| Reles, Angela : MOLECULAR GENETIC ALTERATIONS IN OVARIAN CANCER The Role of the p53 Tumor Suppressor Gene and the mdm2 Oncogene |
35
During exploratory laparotomy both ovaries were examined for tumor involvement and salpingo-oophorectomy was performed in a typical manner. The ovary which was suspected of being tumorous or, if both were involved, the ovary which had the greater tumor mass was sent to the Pathology Department for frozen section diagnosis, where a tissue block of at least 1 cm³ was excised and immediately snap frozen in liquid nitrogen. The tissue was stored in plastic containers (Althor Products, Bethel, Connecticut, USA) at -80° C. Ninety-eight cases were collected at the Department of Gynecology of the Charité, Campus Virchow-Klinikum, Humboldt-University in Berlin. Eighty cases were available from the USC frozen tissue resource of the Principal Investigator Michael F. Press MD, PhD and had mainly been collected at the M.D. Anderson Cancer Center in Houston, Texas, USA.
The study population consisted of a total of 178 patients with invasive epithelial ovarian carcinoma who had undergone surgery between 1972 and 1995 at the Department of Gynecology of the Charité, Campus Virchow-Klinikum, Humboldt-University in Berlin (n=98) or at the M.D. Anderson Cancer Center in Houston, Texas, USA (n=80). The clinical and histopathological characteristics of the patients are demonstrated in Table 12. Patient age ranged from 23 to 84 years with a median age of 57 years. The racial-ethnic groups represented were: White 92%, African-American 5%, Hispanic 3% and Asian 1%.
Each patient underwent exploratory laparotomy with bilateral salpingo-oophorectomy, hysterectomy, and infracolic omentectomy as part of her treatment for ovarian cancer. In 61 of the patients pelvic lymphadenectomy and in 29 patients additional paraaortic lymphadenectomy was performed as part of the primary surgery.
All patients were staged according to the 1986 guidelines of the International Federation of Gynecologists and Obstetricians (FIGO) (Pettersson 1991). For purposes of statistical analysis, patients who had undergone surgery before 1986 were restaged according to the 1986 guidelines. At the time of diagnosis, 21% of the patients were diagnosed as FIGO stage I, 5% as stage II, 61% as stage III and 13% as stage IV (Table 12). Complete surgical resection of the tumor was possible in 71 cases (46%) and optimal debulking with a residual tumor mass of less than 2 cm was achieved in 48 cases (31%), but a residual tumor mass of more than 2 cm was left in situ in 34 cases (22%).
36
All tumors were classified and graded according to the criteria defined by the World Health Organization. The 178 epithelial ovarian carcinomas studied for p53 alterations included 111 (62%) serous, 30 (17%) endometrioid, 8 (5%) mucinous, 6 (3%) clear cell, 1 (0.6%) malignant Brenner tumor, 10 (6%) undifferentiated, 10 (6%) mixed epithelial and 2 (1%) unclassified epithelial tumor.The tumors were graded as well differentiated in 28 (16%) cases, moderately differentiated in 52 (29%) and poorly differentiated in 98 (55%) cases. The evaluation of differentiation was based on the degree of histologic differentiation with the formation of papillary, tubular, glandular or cystic structures versus solid structures.
One hundred and three cases included in this study had been previously characterized for DNA ploidy and S-phase fraction with a Cell Analysis System Image Analyzer (CAS 200, Becton-Dickinson). Fifty-four percent of the ovarian carcinomas were found to be diploid, 38% aneuploid and 8% tetraploid. The S-phase-fraction was low (< 5%) in 27%, intermediate (5% - 14.5%) in 47% and high (
14.5) in 26% of the patients (Reles et al. 1998).
Adjuvant chemotherapy was given to 115 (76%) of the patients with tumor stages Ib-IV. Among these, 54 (47%) of the patients were treated with Cisplatinum / Cyclophosphamide, 20 patients (17%) with Carboplatinum / Cyclophosphamide and 41 (36%) of the patients with other chemotherapy-regimens. 36 patients (24%) were not treated with adjuvant chemotherapy because of early stage disease, old age, or because they refused treatment. In 27 patients, information about chemotherapy treatment was insufficient (Table 12).
The response to chemotherapy was defined 1) as platinum refractory, if there was no change or progressive disease during therapy, 2) as platinum resistant, if the patient responded initially but relapsed or progressed within 6 months after the last cycle of chemotherapy and 3) as platinum sensitive, if no relapse or progression was noted within six months after the last cycle of chemotherapy.
Clinical follow-up and overall survival information was available for all 178 patients and information about progression of the disease was available for 138 (78%) patients. The majority of patients were seen at the outpatient clinics of the Charité, Campus Virchow-Klinikum, Berlin and the MD Anderson Cancer Center, Houston, respectively for follow-up. Additional information was available from physicians in private practice. Follow-up ranged from 1 month to 12 years with a median follow-up of 31 months in the total cohort and 52 months for the survivors.
During the time of follow-up 117 (66%) deaths occured. 104 patients died from ovarian cancer, 6 patients by intercurrent disease or accident, and one patient died from a complication of surgery. Sixty (34%) patients were alive and in 7 cases, no information about the cause of death was available. At the time of last contact, 48 patients (27%) showed no evidence of disease. 76 patients (43%) had been documented to have recurrent disease, three patients had
37
known residual disease with steady state, 11 patients (6%) had primarily progressive disease and in 29 (16%) patients, who died from the tumor, the date of relapse was not available from the patient charts. In 11 patients, the disease status was not sufficiently documented.
If not otherwise specified, sterile disposable plastic ware for molecular biology experiments was purchased from CLP (Continental Lab Products) and Falcon Labware (Oxnard, CA, USA). PCR tubes were purchased from CLP (Continental Lab Products). Chemicals were obtained from Sigma (St. Louis, MO, USA) and Amersham Life Science(Arlington Heights, Il, USA). Restriction enzymes were ordered from Gibco BRL (Gaitherburg, MD, USA) or NEB (Beverly, CA, USA). Length standards for DNA and RNA were purchased from Gibco BRL (Gaitherburg, MD, USA). Molecular biology products were obtained from Pharmacia (Uppsala, Sweden), Stratagene (La Jolla, CA, USA) or NEB (Beverly, CA, USA). Tissue culture plastic ware was purchased from Falcon Labware (Oxnard, CA, USA) and additives for tissue culture and media from Gibco BRL (Gaitherburg, MD, USA) or Difco (Detroit, MI, USA).
|
TE |
10 mM Tris/Cl, pH 7.4 |
|
|
1 mM EDTA |
|
|
|
|
TAE |
40 mM Tris / acetate, pH 8,0 |
|
|
1mM EDTA |
|
|
|
|
TBE |
89 mM Tris |
|
|
89 mM boric acid |
|
|
2 mM EDTA |
|
|
pH 8.3 |
|
|
|
|
PBS |
137 mM NaCl |
|
|
2.7 mM KCl |
|
|
8 mM Na2HPO4 |
|
|
1.5 mM KH2PO4 |
|
|
pH 7.2 |
|
|
|
|
|
|
|
|
|
38
|
GTB 20x 250 ml ready mix |
Tris base |
54g |
|
|
Taurine |
18 g |
|
|
Na2-EDTA |
1g |
|
|
|
|
|
MOPS |
200 mM MOPS |
|
|
|
50 mM Na Acetate 3.H2O |
|
|
|
10 mM Na2-EDTA |
|
|
|
|
|
|
SSC |
150 mM NaCl |
|
|
|
15 mM Na-citrate |
|
|
|
|
|
|
DEPC-H2O |
0.1% v/v DEPC in H2O |
|
|
(Diethyl-pyrocarbonat) |
|
|
|
|
|
|
|
Stop Solution for SSCP |
95% v/v Formamide |
|
|
|
20 mM EDTA |
|
|
|
0.25% w/v Bromophenol Blue |
|
|
|
0.25% w/v Xylene Cyanol |
|
|
|
|
|
|
Dye for RNA/DNA |
1 mM EDTA, pH 8.0 |
|
|
gel electrophoresis |
50% v/v Glycerol |
|
|
|
0.25% w/v Bromophenol blue |
|
|
|
0.25% w/v Xylene cyanole |
|
|
|
|
|
|
Loading buffer RNA gels (1ml) |
10x MOPS |
100 µl |
|
|
Formamide |
500 µl |
|
|
Formaldehyde |
174 µl |
|
|
10 x dye |
100 µl |
|
|
EtBr (10mg/ml) |
10 µl |
|
|
|
|
|
0.1 M sodium acetate buffer pH 4.0 |
0.2 M acetic acid |
82 ml |
|
|
0.2 M sodium acetate |
18 ml |
|
|
deionized H2O |
100 ml |
|
|
|
200 ml |
|
Ethyl Green solution |
Ethyl Green |
0.5g |
|
|
0.1 M sodium acetate buffer |
100 ml |
39-42
|
1.2% Agarose Gel (100 ml) |
0.5x TBE |
100 ml |
|
|
Agarose |
1.2g |
|
|
EtBr (10mg/ml) |
2 µl |
|
|
|
|
|
0.5 x MDE Gel for SSCP (100 ml) |
MDE Gel Solution |
25 ml |
|
|
10 x TBE |
6 ml |
|
|
Glycerol 10% |
5 ml |
|
|
deionized H2O |
64 ml |
|
|
TEMED |
40 µl |
|
|
10 % APS |
400 µl |
|
|
|
|
|
6% Acrylamide Gel for Sequencing |
SequagelTM Concentrate |
24 ml |
|
(100 ml) |
SequagelTM Diluent |
66 ml |
|
|
10 x GTB buffer |
10 ml |
|
|
TEMED |
40 µl |
|
|
10% APS |
800 µl |
|
|
|
|
|
1% Agarose gel for Northern |
Agarose |
5g |
|
(500 ml) |
DEPC H2O |
365 ml |
|
|
10 x MOPS |
50 ml |
|
|
Formaldehyde |
85 ml |
Table 4: List of all chemicals used in the experiments
|
Chemical |
Company |
Catalog # |
|
Acetic Acid |
Sigma |
A 5640 |
|
Acetone |
Sigma |
A 4206 |
|
Acrylamide |
Sigma |
A 8887 |
|
Ammonium Persulfate |
Sigma |
A-3678 |
|
Ampicillin |
Sigma |
A 9393 |
|
Aprotinin |
Sigma |
A 1153 |
|
Bisacrylamide |
Sigma |
M 7256 |
|
Bromophenol Blue |
Sigma |
B 0126 |
|
Chloroform |
Sigma |
C 5312 |
|
DAB |
Abbott (ER Kit) |
2A08-18 |
|
|
|
|
|
Deoxycholate |
Sigma |
D 5670 |
|
dNTP (Ultrapure dNTP Set) |
Pharmacia Biotech |
27-2035-01 |
|
dNTP mix 10mM |
Gibco |
18427 |
|
DNA ladder 1Kb |
Gibco |
15615-016 |
|
DTT (Dithiotreitol) |
Gibco |
15508-013 |
|
ECL Western blotting detection reagent |
Amersham |
RPN 2109 |
|
E. coli pulser cuvettes 0.1 cm |
BIO-RAD |
165-2089 |
|
EDTA |
Sigma |
E 7889 |
|
Epicurian Coli® XL1-Blue Electroporation-Competent Cells |
Stratagene Cloning Systems |
200228 |
|
Ethidiumbromide |
Biorad |
161-0433 |
|
Ethyl Green |
Sigma |
M 8884 |
|
Exonuclease I |
Amersham Life Sciences |
US 72050 |
|
Fetal calf serum |
Omega |
FB 01 |
|
Gene Clean Kit |
Bio 101 |
1001-600 |
|
L-Glutamine (cell culture) |
Gibco |
21051-016 |
|
Glycerol |
Amersham Life Sciences |
US 16374 |
|
Glycine |
Sigma |
G 7403 |
|
GTB Glycerol Tolerant Buffer |
Amersham Life Sciences |
US 71949 |
|
Hepes |
Gibco |
11344-033 |
|
Hybridization membrane Hybond ECL |
Amersham Life Sciences |
RPN 68D |
|
Hybridization membrane Hybond XL |
Amersham Life Sciences |
RPN 82S |
|
Isopropanol |
Sigma |
405-7 |
|
Kanamycin |
Sigma |
K 4000 |
|
Kcl (Potassium Chloride) |
Sigma |
P 9333 |
|
Kodak X-OMAT AR |
Eastman Kodak Company |
1651454 |
|
Kodak Biomax MS film |
Eastman Kodak Company |
1435726 |
|
Kodak Biomax MR film |
Eastman Kodak Company |
8715187 |
|
Kodak Biomax MR2 film |
Eastman Kodak Company |
IB8952855 |
|
LB Agar tablets |
Sigma |
L 7025 |
|
LB Broth |
Sigma |
L 3022 |
|
Leupeptin |
Sigma |
L 2023 |
|
LipofectamineTM Reagent |
Gibco BRL |
18324-020 |
|
MDETM Mutation Detection Gel Solution |
AT Biochem |
1-500-00 |
|
MegaprimeTM DNA labelling system |
Amersham Life Science |
RPN1604/5/6/7 |
|
Methanol |
Sigma |
M 1775 |
|
MicroSpin Columns S-400 HR |
Pharmacia |
27-5140-01 |
|
Mineral oil (PCR) |
Sigma |
M 8662 |
|
M-MLV Reverse Transcriptase |
Gibco BRL |
28025-013 |
|
NaCl (Sodium Chloride) |
Sigma |
S 7653 |
|
|
|
|
|
NaF (Sodium Fluoride) |
Sigma |
S 7920 |
|
Nonidet P40 (Octylphenoxy Polyethoxy Ethanol) (Igepal CA 630) |
Sigma |
I 3021 |
|
oligo (dT)15 primer |
Promega |
C 1101 |
|
pcDNA3.1 Expression vector |
Invitrogen |
V 790-20 |
|
Penicillin/Streptomycin |
Gibco |
043-05140 |
|
Pepstatin A |
Sigma |
P 5318 |
|
Permount |
Fisher |
SP15-500 |
|
Phenol/chloroform/isoamyl alcohol (25:24:1) |
Boehringer Mannheim |
101 001 |
|
Plasmid Maxi Protocol kit |
Qiagen |
12162 |
|
PMSF (PhenylmethylsulfonylFluoride) |
Sigma |
P 7626 |
|
Protein G sepharose beads |
Pharmacia |
17-0618-01 |
|
Proteinase K |
Sigma |
P 6556 |
|
Pwo DNA Polymerase |
Boehringer Mannheim |
1644947 |
|
Qiagen Plasmid Midi Protocol Kit |
Qiagen |
12143 |
|
Qiagen Plasmid Purification Kit (Mini-Prep) |
Qiagen |
12123 |
|
Qiaquick Gel Extraction Kit |
Qiagen |
28704 |
|
Qiaquick PCR Purification Kit |
Qiagen |
28104 |
|
Quick SpinTM Columns |
Boehringer Mannheim |
1273 922 |
|
Rapid-hyb buffer |
Amersham Life Science |
RPN 1635 |
|
Restriction enzyme |
|
|
|
AscI |
NEB |
558S |
|
Bam HI |
NEB |
136S |
|
BglI |
NEB |
143S |
|
Eco RI |
Gibco |
15202-013 |
|
HindIII |
NEB |
104S |
|
MluI |
NEB |
198L |
|
NcoI |
Gibco |
15421-019 |
|
Sal I |
Gibco |
15217-011 |
|
RNAguard® |
Pharmacia |
27-0816-01 |
|
RNA ladder 0.24-9.5 Kb |
Gibco |
15620-016 |
|
RPMI medium 1640 |
Gibco |
21870-092 |
|
Salmon sperm DNA |
Gibco |
15632-011 |
|
SDS (Sodium Dodecyl Sulfate) |
Pharmacia |
US75832 |
|
SDS-PAGE Standards, broad range, prestained |
BIO-RAD |
161-0318 |
|
Sequagel TM Sequencing System, Concentrate |
National Diagnostics |
EC 830 |
|
Sequagel TM Sequencing System, Diluent |
National Diagnostics |
EC 840 |
|
Shrimp Alkaline Phosphatase |
Amersham Life Sciences |
US 70173 |
|
Sodiumacetate (NaOAc) |
Sigma |
S 7670 |
|
SEA Spray |
CLP |
5455 |
|
|
|
|
|
TA Cloning® kit (INV |
Invitrogen |
K2000-01 |
|
Taq DNA Polymerase 500 units |
Promega |
M 1865 |
|
TEMED (N,N,N,N‘-Tetramethyl-Ethylendiamine) |
Sigma |
T 8133 |
|
T4 DNA Ligase 500 units |
Boehringer Mannheim |
481220 |
|
Tris base |
Sigma |
T 6791 |
|
Trizol Reagent |
Gibco |
15596-026 |
|
Tween-20 |
Sigma |
P 7949 |
|
Whatman 3 MM Chromatography paper |
Fisher |
057163W |
|
X-Gal |
Gibco |
15520-034 |
|
Xylene cyanole |
Fisher |
X3P-IGAL |
|
[ |
Amersham |
# AA 0005 |
|
[ |
Dupont |
# NEG/613 H |
|
[ |
Dupont |
# NEG/612 H |
|
[ |
Amersham |
Kit # 188403 |
|
[ |
Amersham |
Kit # 188403 |
|
[ |
Amersham |
Kit # 188403 |
|
[ |
Amersham |
Kit # 188403 |
The Qiaquick PCR Purification Kit (Qiagen, Hilden, Germany) was used for purification of PCR products for cloning and the Qiaquick Gel Extraction Kit (Qiagen, Hilden, Germany) and the Geneclean kit (BIO 101) were used for extraction of DNA from agarose gels. DNA sequencing was performed with the Thermo Sequenase radiolabeled terminator cycle sequencing kit (Amersham Life Science). Purification of plasmid DNA was performed with the Qiagen Plasmid Purification Kit (Qiagen, Hilden, Germany) for mini- and midi-preps. The TA cloning kit (Invitrogen, INV
F‘One Shot Kit) was used for cloning cDNA into a TA vector. For detection of proteins in Western blotting we used the ECL Kit (Amersham).
Monoclonal Antibodies
|
Clone |
origin |
Company |
Catalog # |
|
DO7 |
mouse anti-human p53 protein |
DAKO Inc. |
M7001 |
|
3F10 |
rat anti human influenza virus HA |
Boehringer Mannheim |
1867423 |
|
9E10 |
mouse IgG1 anti human c-myc |
Boehringer Mannheim |
1667149 |
|
12CA5 |
mouse IgG1 anti HA |
Boehringer Mannheim |
15833816 |
43
Polyclonal Antibodies|
normal mouse IgG |
Zymed Laboratories |
08-6599 |
|
rabbit anti-mouse IgG |
Zymed Laboratories |
61-6500 |
|
mouse peroxidase anti-peroxidase antibody |
Sternberger Meyer |
405 |
|
goat anti-mouse IgG-HRPO |
BIO-RAD |
172-1011 |
|
rabbit anti-rat IgG-HRPO |
DAKO |
P0162 |
For DNA and RNA extraction a tissue homogenizer (VWR) was used and centrifugation steps were carried out in an Eppendorf 5415 table centrifuge. The optical density of DNA and RNA were measured with a Beckman DU-600 spectrophotometer. PCR reactions were performed in either a Perkin Elmer Cetus DNA Thermal Cycler 480 or an MJ Research PC 100/96V Thermal Cycler.
For SSCP and sequencing, gel electrophoresis was carried out in a 38x50 cm Sequi-Gen GT Sequencing Cell (Biorad), using a Power Pac 3000 Power Supply (Biorad). For sequencing a Vinyl Sharkstooth Comb of 0.4 mm thickness and 30 cm length with 97 wells was used to separate lanes. Gels were dried in a Savant gel drier (GDS 100 - SGD 2000 - GP 110).
Tissue sections for immunohistochemistry were cut with a Tissue Tek II Cryostat, mounted on Fisher slides and encircled with a PAP pen (Kiyota International Inc.). Staining results were evaluated with an Olympus BH2 microscope.
For Southern and Northern hybridization radioactivity of the probe was measured in a Scintillation Counter Tri-Carb 2100TR (Packard Instruments) and hybridization was carried out in a Micro Hybridization Incubator Model 2000 (Robbins Scientific).
For DNA cloning into the pcDNA3 expression vector a Biorad E. coli pulser apparatus 120 V was used for transformation of bacteria. Western blotting of expressed proteins was carried out with a Transblot Electrophoretic Transfer Cell (BIO-RAD Laboratories, Hercules, CA, USA).
Frozen tissue samples were embedded in OCT compound, sectioned at 4 µm in a TissueTek II cryostat, thaw-mounted on glass slides and fixed immediately in acetone for 10 minutes. The initial tissue section, stained with hematoxylin and eosin, was used to confirm that an ovarian tumor of the appropriate histopathologic type was present in the frozen specimen. Subsequent tissue sections were immunostained for p53 or used as a negative control section.
44
Frozen cell pellets of human breast cancer cell lines known to have mutant p53 (SK-BR-3 and T47D, American Type Culture Collection) were used as positive control specimens for the immunohistochemistry. After fixation in acetone, sections were transferred to PBS buffer and subsequently, endogenous peroxidase was bleached off by incubation with 0.5% H2O2 in PBS for 15 minutes.
After rinsing in PBS for 2 x 5 minutes, unspecific antigen activity was blocked by incubation with 10% normal rabbit serum for 20 minutes. Tissue sections were encircled with a PAP pen. p53 immunostaining was performed by successive incubation in a primary mouse monoclonal p53 antibody (DO-7, 0.95 microgm/ml [1:100 dilution], DAKO Corp.) for 1 hour and after rinsing in PBS a bridging secondary rabbit antimouse IgG antibody (Zymed Laboratories) for 30 minutes.
A negative control was prepared for each unknown tissue by substituting normal mouse IgG (2.5 microg/ml [1:1000 dilution], Zymed Laboratories, Inc. Cat# 08-6599) for the primary p53 antibody.
After rinsing in PBS, the peroxidase anti-peroxidase antibody (Sternberger Meyer #405) was applied in a 1:50 dilution for 30 minutes at room temperature and slides were subsequently rinsed in PBS again for 3 x 5minutes. A DAB solution (Abbott Kit #2A08) was prepared, filtered through a 0.22 µm millipore filter and applied to the slides for 7 minutes at room temperature after blotting off excess saline.
Slides were counterstained by rinsing in 0.1 M sodium acetate buffer for 10 minutes, staining in ethyl green solution for 10 minutes, rinsing in deionized H2O for 2x 10 dips and 1x 30 seconds, and dehydrating in butanol with 2x 10 dips, 1x 3 minutes and xylene 3x for 2 minutes each. Slides were subsequently mounted with Permount (Fisher).
Nuclear immunostaining patterns were evaluated by three observers (Angela Reles, Wen H. Wen, Michael F. Press). The immunoreactivity for p53 antibody was scored as the percentage of positively stained nuclei by counting 100-200 (minimum 100) tumor cells. Tumors with 10% or more nuclei showing immunostaining were considered to have p53 overexpression.
Frozen tissue sections stained with hematoxylin and eosin were used to confirm that the majority of the tissue selected for analysis was composed of tumor cells. To isolate genomic DNA, 10-20 serial frozen tissue sections (10 microns thick) of the tumor were collected in Eppendorf tubes and incubated in 300 µl extraction solution consisting of 10mM Tris Hcl pH 7.5, 25mM EDTA, 100mM NaCl, 0.5% SDS and Proteinase K (0.1 mg/ml) overnight at 50°C.
45
After complete digestion 300 µl of phenol:chloroform:isoamyl alcohol (50:49:1) were added and DNA was purified by centrifugation following deproteination at 14.000 rpm for 5 min. The DNA containing supernatant was placed in a new tube and DNA was precipitated with 2.5 volumes of 100% ethanol and 0.1 volume 3M Na-Acetate pH 6.0 overnight at -20° C. After centrifugation at 14.000 rpm for 30 min and removing the supernatant the pellet was washed with 75% ethanol, airdried and resuspended in 20 µl TE buffer. The DNA yield was measured by spectrophotometry at OD 260 and the concentration was determined according to the formula: DNA concentration (µg/ µl) = (OD 260 x 50 x dilution factor) : 1000
Formalin-fixed, paraffin-embedded tissue stained with hematoxylin and eosin was used to confirm that the majority of the tissue selected for analysis was composed of tumor cells. Three serial sections of 8-10 microns were collected into Eppendorf tubes and deparaffinized by subsequent treatment with Xylene for 5 min, 100% ethanol for 3 min and 95% ethanol for 3 min, each step followed by 5 min centrifugation at 14.000 rpm and removal of the supernatant. The tissue was airdried for 1 hour and then placed in 400 µl of an extraction solution at pH 8.0 containing:
for 3 to 4 days at 50°C. After complete digestion 400 µl of phenol:chloroform:isoamyl alcohol (50:49:1) were added and DNA was purified by centrifugation following deproteination at 14.000 rpm for 5 min. The DNA containing supernatant was placed in a new tube and DNA was precipitated with 2.5 volumes of 100% ethanol and 0.1 volume 3M Na-Acetate pH 6.0 overnight at -20° C. After centrifugation at 14.000 rpm for 30 min and removing the supernatant the pellet was washed with 75% ethanol, airdried and resuspended in 20 µl TE buffer. The DNA yield was measured by spectrophotometry at OD 260 and the concentration was determined according to the formula: DNA concentration (µg/ µl) = (OD 260 x 50 x dilution factor) : 1000
The PCR was used 1) to amplify each of the exons contributing to the open reading frame of the p53 gene (exon 2-11) of all ovarian cancer cases for the mutation screening by SSCP (Single Strand Conformation Polymorphism) and 2) to reamplify those exons which had shown abnormal band patterns in SSCP to detect mutations by DNA sequencing. Sense and antisense primers for exon 2-11 of the p53 gene were designed and analyzed for sequence homologies by using the DNAsis software package on a Macintosh computer and the NCBI (National Center of Biotechnology Information, website: www.ncbi.nlm.nih.gov) sequence data base available through the internet. Primers were usually of 20-21 bases length with a G/C-content ranging between 40-60%.
46
Table 5: Primers and PCR conditions for amplification of p53 exon 2-11
|
p53 exon |
primer sequence |
spans nucleotides |
PCR pro-duct |
Mg++ mM |
tempe-rature |
|
ex 2 Sn |
5' CAGGGTTGGAAGCGTCTCAT 3' |
11642-11661 |
224 bp |
1.6 |
63°C |
|
ex 2 Asn |
5' CTTCCCACAGGTCTCTGCTA 3' |
11865-11846 |
|
|
|
|
ex 3 Sn |
5' TAGCAGAGACCTGTGGGAAGC 3' |
11846-11866 |
159 bp |
0.6 |
63°C |
|
ex 3 Asn |
5' AGAGCAGTCAGAGGACCAGGT 3' |
12004-11984 |
|
|
|
|
ex 4 Sn |
5' CGTTCTGGTAAGGACAAGGG 3' |
11921-11940 |
445 bp |
0.8 |
63°C |
|
ex 4 Asn |
5' AAGAAATGCAGGGGGATACGG 3' |
12366-12346 |
|
|
|
|
ex 5 Sn |
5' CTGTTCACTTGTGCCCTGAC 3' |
13004-13023 |
271 bp |
0.7 |
60°C |
|
ex 5 Asn |
5' AACCAGCCCTGTCGTCTCTC 3' |
13275-13256 |
|
|
|
|
ex 6 Sn |
5' GCTGGAGAGACGACAGGGCT 3' |
13252-13271 |
228 bp |
0.7 |
60°C |
|
ex 6 Asn |
5' CAACCACCCTTAACCCCTCC 3' |
13480-13461 |
|
|
|
|
ex 7 Sn |
5' CTTGCCACAGGTCTCCCCAA 3' |
13941-13960 |
237 bp |
1.6 |
70°C |
|
ex 7 Asn |
5' AGGGGTCAGCGGCAAGCAGA 3' |
14158-14177 |
|
|
|
|
ex 8 Sn |
5' TTCCTTACTGCCTCTTGCTT 3' |
14411-14430 |
231 bp |
1.2 |
65°C |
|
ex 8 Asn |
5' AGGCATAACTGCACCCTTGG 3' |
14622-14641 |
|
|
|
|
ex 9 Sn |
5' AGCAAGCAGGACAAGAAGCG 3' |
14592-14611 |
264 bp |
1.4 |
66°C |
|
ex 9 Asn |
5' GCAAATGCCCCAATTGCAGG 3' |
14836-14855 |
|
|
|
|
ex 10 Sn |
5' CGATGTTGCTTTTGATCCGTCA 3' |
17465-17486 |
257 bp |
1.6 |
63°C |
|
ex 10 Asn |
5'ATCCTATGGCTTTCCAACCTAG3' |
17722-17743 |
|
|
|
|
ex 11 Sn |
5' TCCCGTTGTCCCAGCCTTAG 3' |
18491-18510 |
383 bp |
0.6 |
63°C |
|
ex 11 Asn |
5' GGTATGTCCTACTCCCCATC-3' |
18874-18894 |
|
|
|
One pair of primers was used for each exon except exon 4 for which in part of the cases two pairs of oligonucleotide primers were used as previously published (Wen et al. 1999). The sequence of the primers for exon 7 and exon 8 was used as described by Kohler et al. (1993b). Each of the oligonucleotide primer pairs were designed to span not only the exon of interest, but also sufficient flanking intron sequence so that splice junction mutations would be included for analysis. The 3' oligonucleotide primer of exon 11 was not outside of the splice junction but was 196 nucleotides downstream of the translation termination-codon.
The annealing temperature was determined according to the NCBI information and the Mg++ concentration was optimized for each primer pair. The sequence for each primer pair, the nucleotides spanned by the primer, the expected PCR fragment size, the optimal Mg++ concentration and the annealing temperature were as shown in table 5.
47
Primers were chemically synthesized by the University of Southern California core lab. The primers which were obtained in dried form were diluted in ddH2O. The concentration was determined by measuring the absorbance at
=260 nm (A260) and aliquots of 20 µl with a concentration of 50 pmol were stored at -20°C. 2-5 µl of the tumor DNA samples were diluted to a concentration of 100 ng/µl in TE buffer.
The PCR reaction with a total volume of 25µl was set up as follows:
For each PCR run, a reaction mix with H2O instead of DNA was used as a negative control. For SSCP specimens containing known mutations were processed as positive control samples for exons 5-8 and normal ovarian tissue DNA was used as a normal control. The reactions were set up on ice in 0.5 ml PCR tubes (CLP) and the mixtures were overlaid with one drop of mineral oil to prevent evaporation during repeated heating and cooling during the PCR. After short spinning at 12.000 rpm the PCR reaction was carried out in a DNA thermal Cycler (Perkin-Elmer Cetus, Norwalk, CT, USA) at the following conditions:
|
1 cycle |
94°C |
2 min (initial denaturing of template DNA) |
|
35 cycles |
94°C |
1 min (denaturing of template DNA) |
|
|
60-70°C |
1 min (annealing temperature, depending on primers) |
|
|
72°C |
2 min (elongation) |
|
1 cycle |
72°C |
2 min (elongation) |
After completion of the PCR reaction, samples were cooled to 4°C and, if not used immediately, stored at -20°C.
The PCR products were checked on an agarose gel for the amount and correct size of DNA. 5 µl of the PCR reaction were mixed with 5 µl dd H2O and 2 µl 10x DNA dye and run on a 1.2% agarose gel (50 ml 0.5x TBE buffer, 0.6g Agarose and 1 µl EtBr) with 0.5x TBE as running buffer at 70 volt for 1 hour.
Conformational differences in the PCR products were resolved on a non-denaturing, 0.5x MDE (mutation detection enhancement) polyacrylamide gel with the addition of 5% glycerol at room temperature (Spinardi et al. 1991). A total volume of 100 ml of the gel was mixed out of the following components:
48
|
25 ml |
|
6 ml |
|
5 ml |
|
64 ml |
|
40 µl |
|
400 µl |
The gel mix was cast between two glasplates of a Biorad sequencing apparatus and allowed to polymerize after insertion of a 0.4 mm thick 97 well comb for at least 1 hour at room temperature. A 0.6x TBE solution was used as running buffer. 5 µl of the PCR product of each sample were mixed with 7 µl of stop solution (as described above), and denatured at 94°C for 2 min, followed by immediate cooling on ice for 10 min, except for a normal DNA double-stranded control. Fortyfive samples including the single-stranded normal DNA control, the double-stranded normal DNA control and the positive control were loaded on the gel and run at 21 W at room temperature for a time period between 8 hours (exon 3) and 20 hours (exon 4), on average 14-16 hours, depending on the expected size of the PCR product. After the DNA had migrated far enough through the gel to allow separation of the DNA strands, the gel was dried on Whatman 3 MM paper and subsequently exposed to a Kodak Biomax MR film for 12-48 hours.
DNA segments identified as having altered mobility by SSCP were evaluated by conventional DNA sequence analysis methods (Sanger et al. 1977, Slatko, 1996). Both the sense and anti-sense strands were analyzed by the dideoxynucleotide chain termination technique with PCR sense and anti-sense primers using the ThermoSequenase radiolabeled terminator cycle sequencing kit (Amersham Life Science, Arlington Heights, Il, USA).
a) Preparation of the sequencing gel:
|
|
- 24 ml SequagelTM Concentrate |
|
|
- 66 ml SequagelTM Diluent |
|
|
- 10 ml 10x GTB buffer |
49
b) Sequencing reaction|
|
ddATP, 0.3µM [ |
|
|
ddCTP, 0.3µM [ |
|
|
ddGTP, 0.3µM [ |
|
|
ddTTP, 0.3µM [ |
The sequencing reaction was set up according to the following protocol (Mok et al.1993):
Ovarian carcinoma template DNA was reamplified with the appropriate PCR primer pair as described previously. 5 µl of the amplified PCR product were pretreated with 1 µl (2U) of shrimp alkaline phosphatase (Amersham) and 1 µl (10U) of exonuclease I (Amersham) at 37°C for 15 min in a thermal cycler followed by inactivation of the enzyme at 80°C for 15 min.
For each case two sets of PCR tubes (for the sense and the antisense primer) were labelled as A,C,G,T and a termination mix was set up on ice as follows:
|
2 µl dGTP termination master mix + 0.5 µl [ |
|
2 µl dGTP termination master mix + 0.5 µl [ |
|
2 µl dGTP termination master mix + 0.5 µl [ |
|
2 µl dGTP termination master mix + 0.5 µl [ |
Subsequently a reaction mix of 20 µl volume was set up on ice for each case as follows:
|
3 µl |
|
2 µl |
|
12 µl |
|
1 µl |
|
2 µl |
50
4.5 µl of this reaction mix were added to each A,C,G,T termination mix tube (total volume 7 µl) on ice. The sequencing reaction was carried out in a thermal cycler (MJ research) which was preheated to 95°C under the following conditions for 30 cycles:
|
30 sec |
|
30 sec |
|
90 sec |
followed by cooling to 0°C. Subsequently 4 µl of stop solution were added to each of the reactions and the samples were stored at -20°C overnight.
c) Gel electrophoresis:
Automated DNA sequencing was used 1) to identify p53 mutations in ovarian cancer cases which had not shown SSCP alterations and 2) to compare the normal tissue DNA sequence of tumor cases with suspected p53 polymorphisms.
Fourty-two ovarian carcinoma cases which had no mobility shift identified by SSCP screening were subjected to complete DNA sequence analysis of exon 2-11 by automated DNA sequence analysis, to identify those mutations which SSCP failed to identify, as described elsewhere (Wang-Gohrke et al.1998, Wen et al. 1999). The automated sequencing was performed in the Molecular Biology Laboratory of Prof. Dr. R. Kreienberg at the Department of Gynecology and Obstetrics at the University of Ulm, Germany, using an A.L.F. Express Sequencer (Pharmacia Biotech, Uppsala, Sweden) (Wang-Gohrke et al. 1998).
51
For automated sequencing of normal tissue controls for p53 polymorphisms a PCR reaction of 50 µl volume was set up with 400 ng of DNA, 40 µmoles dNTP, 25pmol of each of the appropriate primers, Mg++ concentration as described in table 5 and 2U of Taq DNA polymerase. The PCR product was analyzed by gel electrophoresis on a 1.2% agarose gel (Seakem) made up with 0.5x TAE buffer and 160 µg/l ethidium bromide. The PCR product of the expected size was extracted from the gel with a DNA gel extraction kit (Qiagen, Chatsworth, CA).150 ng of each purified PCR product and 5 pmol of each of the appropriate primers as used for the PCR reaction were submitted to automated sequencing on a Perkin Elmer 377 ABI prism automated sequencer. DNA sequencing was performed with a dye-based (Big Dye) Applied Biosystems procedure incorporating 3‘ fluorescent-labeled dideoxynucleotide triphosphates (dye terminators) into the extension of the PCR products (asymmetric PCR). The specific emissions were detected and analyzed by a PC program which counts the fluorescence label excitements produced by laser lights.
Total RNA was extracted from frozen tissue by using the TRIzol reagent and extraction protocol (Gibco BRL). Frozen tissue sections stained with hematoxylin and eosin were used to confirm that the majority of the tissue selected for analysis was composed of tumor cells. To isolate total RNA an adjacent piece of frozen tissue (50 mg) of the tumor was collected in an Eppendorf tube placed on dry ice. Subsequently 1 ml of TRIzol reagent was added to the tube, immediately followed by homogenization with a tissue homogenizer (VWR) at maximum speed. The homogenized samples were incubated 5 min at room temperature to permit complete dissociation of nucleoprotein complexes. After adding 0.2 ml of chloroform, tubes were vigorously shaken by hand for 15 sec and then incubated at room temperature for 3 min, followed by centrifugation at 12.000 rpm for 15 min at 4°C. The RNA-containing upper aqueous phase was transferred to a fresh tube and precipitated with 0.5 ml isopropyl alcohol, incubated for 10 min at room temperature and then centrifuged at 12.000 rpm for 10 min at 4°C. After centrifugation the supernate was removed and the RNA pellet was washed with 1 ml of -20°C cold 75% ethanol, mixed by vortexing and centrifuged at 10.000 rpm for 5 min at 4°C. Subsequently the RNA pellet was airdried and redissolved in DEPC-H2O. The RNA yield was measured by spectrophotometry at OD 260 and the concentration was determined according to the formula: RNA conc. (µg/ µl) = (OD 260 x 40 x dilution factor) : 1000
RNA preparations were stored at -70°C.
Total RNA from tumor tissue and a control cell line (SA1 osteosarcoma cell line) was fractionated, blotted on nylon membranes and hybridized according to the following protocol:
RNA fractionation:
52
b) Immobilization of the fractionated RNA on nylon filters:
c.) Hybridization
53
Genomic DNA from tumor tissue and cell lines was fractionated, blotted on nylon membranes and hybridized according to the following protocol:
DNA fractionation:
b) Immobilization of the fractionated DNA on nylon filters:
c.) Hybridization
cDNA synthesis was performed with the following reaction mix:
were heated to 70°C for 10 min and then immediately cooled to 0°C in ice water for 5 min; the following reagents were mixed on ice:
54
and the total volume of 13 µl was added to each tube. The cDNA synthesis was carried out at 39°C for 1 hour and stopped by heating to 95°C for 5 min, followed immediately by cooling the samples in ice water; 2 µl of the cDNA were used for RT-PCR; the cDNA was stored at -70°C.
a) Nested PCR for amplification of mdm2 cDNA
cDNA which had been synthesized by reverse transcription from total RNA was used as a template for a nested PCR protocol. cDNA was amplified by a set of external mdm2 primers spanning the entire coding region of the mdm2 gene spanning exon 3 to exon 12. Since mdm2 is expressed at low levels the PCR product was then subjected to a second run of PCR with internal primers. The primer sequence we used had been previously published (Sigalas et al. 1996). The internal sense primer has a gap of eight nucleotides.
The annealing temperature was determined to be 58° C according to a formula based on the nucleotide content. The Mg++ concentration was chosen as 1.4 mMol according to previous protocols (Sigalas et al. 1996).
Table 6: mdm2 external and internal primers for nested PCR
|
Primer |
Primer sequence |
spans nucleotides |
|
ext Sn |
5' CTGGGGAGTCTTGAGGGACC 3' |
248-267 |
|
ext Asn |
5' CAGGTTGTCTAAATTCCTAG 3' |
1831-1851 |
|
int Sn |
5' CGCGAAAACCCCGGGCAGGCAAATGTGCA 3' |
280-293, 302-318 |
|
int Asn |
5' CTCTTATAGACAGGTCAACTAG 3' |
1784-1805 |
Primers were obtained from the University of Southern California core lab. The concentration of the primers dissolved in ddH2O was determined by measuring the absorbance at
=260 nm (A260). Primers were diluted to a concentration of 50 pmol. 2 µl of the cDNA, which had been reverse transcribed from total RNA, were used as a template for the external PCR run and 2 µl of the resulting product were used for the internal primer PCR run.
The PCR reaction was set up for the external primer run to a total volume of 25 µl as follows. For the internal primer run a volume of 50 µl was set up to have a greater DNA yield for sequencing analysis.
55
For each PCR run, a reaction mix with H2O instead of DNA was used as a negative control. The reactions were set up on ice in 0.5 ml PCR tubes (CLP) and the mixtures were overlaid with one drop of mineral oil to prevent evaporation during repeated heating and cooling during the PCR. After short spinning at 12.000 rpm the PCR reaction was carried out in a DNA thermal Cycler (Perkin-Elmer Cetus, Norwalk, CT, USA) at the following conditions for both external and internal primers:
|
1 cycle |
94°C |
2 min (initial denaturing of template DNA) |
|
30 cycles |
94°C |
1 min (denaturing of template DNA) |
|
|
58°C |
1 min (annealing temperature) |
|
|
72°C |
2 min (elongation) |
|
1 cycle |
72°C |
2 min (elongation) |
After completion of the PCR reaction, samples were cooled to 4°C and, if not used immediately, stored at -20°C.
b) PCR of the ß2 microglobulin gene as a control
PCR amplification of the ß2 microglobulin gene was used as an internal control to confirm that the RNA used for reverse transcription was intact and that sufficient and equal amounts of cDNA had been synthesized. The
2-microglobulin gene is approximately 8Kb in size and consists of four exons and three introns. The complete mRNA comprises 945 nucleotides and codes for a polypeptide of 99 amino acids, which are mostly represented by the exon 2 sequence (93 amino acids). We designed a pair of primers which span 898 bp of cDNA. The sense primer was located close to the 5‘ end of exon 1 and the antisense primer close to the 3‘ end of exon 4. The sequence of the primers was:
sense: 5‘ TCCTGAAGCTGACAGCATTC 3‘ (nucleotides 855-874) and
antisense: 5‘ CCGTACCAACACCAATTAGA 3‘ (nucleotides 3983-4002).
Primers were obtained from the University of Southern California core lab. Primer concentration was determined by measuring the absorbance at
=260 nm (A260) and primers were diluted to 50 pmol/µl. 1 µl of the cDNA template was used for the reaction which was carried out at an annealing temperature of 62° and a Mg++ concentration of 0.8 mmol. The PCR reaction with a total volume of 25 µl was set up as follows:
56
For each PCR run, a reaction mix with H2O instead of DNA was used as a negative control. The reactions were set up on ice in 0.5 ml PCR tubes (CLP) and the mixtures were overlaid with one drop of mineral oil to prevent evaporation during repeated heating and cooling during the PCR. After short spinning at 12.000 rpm the PCR reaction was carried out in a DNA thermal Cycler (Perkin-Elmer Cetus, Norwalk, CT, USA) at the following conditions:
|
1 cycle |
94°C |
2 min (initial denaturing of template DNA) |
|
35 cycles |
94°C |
1 min (denaturing of template DNA) |
|
|
62°C |
1 min (annealing temperature) |
|
|
72°C |
2 min (elongation) |
|
1 cycle |
72°C |
2 min (elongation) |
After the PCR reaction was completed, samples were cooled to 4°C and 10 µl of the reaction product was run on a 1% agarose gel. A single PCR product of approximately 900 bp size was detected for all cDNA samples.
For optimal ligation efficiencies, a fresh PCR reaction was run with the internal mdm2 primers using the external primer PCR product as a template to provide sufficient single 3‘ A-overhangs. Ligation and transformation were performed by using the Original TA Cloning® Kit (Invitrogen), which contains the pCRTM 2.1 vector.
a) Ligation
|
x ng PCR product |
= |
(y bp PCR product)(50 ng pCRTM 2.1 vector) |
|
|
|
(size in bp of the pCRTM 2.1 vector |
57
|
fresh PCR product |
6 µl |
|
10x ligation buffer |
1 µl |
|
pCRTM 2.1 vector (25ng/µl) (Invitrogen) |
2 µl |
|
T4 DNA ligase (5U/µl ) ( Boehringer Mannheim) |
1 µl |
|
Total volume |
10 µl |
b) Transformation
) were used for transformation
|
DdH20 |
13.64 µl |
|
Mg free buffer |
2 µl |
|
dNTP 400µM |
1 µl |
|
primer PR 126 |
1 µl |
|
primer PR 127 |
1 µl |
|
MgCl++ |
0.96 µl |
|
|
|
Electro-competent bacteria of the strain DH10B were generated and tested according to the following protocol:
a) Growth of electro-competent bacteria
59
b) Transformation of electro-competent bacteria
Mini- and midi-preps of plasmid DNA were carried out with a Quiagen plasmid purification kit (Quiagen Inc, Chatsworth, CA, USA) according to the protocol supplied by the manufacturer:
=260 nm (1 OD corresponds to 50 µg/ml plasmid DNA)
60
|
P1: |
50 mM Tris/Cl, 10 mM EDTA, 100 µg/ml RNAseA, pH 8.0 |
|
P2: |
200 mM NaOH, 1% SDS |
|
P3: |
3.0 M potassium-acetate, pH 5.5 |
|
QBT: |
50 mM MOPS, 750 mM NaCl, 15% EtOH, 15% Triton X-100, pH 7.0 |
|
QC: |
50 mM MOPS, 1000 mM NaCl, 15% EtOH, pH 7.0 |
|
QF: |
50 mM Tris/Cl, 1250 mM NaCl, 15% EtOH, pH 8.5 |
|
|
|
Restriction enzyme digestion of DNA was carried out in 20 µl volumes at conditions recommended by the manufacturer (NEB Biolabs) using the appropriate restriction enzyme buffer supplied with the enzyme. Digestion of plasmid DNA was usually checked during the reaction on a 0.8-1.5% agarose mini-gel containing 5 µg/ml ethidium bromide. Digestion was usually stopped by incubation at 65°C for 10 to 15 min, before the digested DNA was used for further experiments.
|
13.6 µl |
|
2 µl |
|
1 µl |
|
1 µl |
|
1 µl |
|
0.96 µl |
|
0.4 µl |
For further analysis of mdm2 splice products, the PCR product, amplified from the cDNA, was extracted from a 1.2% agarose gel containing 5 µg ethidium bromide with a QIAquick Gel Extraction Kit (Quiagen Inc, Chatsworth, CA, USA) with the buffers supplied in the kit according to the manufacturers instructions:
100 ml)
61
For in vitro protein expression of the mdm2 splice variants, MDM2 full length protein and p53 protein, cDNA was cloned into the pcDNA3.1 expression vector (Invitrogen) (Fig. 8a). A variant of the pcDNA3 vector with a human myc epitope, respectively a human hemagglutinin (HA) epitope was kindly provided by Ulf Grawunder PhD.
The following set of sense and antisense primers for p53 and MDM2 protein expression containing restriction enzyme sites for BamHI and MluI was designed:
|
mdm2 sense: |
5‘ CG GGATCC ATGGGCAATACCAACATGTCTGTACCTAC 3‘ |
|
|
|
BamHI |
mdm2 sequence (T exchanged to G) |
|
mdm2 antisense: |
5‘ GCG ACGCGT GGGGGAAATAAGTTAGCACAATCATTTG 5‘ |
|
|
|
MluI |
mdm2 sequence (G added for correct frame) |
|
p53 sense: |
5‘ CG GGATCC ATGGAGGAGCCGCAGTCAGATCCTAGC 3‘ |
|
|
|
BamHI |
p53 sequence |
62
|
p53 antisense: |
5‘ GCG ACGCGT GGTCTGAGTCAGGCCCTTCTGTCTTGAAC 5‘ |
|
|
|
MluI |
p53 sequence (G added for correct frame) |
CMV promotor: bases 209-863
T7 promotor: bases 864-882
Polylinker: bases 889-994
Sp6 promotor: bases 999-1016
BHG poly A: bases 1018-1249
SV40 promotor: bases 1790-2115
SV40 origin of replication: bases 1984-2069
NeoR ORF: bases 2151-2945
SV40 poly A: bases 3120-3250
pUC19 backbone: bases 3272-5446
AmpR ORF: bases 4450-5310
Fig. 8a: pcDNA3 expression vector (Invitrogen). cDNA of p53, full length mdm2 and mdm2 splice variants was ligated into the pcDNA3 expression vector.

63
To generate the insert with the correct sequence for protein expression, a PCR reaction was run with the pCRTM2.1 vector plasmid DNA containing the cDNAs of six different mdm2 splice variants. The plasmid DNA was diluted 1:1000 in TE buffer. To obtain the PCR product containing the full length mdm2 cDNA and the p53 sequence, undiluted cDNA generated by reverse transcription from RNA of five different normal ovary tissues was used as a template. The following reaction was set up:
|
16.8 µl |
|
3 µl |
|
6 µl |
|
1.5 µl |
|
1.5 µl |
|
0.2 µl |
|
1 µl |
The PCR product was run on a 1.2% agarose gel to check the size of the DNA.
a) Purification of the PCR-product
The PCR products generated with the primers designed for protein expression were purified by using MicroSpin Columns S-400 HR, according to the manufacturers instructions:
Restriction enzyme digestion of PCR product and vector
64
Purification of PCR product and plasmid DNAAfter enzyme digestion, the PCR products of the splice variants were run on a 1.5% agarose gel and the plasmid DNA, the mdm2 full length, and p53 PCR product were run on a 0.8% agarose gel. Both agarose gels were prepared with 1x TAE buffer and ethidiumbromide in a concentration of 1.2 µl/100ml gel. The DNA was then excised from the gel and purified with the Gene Clean kit (Bio 101), according to the manufacturers instructions:
volume)
To ligate the digested PCR products of the mdm2 splice variants, the full length mdm2 cDNA, and the full length p53 cDNA into the pcDNA3 expression vector, the following reaction was set up:
|
0.5 µl |
|
2 µl |
|
6.5 µl |
|
1 µl |
|
10 µl |
|
20 µl |
|
0.5 µl |
|
2 µl |
|
6.5 µl |
|
1 µl |
|
10 µl |
|
20 µl |
65
|
Negative control I (no cDNA) |
|
|
0.5 µl |
|
0.5 µl |
|
2 µl |
|
16 µl |
|
1 µl |
|
20 µl |
|
Negative control II (no cDNA, no ligase) |
|
|
0.5 µl |
|
0.5 µl |
|
2 µl |
|
17 µl |
|
20 µl |
The ligation reaction was incubated for 30 min at room temperature.
The pcDNA3 plasmid DNA containing the mdm2 respectively p53 insert was digested with
the NcoI restriction enzyme in a reaction containing 2 µl template DNA, 1 µl 10x buffer, 1 µl 10x BSA, 5.8 µl H2O, and 0.2 µl NcoI (10 U/µl) at 37°C overnight. The pcDNA3 vector contains three NcoI sites at positions 610, 1976 and 2711, which cut the plasmid into three expected sizes of 3345 bp (609+2736), 1366 bp and 735 bp (Figure 8a,b).
66
Fig. 8b: mdm2 splice variant cDNA after NcoI restriction enzyme digestion of the pcDNA3 expression vector. The expression vector has three NcoI restriction sites at positions 610, 1976, and 2711 and the mdm2 cDNA (654 bp) has one NcoI restriction site at position 533. The cDNA analyzed on the agarose gel shows three fragments of the vector and two fragments of the cDNA insert, one with additional vector sequence. All clones (lanes 1-6) contain the mdm2 splice variant cDNA.

The site of the polylinker is between position 889 and 994. The primer designed for the protein expression contains a NcoI site. Therefore in cases with the expected insert, the plasmid was cut 301 bases from the first restriction site 610. The mdm2 cDNA contains a NcoI site at position 1664, which has been spliced out in clones 49, 66, 68, 83, and 84, but not in clone 20. After restriction enzyme digestion, five bands of the correct size were seen in the mdm2 full length clone and clone 20, while the other mdm2 clones contained four bands of the correct size. The primer and the p53 cDNA also contain one NcoI site each, so that the p53 containing plasmid was cut into five pieces of DNA (Fig. 8b). The plasmid DNA of the clones containing the correct size inserts were phenol-chloroform extracted as previously described.
We used a transient cytoplasmic expression system that relies on the synthesis of the bacteriophage T7 RNA polymerase in the cytoplasm of mammalian cells (Fig. 9) (Panicali and Paoletti, 1982, Mackett et al. 1982, Moss and Flexner, 1987). The mdm2-cDNA of interest, respectively the p53-cDNA, had been inserted into the pcDNA3 plasmid such that it came under the control of the T7 RNA polymerase promoter (pT7) as previously described (chapter 3.3.2.22).
67
Fig. 9: Transient transfection of pcDNA constructs into vaccinia virus infected HeLa cells. The cDNA of interest was inserted into the pcDNA3 plasmid such that it came under the control of the T7 RNA polymerase promoter (pT7). Using liposome-mediated transfection, this recombinant plasmid is introduced into the cytoplasm of HeLa-cells infected with the vTF7-3 strain, a recombinant vaccinia virus encoding bacteriophage T7 RNA polymerase. During incubation, the cDNA is transcribed with high efficiency by T7 RNA polymerase. Proteins were detected by immunoprecipitation and Western blotting.

Using liposome-mediated transfection, this recombinant plasmid is introduced into the cytoplasm of HeLa-cells infected with the vTF7-3, a recombinant vaccinia virus encoding bacteriophage T7 RNA polymerase. During incubation, the cDNA is transcribed with high efficiency by T7 RNA polymerase.
a) Infection of HeLa cells with the Vaccinia Virus vTF7-3
68
b) Transient transfection of HeLa cells
Cellular proteins either for Western blot analysis or after immunoprecipitation were electrophoretically fractionated by SDS-PAGE according to Laemmli (Laemmli, 1970). Therefore,
69
|
|
final acrylamide concentration: |
|
|
||
|
|
10% |
12.5% |
15% |
17.5% |
20% |
|
MW-range (kd) |
15-180 |
12-150 |
12-100 |
8-80 |
7-70 |
|
30% acrylamide |
10 ml |
12.5 ml |
15ml |
17.5 ml |
20 ml |
|
1% bis-acrylamide |
3.9 ml |
3.1 ml |
2.6 ml |
2.2 ml |
2.0 ml |
|
-125 mM Tris/Cl, pH 8.6 |
|
- 20% glycerol |
|
- 0.2% SDS |
|
- 0.002% bromophenol-blue |
|
- 1.43 M 2-mercaptoethanol |
The expression of the MDM2 full length and splice variant proteins and the p53 protein was analyzed by Western blotting using antibodies directed against the myc- respectively HA- epitope followed by the use of secondary horseradish peroxidase (HRPO) labelled antibodies, which were detected by means of an ECL kit (Amersham Life Science, Arlington Heights, Il, USA).
70
|
- 0.025 M Tris-base |
|
- 0.192 M glycine |
|
- 20% methanol |
Statistical analyses were implemented using the SAS software packages. Overall survival was defined as the time from initial surgery following the diagnosis of ovarian cancer until death or the date of last follow-up, if the patient was still alive. All causes of death were counted as failures. Time to progression was defined as the time from initial surgery until documentation of disease progression. Patients who had not yet progressed were censored at the date of last follow-up in which the disease status was assessed; no patients died prior to progressing, unless they died from intercurrent disease. For 29 (16%) of the patients who died of their ovarian cancer, the date of progression was not documented. For those patients (n=83) who had progressed and whose date of progression was known, the median time from progression to death was calculated using the Kaplan-Meier estimator, to estimate the date of
71
progression (Kaplan and Meier 1958). This value, 273 days, was subtracted from the survival time of the patients whose date of recurrence was not documented. In 5 patients this value was greater than the time from surgery to death and in this situation, the time to progression was taken as one-half of the interval between surgery and death. In 11 cases, no follow-up regarding disease status was available; these patients were not included in the analysis of time to progression but were included in the summary of baseline characteristics.Medians, quartiles and percentages were used to summarize the patient characteristics and to illustrate associations. Pearson´s chi-square test for association and the Mantel-Haenszel test for trend (Mantel and Haenszel, 1959) were used to evaluate the strengths of the observed associations. Kaplan-Meier plots, relative risks and p-values derived from the partial likelihood ratio test based on Cox´s proportional hazards model (Cox, 1972) were used to summarize the relationships; a stepwise forward selection algorithm was used to select a parsimonious subset of variables to classify patients into better or worse prognosis subsets.
Finally to further explore the association between p53 overexpression and outcome, an optimal cut-point for p53 nuclear staining was determined by adapting the maximally selected chi-square methods of Miller and Halpern (Miller and Siegmund 1982, Halpern 1982, Lausen and Schumacher 1992). To do this, we first applied the score function generated from the stepwise proportional hazards model to each patient. The logrank test statistic, stratified by the trichotomized scores, was used to compare overall survival for the two groups of patients (below or equal to the percentage of p53 staining value vs above the value). The percentage of p53 positive nuclei which yielded the largest stratified logrank test statistic (the maximal logrank statistic) was selected as the optimal cutpoint.
© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
|
DiML DTD Version 2.0 |
Zertifizierter Dokumentenserver der Humboldt-Universität zu Berlin |
HTML - Version erstellt am: Thu Aug 15 15:17:40 2002 |