-V, ein Protein mit starker Affinität zu Phosphatidylserin, kann somit an dieses Phospholipid binden (Martin., 1995). Die Fluoreszenzintensität des FITC ist proportional zur Menge an exprimiertem Phosphatidylserin und


22

damit zur Apoptoserate der Zellen. Zur Annexin V-Färbung benutzten wir das ApoAlertTM-Annexin-V-Apoptosis-Kit. 1 x 106 frisch isolierte oder kultivierte Zellen wurden einem Waschvorgang mit PBS unterzogen, anschließend pelletiert und in 200 µl Bindungspuffer resuspendiert. Nach der Zugabe von 10 µl Annexin-V (Endkonzentration 1 µg/ml) wurden die Zellen in der Suspension vorsichtig gemischt und für 5 min bei RT in Dunkelheit inkubiert. Danach folgte die Analyse in der Durchflußzytometrie. Pro Probe wurden 10.000 Ereignisse acquiriert und gespeichert. Die Auswertung wurde mit der Software LysisII/Analysis vorgenommen.

2.5.3 Bestimmung der FcgammaIII (CD16)-Rezeptor-Expression

Die spontane Apoptose neutrophiler Granulozyten führt zur proteolytischen Abspaltung des FcgammaIII-Rezeptors (Homburg, 1995). Wir verwendeten eine Färbung der Zellen mit einem FITC-gekoppelten monoklonalem Antikörper gegen den FcgammaIII-Rezeptor, um den Prozentsatz apoptotischer Zellen zu quantifizieren. Frisch isolierte oder kultivierte neutrophile Granulozyten wurden dazu einmal in eiskaltem PBS gewaschen. 1x106 Zellen wurden anschließend mit 10 µl des FITC-gekoppelten Antikörpers in einem Volumen von 100 µl PBS für 20 min auf Eis inkubiert, gewaschen und im FACScan analysiert. Pro Probe wurden 10.000 Ereignisse eingelesen und gespeichert. Die Auswertung erfolgte mit der Software LysisII/Analysis.

2.5.4 Zellfärbung mit Wright Giemsa und 4',6 Diamidino-2-Phenylindol

Morphologische Zeichen der Apoptose sind ausführlich durch Kerr et al. beschrieben worden (Kerr, 1972) und beinhalten das Schrumpfen der Zellen, Kernpyknosen, die Kondensation von Kern und Zytoplasma sowie die Bildung sogenannter apoptotischer Körperchen. Für diese Untersuchungen zentrifugierten wir frisch isolierte oder kultivierte Zellen mit einer Zellzentrifuge auf einen Objektträger. Die Präparate wurden in 70% Ethanol fixiert und anschließend entweder mit modifizierter Wright-Giemsa-Lösung oder mit DAPI (1 µg/ml) gefärbt. Die Auswertung erfolgte durch Licht- (Wright-Giemsa) bzw. UV-Mikroskopie (DAPI).

2.5.5 DNA-Fragmentations-Assay

Frisch isolierte oder kultivierte Zellen wurden pelletiert (1100 U/min, 7 min, 4°C) und in 750 µl NTE-Lysispuffer resuspendiert. Nach 4-5 h Inkubation bei 37°C erfolgten die Zugabe von 5 µl Proteinase K (20 mg/ml) und die Fortführung der Inkubation für weitere drei Stunden bei 37°C. Nach Zentrifugation für 20 min (13000 U/min, 4°C) wurde der Überstand, der die Gesamt-DNA enthielt, in ein neues Gefäß überführt. Es erfolgte eine zweimalige Extraktion der DNA durch Zugabe von 750 µl P:C:IA (25:24:1) mit anschließender Zentrifugation (13000 U/min, 7 min, RT). Es folgten zwei weitere Extraktionsschritte mit je 750 µl C:IA (Chloroform: Isoamylalkohol) (24:1). Das Volumen des zuletzt erhaltenen Überstandes wurde bestimmt und ein Zehntel dieser Menge an 3 M Na-Acetat (pH 5,2) zugesetzt. Die DNA wurde über Nacht bei -20°C in dem 2,2-fachen Volumen absoluten Ethanols präzipitiert. Anschließend wurden die Proben erneut zentrifugiert (13000 U/min, 15 min, 4°C), der Überstand verworfen und die DNA bei RT getrocknet. Die DNA wurde mit 17 µl TE-Puffer/RNase aufgenommen und 15 min bei 37°C inkubiert. Die DNA-Konzentration wurde photometrisch bestimmt. Dazu wurden 2 µl der DNA-Suspension in 98 µl TE-


23

Puffer gegeben. Die Extinktion dieser Lösung wurde bei 260 nm gemessen. Die Berechnung der DNA-Konzentration erfolgte nach folgender Formel: A260 x 50 (Verdünnungsfaktor) x 50 (Konstante für DNA) / 1000 = Konzentration in µg/µl. Für die Herstellung eines 1,5% Agarosegels wurden 45 g Agarose (Serva) mit 30 ml TBE-Puffer aufgekocht, 1,5 µl Ethidiumbromid zugefügt (Endkonzentration 0,5 µg/ml) und in die Gelkammer gegossen. Jeweils 7 µg DNA wurden pro Bahn geladen. Die Elektrophorese erfolgte bei 80 V. Ethidiumbromid interkaliert mit der DNA und fluoresziert im UV-Licht. Die auf diese Weise dargestellten DNA-Banden wurden mit einer Computerkamera fotografiert und im Tiff-Format auf Diskette gespeichert.

2.6 Bestimmung der Zelladhäsion und des Zell-Spreadings

96-Loch-Zellkulturplatten wurden mit PolyHema, Fibronektin oder mit Poly-L-Lysin beschichtet. 1 x 105 neutrophile Granulozyten in 100 µl Medium wurden in jedes Loch pipettiert und mit Pufferkontrolle oder 20 ng/ml TNFalpha stimuliert. Die TNFalpha-Behandlung erfolgte entweder ohne oder mit einer Vorinkubation der Zellen für 20 min in 50 µM Genistein auf Eis. Die Platten wurden für die angegebenen Zeitabschnitte in einem Inkubator bei 37oC und 5% CO2 kultiviert. Der Überstand mit den nicht-adhärierten Zellen wurde anschließend verworfen. Die Platten wurde 3x mit PBS gewaschen und anschließend mit 10% Formalin für 15 min bei RT fixiert. Nach Färbung der verbliebenen adhärenten Zellen in 100 µl Toluidin Blau wurden die Platten 3x mit destilliertem Wasser gewaschen, und die Zellen wurden in 2% SDS für 10 min lysiert. Die Bestimmung der OD (optical density) erfolgte bei 600 nm. Jedes Experiment wurde als 3fach-Bestimmung durchgeführt. Wir etablierten eine Dosis-Wirkungsbeziehung in Form einer Standardkurve für ansteigende Zellzahlen zwischen 1x104 - 1x105. Der R-Wert von 0,983 demonstriert eine sehr enge Korrelation zwischen der Zellzahl und dem OD. Die Beurteilung der Adhärenz der Zellen auf PolyHema erfolgte mittels Phasenkontrastmikroskopie, da der Toluidin Blau-Assay mit dem PolyHema-Reagenz interferierte.

Für die Einschätzung des Zell-Spreadings benutzten wir die Phasenkontrastmikroskopie. Die Zellen wurden dazu, wie im Absatz Zellkultur beschrieben, in 12-Loch-Platten inkubiert. Zu den angegebenen Zeitpunkten wurden die nicht-adhärenten Zellen verworfen und der Anteil der Zellen, die ein Spreading aufwiesen, bestimmt. Jede Probe wurde von 2 Untersuchern bewertet. Ein Minimum von 100 Zellen pro Probe wurden ausgewertet und solche Zellen, die im Phasenkontrast dunkel erschienen, vergrößert waren und unregelmäßige Konturen zeigten, galten als positiv im Sinne des Spreadings.

2.7 Analyse der Proteinexpression

2.7.1 Western Blot-Analyse zur Expression von Bcl-2 und Ly-GDI sowie zur Detektion von Tyrosin-phosphorylierten Proteinen

Die Zellen wurden nach der Inkubation unter den entsprechenden Versuchsbedingungen geerntet, in eiskaltem Puffer lysiert (20 mM Tris-HCL, pH 8.0 mit 138 mM NaCl, 1% Triton X-100, 2 mM EDTA, 10% Glycerol, 0.2 mM Natriumorthovanadat, 1 mM PMSF, 10 µg/ml Aprotinin, 10 µg/ml Leupeptin, 0.1 mM Quercetin, 5 mM Jodoacetamid) und für 20 Minuten auf Eis gelagert. Nach der


24

Zentrifugation (12.000 G, 4oC) wurde der Überstand abpipettiert und die Proteinkonzentration mit dem BCA-Proteinbestimmungs-Assay gemessen. Der Überstand wurde bis zur Verwendung bei -20oC aufbewahrt. Nach Kochen der Proben bei 95oC in Ladepuffer (250 mM Tris-HCL, pH 6,8 mit 4% SDS, 20% Glycerol, 0.01% Bromphenolblau und 0,05% Mercaptoethanol) für 5 Minuten wurden 30 µg Protein/Bahn in einem SDS-Polyacrylamid-Gel aufgetrennt. Da die mit SDS beladenen Proteine von der Anode zur Kathode wandern, können die Proteine aus dem Gel auf eine Membran übertragen werden. Vor dem Blotten in semi-dry-Technik wurden das Gel und die Polyvinylidendifluorid (PVDF)-Membran in Transfer-Puffer eingelegt, wobei die Membran zusätzlich zuvor mit Methanol benetzt wurde. Der Transfer erfolgte innerhalb von 45 min mit einer Stromstärke von 2,5 mA/cm2 Gelfläche. Die Membran wurde über Nacht in 5% Magermilch/TBS-T bei 4o C geblockt, in TBS-T gewaschen (40 min mit 4-maligem Wechsel der Waschlösung) und anschließend mit dem entsprechenden primären Antikörper (in 1% BSA/TBS-T verdünnt) für 1,5 h bei RT inkubiert. Nach erneutem Waschen wurde der Blot mit dem Peroxidase-konjugierten sekundären Antikörper (1:10.000 in 1%BSA/TBS-T verdünnt) für 1 h bei RT inkubiert, gewaschen und mit Chemielumineszenz-Substrat entwickelt. Am Ende erfolgte die Exposition auf einem Röntgenfilm (Kodak).

2.7.2 Nachweis der Expression von Bcl-2 mit der Durchflußzytometrie

Frisch isolierte oder 24 h in Abwesenheit bzw. Anwesenheit von Interleukin-8 kultivierte neutrophile Granulozyten wurden gewaschen (PBS/1% BSA) und in 4% Paraformaldehyd für 20 min fixiert. 1x106 Zellen wurden in ein 1,5 ml Eppendorf-Röhrchen transferiert und in 1 ml eiskaltem PBS/1% BSA gewaschen. Danach erfolgten die Resuspension der Zellen in 100 µl Permeabilisierungspuffer (PBS/1% BSA/0,2% Saponin) und die Zugabe von monoklonalem Maus-Antikörper gegen Bcl-2 (4,3 µg/ml, IgG1_) oder derselben Menge eines Kontroll-Antikörpers vom entsprechenden Isotypen. Nach einer Inkubation für 20 min auf Eis wurden die Zellen erneut gewaschen und in 100 µl PBS/1% BSA, dem 10 µl FITC-gekoppeltem Ziege-Anti-Maus-Antikörper zugesetzt waren, erneut für 20 min auf Eis inkubiert. Danach wurden die Zellen in PBS/1% BSA gewaschen und mittels Durchflußzytometrie analysiert. Dazu wurden im Programm LysisII/Acquisition (Becton Dickinson) pro Probe 10.000 Ereignisse acquiriert und gespeichert. Die Auswertung erfolgte mit der Software LysisII/Analysis.

2.7.3 Zweidimensionale Gelelektrophorese und Western Blot-Analyse zur Identifizierung von Substraten der Tyrosin-Phosphorylierung

2,5x106 neutrophile Granulozyten wurden in 12-Loch-Zellkulturplatten in Abwesenheit oder Anwesenheit von 20 ng/ml TNFalpha für 60 min kultiviert. Die Platten wurden zuvor entweder mit PolyHema oder mit Fibronektin, wie bereits beschrieben, beschichtet. Das Assayvolumen betrug 500 µl und enthielt 0,2 mM Natrium Orthovanadat. Die Proben wurden geerntet und einmal in EP-Puffer (25 mM Tris/HCL pH 7,1, 50 mM KCL, 3 mM EDTA, 2,9 mM Benzamidin, 2,1 µM Leupeptin) gewaschen. 5x106 Zellen wurden in 26,6 µl EP-Puffer, der ein Inhibitor-Gemisch (Aprotinin 10 µg/ml, 0,1 mM Quercetin, 5 mM Jodoacetamid, 1mM PMSF, 0,2 mM Sodium orthorvanadate) enthielt, resuspendiert. Die Zellen wurden anschließend in 9 M Urea lysiert, bevor 70 mM 1,4


25

Dithiothreitol (DTT) und 2% (v/v) Trägerampholyte zugegeben wurden. Die Suspension wurde für 5-10 min gut gemischt, zentrifugiert (20 min, 70.000 U/min bei RT), und der Proteingehalt des klaren Überstandes wurde bestimmt. Dieser Überstand wurde bei -70°C gelagert und in der 2D-GE aufgetrennt. In einem ersten Schritt wurden 100 µg Protein für die isoelektrische Fokussierung eingesetzt (IEF). Dazu wurden 6,5 x 8,5 x 0,15 cm große IEF-Gele nach der Methode von Klose et al. (Klose und Kobalz, 1995) verwendet. Die Gele enthielten 3,5 % Acrylamid, 0,3% Piperazin Diacrylamid und 4 % (v/v) Trägerampholyt-Mix. Während der Elektrophorese wurden die Proteine mittels pH-Gradienten (pH 3,5 - 9; durch Trägerampholyte während des Laufes eingestellt) entsprechend ihres isoelektrischen Punktes (IP) getrennt. Nach dem Lauf wurden die Gele mittels Polypropylenfäden ausgestoßen und nachfolgend in Inkubationspuffer (125 mM Tris-Puffer, 40 % (v/v) Gycerol, 65 mM DTT, 3 % (w/v) SDS) auf die Bedingungen der SDS-PAGE eingestellt. Das IEF-Gel wurde auf die SDS-Polyacrylamid-Gele (15 % SDS, 0,2% Bis) transferiert. Die in der ersten Dimension nach IP getrennten Proteine wurden in der zweiten Dimension nach den Molekulargewichten getrennt (205 kDa bis 8,2 kDa). Die Bedingungen für die erste Dimension waren: 75 min 100 V, 75 min 200 V, 75 min 400 V, 75 min 600 V, 10 min 1000 V, 5 min 1000 V und für die zweite Dimension: 5 min 35 V, 10 min 55 V, 15 min 100 V, 60 min 150 V. Das Gel wurde entweder für präperative Zwecke mit Coomassie Blau gefärbt (Eckerskorn et al., 1988) oder auf eine PVDF-Membran geblottet. Der Transfer erfolgte innerhalb von 60 min mit einer Stromstärke von 2,5 mA/cm2. Die Membran wurde über Nacht in 5% Magermilch/TBS-T bei 4o C geblockt, in TBS-T gewaschen (40 min mit 4-maligem Wechsel der Waschlösung) und anschließend mit PY 20, einem monoklonalen Maus-Antikörper gegen Phosphotyrosin (1: 2000 in 1%BSA/TBS-T verdünnt), für 3 h bei RT inkubiert. Die Membran wurde in TBS-T für 40 min gewaschen (4-maliger Wechsel der Waschlösung) und mit dem sekundären Antikörper, einem Peroxidase-gekoppelten Ziegen-Antikörper gegen Maus-Ig (1:1000 in 1% BSA/TBS-T verdünnt), für 1 h bei RT inkubiert. Nach erneutem Waschen erfolgten die Entwicklung mit dem ECL-System und die Exposition auf einem Kodak-Röntgenfilm.

2.7.4 Immunzytochemie zur Lokalisation der Tyrosin-Phosphorylierung

Mit der konfokalen Mikroskopie wurden die Effekte von extrazellulären Matrixsubstanzen auf die Verteilung von phosphorylierten Proteinen innerhalb von TNFalpha-behandelten neutrophilen Granulozyten analysiert. Die nicht-adhärenten Zellen wurden durch Waschen mit PBS entfernt. Die Zellen, die auf Matrix adhäriert hatten, wurden mit 4% Paraformaldehyd fixiert und mit 80% Methanol bei -20o C permeabilisiert. Da TNFalpha-behandelte Zellen nicht auf PolyHema haften, wurden diese Zellen abpipettiert, in Suspension fixiert und permeabilisiert. Nach 60 Minuten Inkubation in 1% BSA in PBS (BSA/PBS) wurden die Proben mit dem Anti-Phosphotyrosin-Antikörper (Klon 1G2, 1:80) inkubiert, gewaschen und anschließend mit einem FITC-konjugierten sekundären Antikörper inkubiert (FITC-konjugierter Anti-Maus-IgG 1:100 in 1% BSA/PBS). Parallel dazu erfogten die Kontrollfärbungen ohne den primären Antikörper. Das Präparat wurde dann mit einem Nikon-Diaphot Mikroskop unter Zuhilfenahme des konfokalen Imaging Systems Biorad MRC 600 analysiert, welches mit einem Argon-Krypton Laser (488/568 nm) ausgestattet war. Subzelluläre Lokalisationsstudien erfolgten mit einer sog. Schlüsselloch-Einstellung, wodurch eine


26

z-Auflösung von 0,5 mm möglich wurde. Z-Projektionen wurden anschließend mit Hilfe der som/thru View Software (BioRad) berechnet. Wenigstens 30 Zellen von jedem der 3 unabhängigen Experimente wurden durch 2 verschiedene Untersucher ausgewertet. Die Quantifizierung der Signal-Intenstäten erfolgte mittels der Histogram/Fläche-Funktion der MRC-Cosmos Software. Die Zellen wurden dazu manuell umrandet und die errechnete mittlere Fluoreszenz-Intensität wurde bestimmt. Die Daten sind als Ratio der mittleren Fluoreszenintensität der untersuchten Flächen zur mittleren Fluoreszenz-Intensität der Gesamtfläche ausgedrückt.

2.8 Analyse der mRNA-Expression durch RT-PCR

2.8.1 Extraktion der RNA

Die RNA wurde mit RNA-STAT bzw. Trizol entsprechend der vom Hersteller empfohlenen Anleitung aufgereinigt. Dazu wurden 5x106 neutrophile Granulozyten oder Kontrollzellen in PBS gewaschen, in 1 ml der Lysierlösung resuspendiert und für 5 min bei RT inkubiert. Die Mischung aus Zellen und RNA-STAT wurde anschließend mit 200 µl Chloroform extrahiert. Die RNA-Präzipitation erfogte in 500 µl Isopropanol. Die so gewonnene RNA wurde in 1 mM EDTA, pH 8,0, aufgenommen und die Konzentration wurde über die Extinktionsmessung bestimmt.

2.8.2 Bestimmung der Konzentration und der Reinheit der RNA

Konzentration und Reinheit der RNA wurden durch die photometrische Messung der optischen Dichte (OD) bei einer Wellenlänge von 260nm und 280 nm bestimmt. Da ein OD bei 260 nm einer Konzentration von 40 µg/ml RNA entspricht, konnte die Konzentration der präparierten RNA mit Hilfe dieses Verhältnisses berechnet werden. Desweiteren bestimmten wir das Absorptions-Verhältnis OD260/OD280, welches idealerweise 1,8 betragen sollte. Abweichungen zeigen Verunreinigung durch Proteine oder Phenole an.

2.8.3 Durchführung der RT-PCR

Gen-spezifische RNA wurde mittels RT-PCR, basierend auf dem Protokoll des RNA-PCR-Kits von Clontech, analysiert. 1 µg Gesamt-RNA wurde durch die reverse Transkriptase in c-DNA umgeschrieben und anschließend mit Hilfe genspezifischer Primer amplifiziert. Dazu wurden 5 µl c-DNA in einem Reaktionsvolumen von 50 µl eingesetzt und unter folgenden Bedingungen mit 30 Zyklen in einem GeneAmp PCR System 9600 durch die PCR amplifiziert: 95oC für 45 sec, 58oC für 1 min und 72oC für 2 min. Glyceraldehyde-3-Phosphat-Dehydrogenase (G3PDH)-Primer wurden als interne Kontrolle verwendet. Die Primer für die PCR wurden in einem Primer-Auswahlprogramm selektioniert (MacVector, Kodak). Eine Kontrollreaktion ohne Zusatz von reverser Transkriptase wurde für jede RNA-Präparation durchgeführt, um mögliche Kontaminationen mit genomischer DNA zu erfassen.

Wir verwendeten folgende Primer-Paare: Vorwärtsprimer für die Mn-Superoxiddismutase (Mn-SOD) CGCCCTGGAACCTCACATCAAC und für Bcl-2 GCCTTCTTTGAGTTCGGTGGG; Rückwärtsprimer für die Mn-SOD CCCACACATCAATCCCCAGCAG und für Bcl-2 GAGCAGAGTCTTCAGAGACAGCCAG. Die Primer wurden unter Benutzung eines Synthetisierers (Applied Biosystems Model 394 DNA synthesizer) hergestellt.


27

2.8.4 Gelelektrophorese

10 µl PCR-Produkt/Bahn wurden auf ein 1,5 % Agarose-Gel, welches 0,5 µg/ml Ethidium Bromid enthielt, aufgetragen. Die elektrophoretische Auftrennung erfolgte in TBE Puffer bei 80 V für 1 Stunde. Die Gele wurden unter UV-Licht mit einer Computerkamera fotografiert und auf Diskette gespeichert. In den Experimenten zur Expression der Mn-SOD mRNA erfolgte die Bestimmung der Ratio von G3PDH/Mn-SOD zu jedem der angegebenen Untersuchungszeitpunkte. Hierzu wurde das NIH-Image Programm verwendet. Der 0 Stunden-Wert wurde dabei als 100% gesetzt.

2.9 Charakterisierung von differentiell exprimierten Proteinen bei der Apoptose neutrophiler Granulozyten

2.9.1 Separation nicht-apoptotischer und apoptotischer Zellen durch Sortierung mit Antikörper-beladenen magnetischen Teilchen

Herstellung einer hochreinen Präparation von neutrophilen Granulozyten

Neutrophile Granulozyten wurden von gesunden Spendern, wie weiter oben ausführlich beschrieben, durch Dichtegradienten-Zentrifugation isoliert. Mit dieser Methode erhält man eine Präparation mit einem Anteil von etwa 95% neutrophilen Granulozyten und etwa 5% kontaminierenden eosinophilen Granulozyten. Für unsere Untersuchungen war es wichtig, diese kontaminierenden Zellen zu eliminieren, um eine möglichst reine Population neutrophiler Granulozyten analysieren zu können. Zur Entfernung der eosinophilen Granulozyten benutzten wir einen Antikörper, der das Oberflächenmolekül CD9 erkennt, welches nur auf eosinophilen, nicht aber auf neutrophilen Granulozyten vorkommt. Dazu wurden 1x107 mit Histopaque und hypotoner Erythrozytenlyse isolierte Zellen mit 10 µg des anti-CD9 Antikörpers in 1 ml RPMI 1640/1% FCS für 25 min auf Eis inkubiert. Nach einmaligem Waschen in RPMI 1640 wurden die Zellen in 1 ml RPMI 1640/1% FCS resuspendiert, welches 7,5x106 magnetische Teilchen (Dynabeads M-450 RAM) enthielt. Die beads sind über einen DNA-Linker an einen Ratten-Antikörper mit Spezifität gegen Maus-IgG1 gekoppelt, der nun mit dem murinen monoklonalen Antikörper gegen CD9 reagiert. Unter der Annahme einer etwa 5%igen Kontamination mit Eosinophilen wählten wir eine beads-zu-Zielzell Ratio von 10:1. Die beads wurden 2x in PBS/0,1% BSA gewaschen und für 15 min bei 4oC mit den Zellen, die zuvor mit dem anti-CD9-Antikörper behandelt waren, auf einem Rotator inkubiert. Mit Hilfe eines Magneten (magnetic particle concentrators, MPC) wurden die CD9-positiven eosinophilen Granulozyten anschließend entfernt. Die verbliebenen neutrophilen Granulozyten wurden 3x gewaschen und eventuell verbliebene Teilchen durch die erneute Anwendung des MPC restlos entfernt. Die Reinheit der negativ selektionierten neutrophilen Granulozyten und der positiv selektionierten eosinophilen Granulozyten wurde mittels Wright-Giemsa Färbung und lichtmikroskopischer Untersuchung bestätigt. Die so gewonnene hoch gereinigte Präparation von neutrophilen Granulozyten stand für weitere Untersuchungen zur Verfügung.

Separation nicht-apoptotischer und apoptotischer Zellen

Im Anschluß an das CD9-Sorting wurden die hoch gereinigten neutrophilen Granulozyten für 24 h in RPMI 1640 mit 10% FCS inkubiert. Der Prozentsatz apoptotischer Zellen in der


28

Gesamtpopulation betrug nach 24 h zwischen 30 und 50%. Für die Charakterisierung von Proteinen, die für das Überleben bzw. für die Apoptose bedeutsam sind, war es wichtig, eine Separation der apoptotischen und der nicht-apoptotischen Population zu erreichen. Verwendet wurde dazu erneut die Technik der Zellseparation mit magnetischen Teilchen. Die Grundlage bildete hierbei die Veränderung der Membranexpression des FcgammaIII-Rezeptors (CD16) während der spontanen Apoptose. Bei dem FcgammaIII-Rezeptor handelt es sich um einen extrazellulären Rezeptor, der über Glycosyl-Phosphatidylinositol (GPI) an die äußere Zellmembran von neutrophilen Granulozyten gekoppelt ist. Während nicht-apoptotische neutrophile Granulozyten eine hohe Expression dieses Rezeptors aufweisen, wird das CD16-Molekül während der spontanen Apoptose durch proteolytische Spaltung von der Oberfläche der Zellen depletiert. Die Analyse der CD16-Expression erlaubt somit eine zuverlässige Diskriminierung beider Populationen (Dransfield, 1994; Homburg, 1995). Wir verwendeten das CELLection-Kit von Dynal, um apoptotische und nicht-apoptotische Zellen zu separieren und folgten dabei dem empfohlenen Protokoll des Herstellers. Ein monoklonaler Antikörper gegen den FcgammaIII-Rezeptor (anti-CD16) wurde an die magnetischen Teilchen, die über einen DNA-Linker mit einem Ratten anti-Maus Antikörper beladen waren, gekoppelt. Dazu wurden 1,3x109 beads in 1 ml PBS/0,1% BSA resuspendiert und mit 4 µg anti-CD16 pro 1x107 beads konjugiert. Durch die Inkubation dieses magnetischen Konstruktes mit den Zellen und der anschließenden Anwendung des magnetischen Teilchen-Konzentrators (MPC) konnten die CD16-negativen apoptotischen Zellen von den CD16-positiven nicht-apoptotischen Zellen getrennt werden. Beide Subpopulationen wurden anschließend mittels Wright-Giemsa-Färbung und Lichtmikroskopie sowie mittels Annexin V-Färbung und Durchflußzytometrie charakterisiert.

2.9.2 Zweidimensionale hochauflösende Gelelektrophorese

Die Proteingemische aus Lysaten hoch aufgereinigter frisch isolierter neutrophiler Granulozyten sowie für 24 h kultivierter nicht-apoptotischer und apoptotischer Zellen wurden in der zweidimensionalen hochauflösenden Gelelektrophorese (2D-GE) analysiert. Nicht-apoptotische und apoptotische Zellpopulationen wurden zuvor durch magnetisches Zell-Sorting, wie weiter oben beschrieben, separiert. Anhand der Proteinmuster im Gel wurde die Expression von Proteinen in apoptotischen und nicht-apoptotischen Zellen mit denen der frisch isolierten neutrophilen Granulozyten verglichen. Aus präparativen Gelen wurden dann interessierende Proteine mit differentieller Expression durch Sequenzanalyse identifiziert.

In der ersten Dimension wurden die Proteine mittels isoelektrischer Fokussierung nach ihrem jeweiligen isoelektrischen Punkt (IP) und in der zweiten Dimension, der Natriumlaurylsulfat-Polyacrylamid-Gelelektrophorese (SDS-Page), nach ihrem Molekulargewicht getrennt. Zur Probenaufbereitung wurden die isolierten neutrophilen Granulozyten in einem Proteaseinhibitor-Mix (Aprotinin 10 µg/ml, 0,1 mM Quercetin, 5 mM Jodoacetamid, 1 mM PMSF) in Suspension gebracht, mit 9 M Harnstoff (Biorad), 2 % (v/v) Trägerampholyten (40 %ig, pH 2-4) und mit 70 mM 1,4-Dithiothreitol versetzt. Die extrahierten Proteine wurden mittels Ultrazentrifugation bei 70.000 U/min für 20 min bei 20°C von den Zellfragmenten getrennt. Danach wurde die isoelektrische


29

Fokussierung durchgeführt (IEF). Dazu wurden die IEF-Gele (3,5 % Acrylamid, 9 M Harnstoff, 4 % (v/v) Trägerampholyt-Mix) in 23,5 cm langen zylindrischen Glasröhrchen (0,9 mm für analytische Gele und 1,5 mm für präparative Gele) gegossen. Während der Elektrophorese wurden die Proteine mittels pH-Gradienten (pH 3,5 - 9, durch Trägerampholyte während des Laufes eingestellt) entsprechend ihres isoelektrischen Punktes getrennt. Nach dem Lauf wurden die Gele mittels Polypropylenfäden ausgestoßen und in Inkubationspuffer (125 mM Tris-Puffer, 40 % (v/v) Gycerol, 65 mM DTT, 3 % (w/v) SDS) auf die Bedingungen der nachfolgenden SDS-PAGE eingestellt. Das IEF-Gel wurde auf die SDS-Polyacrylamid-Gele (15 %) transferiert. Die in der ersten Dimension nach IP getrennten Proteine wurden in der zweiten Dimension nach den Molekulargewichten (205 kDa bis 8,2 kDa) aufgetrennt. Analytische Gele wurden mittels Silberfärbung und präparative Gele mittels Coomassie Brilliant-Blue-Färbung entwickelt.

2.9.3 Enzymatischer in-gel-Verdau, Extraktion und Entsalzung der Proteine

Für die Identifizierung der interessierenden Proteine wurden die entsprechenden Proteinspots von bis zu 5 Coomassie-gefärbten Gelen mit einem Skalpel ausgeschnitten und für die enzymatische Aufspaltung kombiniert. Der enzymatische in-gel -Verdau wurde mit Trypsin durchgeführt. Die Extraktion der Peptide aus dem Gel mit nachfolgender Entsalzung erfolgte nach der Methode von Otto et al. (Otto, 1996). Dazu wurde die enzymatische Aufspaltung durch den Zusatz von 100 mM Tris HCl-Puffer, 1 mM CaCl2 plus 1/4 µg Trypsin pro ausgeschnittenem Spot in Gang gesetzt. Der Verdau erfolgte für 15 h bei 36 °C. Die Peptid-Lösungen wurden anschließend konzentriert.

2.9.4 Reverse HPLC und Sequenzierung durch Edman-Degradation

Die Peptid-Gemische wurden mit Hilfe eines HPLC-Systems und einer C2/C18-Säule separiert. Die Separation erfolgte an einer Säule mit einem 2,1 mm Innendurchmesser und einer Länge von 10 cm. Ein linear ansteigender Gradient von Acrylnitril in 0,1% (v/v) TFA wurde bei einer Flußrate von 100 µl/min bei RT eingesetzt. Die Peptid-Fraktionen wurden anschließend in einem Speed-Vac Gerät konzentriert und auf Biobren-beschichtete Filter aufgebracht. Diese Filter wurden in einem Sequencer mit einem PTH-Aminosäure-Analyse-Gerät (Perkin Elmer/Applied Biosystems) analysiert.

2.9.5 Peptid-Sequenzierung durch MALDI-MS (Matrix assisted laser desorption/ionization)

Der konzentrierte Proteinextrakt, der durch den in-gel-Trypsin-Verdau gewonnen wurde, wurde in 5 µl einer Acetonitrile-Wasser-Lösung (1:1), die 5% (v/v) Ameisensäure enthält, aufgenommen. MALDI-MS wurde mit einem VG TOF SPEC (Fisons, Manchester, UK, Bruker, Bruker Reflex, Bruker Franzen, Bremen), das mit einem Stickstoff-Laser ausgestattet war, durchgeführt. Die Massenspektren wurden als Summation von 20 - 50 Laser-Applikationen aufgenommen. Als Matrix wurde eine gesättigte Lösung von alpha-Cyano-4-hydroxycinnamic acid in 50% Acetonitrile-Wasser-Lösung und 0,1 % TFA (v/v) verwendet. Die Messungen erfolgten in einem 24 kV Vakuum.


30

2.9.6 Peptid-Sequenzierung durch Nanoelektrospray-Massen-Spektrometrie

Diese Peptid-Lösung wurde mittels Nanoelectrospray-Massen-Spektrometrie in einem Q-Tof (Micromass, Manchester, UK) analysiert, der mit einer Z-Spray-Ionenquelle ausgestattet war. Ein µl der zu analysierenden Lösung wurde dazu in die Nanospray-Borsilikat-Glaskapillare (Micromass, Manchester, UK) pipettiert, in das Massen-Spectrometer mit einer Flußrate von 20-40 nl min-1 infundiert und mittels eines sog. time of flight (TOF) Analyzers bestimmt. Die Tandem-Massen-Spektrometrie (MS/MS) wurde verwendet, um die Spektren von 5-6 ausgewählten Peptiden zu bestimmen.

2.9.7 Datenbankvergleiche

Die Proteine wurden durch das sog. Peptide-Mass-Fingerprinting (PMF) identifiziert. Die durch MALDI-MS erhaltenen Massen-Karten wurden mit Hilfe des Programms MS-FIT von Clauser und Baker (UCSF Massen Spektrometrie Einrichtung, San Francisco, CA, USA) bearbeitet und mit den theoretischen Peptid-Massen von bekannten Proteinen aus der SWISSPROT Datenbank verglichen. Die mit der Tandem-Massen-Spektrometrie bestimmten Aminosäure-Sequenzen wurden mit den bekannten Aminosäure-Sequenzen der identifizierten Proteine verglichen, um die Richtigkeit der Ergebnisse zu bestätigen.

2.10 Auswertungen

Die statistischen Analysen wurden auf einem Macintosh Computer (Apple Inc., Cupertino, CA, USA) durchgeführt. Der Computer war mit kommerziell verfügbaren Programmen ausgestattet (Statview, Cricket Software Inc., Philadelphia, PA, USA). Der nicht-parametrische Wilcoxon Rank-Test wurde verwendet, um zu testen, ob Verteilungsunterschiede zwischen Gruppen bestehen und ob diese ungleich 0 waren. In einigen Untersuchungen wurde zum Vergleich zwischen gepaarten Datengruppen der gepaarte Studentische-T-Test eingesetzt. Für multiple Vergleiche wurde die ANOVA Berechnung verwendet. Da einige Daten wiederholte Messungen und multiple Testungen beinhalteten, wurde ein allgemeines lineares Modell mit 2 verschiedenen Kulturoberflächen (Fibronektin und PolyHema) und 2 verschiedenen Inhibitoren (DEVD and YVAD) mit ansteigenden Konzentrationen (1, 10, 25, and 100 µM) zur Berechnung verwendet. Dabei wurden sowohl die Signifikanz der experimentellen Veränderungen als auch ihre Interaktionen getestet. Im Falle signifikanter Interaktionen wurden Submodelle mit dem post-hoc Scheffe-Test analysiert. Hierdurch wurde multiples Testen erlaubt. Für diese Berechnungen wurde das Statistik-Programm SPSS (SPSS Inc., Chicago, Ill.) verwendet. Die Daten sind als Mittelwerte±SEM ausgedrückt. Unterschiede wurden als statistisch signifikant angesehen, wenn der p-Wert kleiner als 0,05 war.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiML DTD Version 2.0
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Thu Apr 19 14:16:02 2001