Richter , Frank : Interaktion von Retinolsäurerezeptoren und Androgenrezeptor bei Androgen- und Retinoid- Stimulation von Prostatazellen und Prostatakarzinomzellen - möglicher Ansatz zur Therapie des Prostatakarzinoms

23

Kapitel 3. MATERIALIEN UND METHODEN

3.1 VERWENDETE ZELLINIEN UND DEREN CHARAKTERISIERUNG

LNCaP: HumaneEpithelzellinie aus einer supraklavikulären Lymphknotenmetastase eines Patienten mit hormonresistentem, undifferenzierten metastasierendem Prostatakarzinom (Lymph Node of Carcinoma of the Prostate), entwickelt 1981 durch Horoszewicz et al. ( ) in Roswell Park Memorial Institute. Die Zellinie hat einen mutierten Androgenrezeptor und ist im Wachstum durch Androgene stimulierbar. Medium: RPMI mit 5% FCS bei 37 0 C im Inkubator. Passage mittels 1%Trypsin/EDTA in RPMI bei 80-90% Konfluenz.

PC3: Androgenunhabhängige Prostatakarzinomzellinie mit aggressivem Wachstumsverhalten im Nacktmaus-Modell. Der Androgenrezepror ist mutiert. Kultur: In RPMI-Medium mit 5% FCS bei 37 0 C im Inkubator. Passage mittels 1%Trypsin/EDTA in RPMI bei 80-90% Konfluenz.

NRP152 : Prostataepithelzellinie, entwickelt von Danielpour, Sporn et al. () von Prostaten aus Lobund-Wistar-Ratten. Wachstum in DMEM supplementiert mit 5%FCS, EGF, Cholera -Toxin, Hydrocortison bei 37 0 C im Inkubator. Passage mittels 1%Trypsin/EDTA in DMEM bei 80-90% Konfluenz.

NRP154: Prostatakarzinomzellinie, entwickelt von Danielpour, Sporn et al. () von Prostaten aus Lobund-Wistar-Ratten nach Induktion eines Prostatakarzinoms durch einmalige IV-Gabe von Methyl-nitrosoharnstoff (50mg/kg) in die Schwanzvene, gefolgt von Depot-Testosteron als S.C.-Kapsel. Wachstum in DMEM supplementiert mit 5%FCS, EGF, Cholera -Toxin, Hydrocortison bei 37 0 C im Inkubator. Passage mittels 1%Trypsin/EDTA in DMEM bei 80-90% Konfluenz..

Die Zellinien NRP154 und NRP152 erlauben einen direkten Vergleich der Retinoid/ Androgenwirkung auf normales und karzinomatös verändertes Prostata-Epithel.


24

3.2 TIERMODELL NACH POLLARD (LOBUND-WISTAR-RATTE)

Beobachtungen haben gezeigt, daß der Lobund-Wistar-Rattenstamm spontan zur Bildung von Prostatakarzinomen neigt (Pollard, 1973). Die Karzinogenese kann, wie Maurice Pollard, Unversity of Indiana, in seinen Arbeiten gezeigt hat durch einmalige IV-Gabe von Methylnitrosoharnstoff (MNU, 50mg/kg) in die Schwanzvene gefolgt von subkutaner Verabreichung eines Testosteron-Depots stimuliert werden. 90% der so behandelten Tiere entwickelten nach 10-12 Monaten ein histologisch nachgewiesenes Prostatakarzinom. Insgesamt wurden 100 Lobund-Wistar -Ratten verwendet, die zum Zeitpunkt 0, 1.5 Monate, 3 Monate , 6 Monate und 12 Monate nach Behandlung mittels Diethylether euthanasiert wurden. Als Kontrollen dienten unbehandelte Tiere. Die Prostaten wurden disseziert und in dorsalen und ventralen Lappen getrennt. Ein Teil des Gewebes wurde in 10% Formaldehyd fixiert, paraffiniert und für Gewebsschnitte verwendet.

Mit diesen wurde nach De-paraffinierung immunhistochemische Untersuchungen mit Antikörpern gegen RAR alpha,beta,gamma durchgeführt. Der andere Teil des Gewebes wurde in Trockeneis schockgefroren und bis zur Verarbeitung in flüssigen Stickstoff bei -700 Cgelagert.

Das schockgefrorene Gewebe wurde für die Isolierung von Gesamt- RNA zur RT-PCR verwendet.

3.3 GEWINNUNG VON HUMANEM PROSTATAGEWEBE-GEWEBEAUFBEREITUNG

Humanes Prostatagewebe wurde aus dem Urologischen Operationssaal des University Hospital, UMD-New Jersey Medical School, Newark, NJ, und dem Urologischen Operationssaal des VA-Hospitals, East Orange, NJ,USA, bezogen. In beiden Einrichtungen war zuvor durch die jeweilige Ethikkommission (Internal Revenue Board- IRB) die Verwendung von Prostatagewebe, das nicht zur pathologischen Diagnosestellung benötigt wurde, für Forschungszwecke befürwortet. Jeder Patient wurde vor dem Eingriff über die Absicht, Prostatagewebe für Forschungszwecke zu verwenden aufgeklärt. Eine Einverständnserklärung, die jeder Patient vor dem Eingriff zu


25

unterzeichnen hatte, war im Rahmen des Ethikantrages ausgearbeitet und von der Ethikkommission bestätigt worden. Von den Patienen, die wegen eines Prostatakarzinoms operiert wurden (Retropubische Radikale Prostatektomie) erhielt keiner Anti-Androgene präoperativ. Die Gewebesicherstellung erfolgte durch den Untersucher im Zusammenarbeit mit dem Pathologen, der durch Gewebsschnitte die Dignität des gewonnenen Gewebes nachwies.

Das Gewebe wurde dann auf Trockeneis schockgefroren und bis zur Verarbeitung in flüssigen Stickstoff bei -700 C gelagert. Einige Gewebsproben wurden direkt von der Nationalen Gewebebank (NIH, Bethesda, Maryland, USA) bezogen und dort charakterisiert. Die klinisch-pathologische Charakterisierung der verwendeten Gewebe hinsichtlich Tumor-Stadium, Gleason-Score und präoperativem PSA ist in Tab.2 angegeben. Keiner der Patienten hatte Behandlung mit Antiandrogenen oder LHRH-Agonisten.

3.4 BESTIMMUNG DER ZELLPROLIFERATION

  1. Zellzählung wurde durchgeführt, wobei die Anzahl der Zellen in einer 20 µl Zellsuspension in den inneren 5 x 5 Feldern einer Neubauer-Kammer ausgezählt wurden. Die Gesamtzellzahl in der Zellkultur wurde berechnet.
  2. [3H]-Thymidin- Inkorporation in die Zell-DNA pro Zeiteinheit wurde als Marker der Zellproliferation verwendet. Dabei wurden die Zellen auf einer 12-well-Kulturplatte propagiert (2-5 x 104Zellen/ Well in 4 ml Medium). Nach 3 Tagen wurde das Medium entfernt und durch 1ml Kulturmedium (RPMI oder DMEM) mit cFCS ersetzt, um endogene Steroide im FCS zu eliminieren. Diesem Medium wurde [3 H]-Thymidin in einer Konzentration von 0.5 µCi/ml der Zellkltur zugegeben. Die Zellen wurden nach vier Stunden mit 0.2ml Lyse-Puffer (0.1M NaCl, 0.01M EDTA, 0.3M Tris-HCl (pH8.0) mit 0.2M Sucrose und 0.5% SDS) lysiert. DNA wurde mittels Phenol/Chloroform/Isoamylalkohol (25:24:1) extrahiert und durch Zugabe des gleichen Volmenanteils Isopropanol präzipitiert. Nach Waschen mit 70% Ethanol wurde das Pellet mit Szintillationsflüssigkeit vermischt und die Aktivität proDNA im beta-Counter bestimmt und als cpm/µg DNA angegeben.

26

3.5 NORTHERN BLOTS MIT cDNA GEGEN ARmRNA uns RARmRNA

Gesamt-RNA wurde von verschiedenen Geweben und Zellinien wie bei Chomczynski und Sacchi beschrieben () isoliert. Gewebe wurden mit einem Polytron Homogenisator (Brinkmann Instruments, Westbury, NY) in 5 Vol. Denaturierungslösung (4M Guanidinthiozyanat; 25mM Natriumzitrat pH7.0; 0.5% Sacrosyl und 0.1M 2-Mercaptoethanol) homogenisiert. Nach der Phenol- und Chloroform-Isoamylalkohol-Extraktion wurde die RNA aus der wässrigen Phase mit 1Vol. Isopropanol bei -20 0 C über Nacht präzipitiert und imVakuuum getrocknet. Poly(A)RNA wurde durch Oligo(Desoxythymidin)-Zellulose-Chromatografie isoliert, wie beiChomszynski und Sacchi () beschrieben.Die Poly(A)RNA wurde mittels Elektrophorese eines 1%Formaldehyd-17%Agarose-Gels separiert und auf eine Biotrans-Membran (ICN Biomedical, Costa Mesa, CA). Die komplementären cDNA-Abschnitte von Maus- RARalpha,beta,gamma wurden durch Agarose-Gel-Elektrophorese nach Endonuklease-Digestion isoliert und mit [32 P]-Desoxy-CTP markiert (Random priming kit, Boehringer, Mannheim). Die Blots wurden für 2-4 Stunden in 6 x SSC (150mM NaCl und 15mM Natriumzitrat, pH7.0), 0.5% SDS, 50% Formamid und 100µg/ ml denaturierte Sperm-DNA bei 42 0 C prähybridisiert.

Die Hybridisierung erfolgte über Nacht in der gleichen Lösung unter Zusatz von 10 6 cpm/ ml radiomarkierter cDNA. Die Membranen wurden dann in 1 x SSC (+0.1% SDS) bei 68 0 C für 20-30 min gewaschen. Weitere Wasch-Schritte unter Wechsel des Waschpuffers (0.2 x SSC und 0.1%SDS) bei 68 0 C für 2 - 4 Stunden. Für die autoradiographische Signaldetektion wurde ein KODAK XAR-5-Film (Eastman, Kodak, Rochester, USA) mit Intensivierungsschirm für 2-10 Tage mit der Membran bei -20 0 C belichtet. Die Membranen wurden nach filmentwicklung gestrippt und mit [32 P]-markierter beta-Aktin-cDNA und/ oder cDNA gegen 18SrRNA rehybridisiert.

Die Signalintensität wurde durch Densitometrie unter Verwendung eines SHIMADZU-Densitometers und Integrators (Shimadzu Scientific Instruments, Princeton, NJ, USA) bestimmt.


27

3.6 ANALYSE DER GEN-EXPRESSION MIT GEN-ARRAYS (NRP152 und NRP154 )

Unterschiede in der Gen-Expression zwischen den Zellinien NRP152 und NRP154 wurden unter Verwendung des AtlasTM cDNA-Expressions Arrays (CLONTECH) analysiert. Dabei kann mittels AtlasTM-1.2-Array die Expression von 1176 Genen untersucht werden, die für eine Vielzahl bekannter Onkogene, Tumor Suppressor Gene, Zell-Zyklus-Regulatoren, Transkriptionsfaktoren, Transportproteine, Zellmembranrezeptoren und Wachstumsfaktoren kodieren. Dabei wurde von den Zellinien NRP152 und NRP154 Gasamt-RNA, wie oben beschrieben isoliert, mit 32P markiert und mit dem AtlasTM-1.2-Array für 12 Stunden hybridisiert. Die Qantifizierung der Genexpression erfolgte dann mittels der vom Hersteller (CLONTECH) gelieferten Phospho-Imaging-Software (AtlasImageTM 1.0).

3.7 RT-PCR MIT RARalpha,beta,gamma- PRIMERN

Da die Menge an humanem Prostatagewebe begrenzt war, wurde RT-PCR für die Identifizierung der RARmRNAs verwendet. Einzelstrang-cDNA wurde unter Verwendung von 4 µg RNA und random hexamer primers (Life Technologies) mit Reverser Transcriptase (RT) von Moloney Maus-Leukämie-Virus synthetisiert. Die PCR-Reaktion wurde mit den in Tab. 1 angegebenen sense und anti-sense Primer-Sequenzen für RARalpha,beta,gamma durchgeführt (Tanji et al., 1996). Eine Zyklus-Response-Kurve wurde für jedes Primer-Paar durchgeführt, um sicherzustellen, daß die Amplifikationsbedingungen in den linearen Bereich der Zklus-Response-Kurve fallen. Die Bedingungen für jede Reaktion im Thermocyler (PERKIN-ELMERS) waren: 30 Zyklen mit folgenden Reaktionsbedingungen pro Zyklus: 940 C für 45 sec., 550 C für 30 sec.,720 C für 90 sec. Die Amplifikation wurde beendet bei 720C für 10 Minuten. Jede Reaktionsmischung von 50µl Gesamtvolumen enthielt: 2µl RT-Produkt, 10 µM dNTP, 1.5 µM MgCl2 und 0.5 Units Taq-Polymerase in 10 X PCR-Puffer (Life Technologies).

Eine Mischung von Kontroll-Primern mit und ohne Reverser Transkriptase wurde eingesetzt um die Effizienz der RT-Reaktion nachzuweisen (SUPERSCRIPT@, LIFE TECHNOLOGIES). Eine Reaktionsmischung mit Kotroll-Primern für G6PDH wurde eingesetzt um gleiche Bedingungen bei der Gel-Beladung, sowie die Effizienz der PCR-Reaktion zu demonstrieren


28

Tab. 1: Primer für RT-PCR ( Sequenzen, Loci und Basenpaarlänge der PCR-Produkte)
(nach Tanji et al. 1996)

Primer

Orientation

Sequence

Location

Product size (bp)

RARalpha

sense

GACTGTTTGCCTGCTCTTCT

529 - 1075

547

 

antisense

GGGTGCCTCTTTCTTCTTTT

 

 

RARbeta

sense

CCGAGGCAGGAGGGTCTA

2108 - 2509

327

 

antisense

CGTAGGCTGTTGGTCTTTTT

 

 

RARgamma

sense

CTCTCCCTCACCCCCACCA

543 - 1056

514

 

antisense

CCGCTTCGCAAACTCCACAA

 

 


29

Tab. 2: Patienten und Tumordaten

Patient

Pca Stage

PSA preop.

Glieson-Score

Operation

Alter
[Jahre]

B.B.

D2

79.8

8

TURP

77

L.W.

T1a

4.8

6

RP+BPLND

65

V.M.

T1a

5.8

5

RP+BPLND

67

P.A.

T1a

7.1

6

RP+BPLND

64

M.L.

T2a

4.7

5

PLND+RP

61

D.G.

D2

95.3

8

TURP

76

D.J.

T2a

6.6

5

RP+BPLND

63

M.J.

D1

12.8

8

TURP

72

B.R.

T2b

7.9

6

PLND+RP

62

D.I.

T1a

1.3

6

PLND+RP

61

R.L.

Benigne

2.0

 

 

61

V.A.

Benigne

1.1

 

 

59

F.A.

Benigne

1.5

 

 

55

L.W.

Benigne

0.5

 

 

61

W.J.

Blasenkarzinom

2.1

 

Radikale Zystectomie

70

K.J.

Bladderhemangiom

3.2

 

Radikale Zystektomie

72

V.N.

Benigne

1.07

 

 

66

J.G.

Benigne

 

 

 

65

G.L.

Benigne

3.3

 

TURP

71

W.A.

Benigne

1.1

 

 

67

T.G.

Blasenkarzinom

1.5

 

Radikale Zystektomie

61

F.R.

Blasenkarzinom

3.1

 

Radikale Zystektomie

70

TURP = Transurethrale Prostataresektion; PLND = Pelvine Lymphadenektomie; RP = Radikale Prostatektomie


30

3.8 WESTERN BLOTS MIT ANTIK_RPERN GEGEN RARalpha,RARbeta, RARgamma, und EGFR

Zellen in einer 25ml-Kulturflasche wurden in PBS gewaschen und in 1ml Protein-Lyse-Puffer (20mM Tris-HCl, 1mM EDTA, 1mM PMSF, 1%TritonX , 1µg/ ml Aprotinin, 1µg/ml Leupeptin (pH8.0) lysiert und als 0.1ml Aliquote bei -700C aufbewahrt. Die Proteinkonzentration wurde mittels BCA-Protein Assay (PIERCE@) entsprechend der Angaben des Herstellers gegen eine Verdünnunskurve von Rinder-Serum-Albumin (BSA-Standard, 2mg/ml Protein) bei 562nm spektrophotometrisch bestimmt. Für die Durchführung der Western Blots wurden 15µl Probe (=20µg Protein) mit dem gleichen Volumen an 2X Loading-Puffer vermischt (1X= 125mM Tris-HCl, pH6.8 mit 2% SDS, 5% Glycerol, 0.003% Bromphenylblau und 1% 1-Mercaptoethanol) und im Wasserbad für 5 Minuen gekocht. Die Probemischung wurde dann durch Elektrophorese für 1.5 Stunde bei 150V auf einem 7.5% SDS-PAGE-Minigel (BIORAD@) getrennt. Danach wurden die Proteine auf eine PVDF-Membran (BIORAD@) bei 45V für 4 Stunden transferiert.

Die Membran wurde mittels TBST -Puffer (10mM Tris-HCl, 150mM NaCl, 0.05% Tween, pH8.0) unter Zugabe von 3% bei 40C über Nacht geblockt.

Danach wurde die Membran mit TBST gewaschen und mit dem jeweiligen primären Antikörper für eine Stunde bei Raumtemperatur inkubiert. Dabei waren die Verdünnungen bei den verschedenen Antikörpern wie folgt:

Anti-RARalpha-Ab , Anti-RARbeta-Ab und Anti-RARgamma-Ab 1: 1000 in TBST.

Nach wiederholtem Waschen in TBST für 30 min. unter wiederholem Wechseln des Waschpuffers wurden die Membranen mit Anti-IgG/Peroxidase-Konjugat (1:1000 in TBST) für eine Stunde bei Raumtemperatur inkubiert. Nach wiederholtem Waschen in TBST für 45 Minuten erfolgte die Signal-Detektion durch Luminol-Luciferase (ECL-PLUS, AMERSHAM@) und Belichtung eines Kodak-XOMAT Films.


31

3.9 LIGANDEN-BINDUNGS-ASSAYS MIT [125I]-EGF und [125I]-IGF1

3.9.1 Zellmembran- Präparation

Membranfraktionen von Zellen wurden nach der von Wang et al. (1989) beschriebenen Methode isoliert. Dabei wurden die Zell-Pellets in 3 ml eiskaltem Homgenisierungspuffer (2.5mM Tris-HCl, 0.3M Sucrose und 1mM Phenylmethylsulfonylfluorid (PMSF), Aprotinin , 10µg/ml und Leupeptin 1µg/ml; pH 7.4) homogenisiert.

Die Homogenate wurden für 3 x 30 sec. bei 90% Gesamtintensität Ultraschall ausgesetzt (Fisher Sonic Dismembrater Model 300) und danach für 15 min. bei 600 x g bei 40C zentrifugiert. Die Überstände wurden mit 1/3 Volmen eines Puffers versetzt, der 0.4M NaCl, 0.8mM MgSO4, Aprotinin , 10µg/ml und Leupeptin 1µg/ml; pH 7.4 enthielt. Die Membranen wurden dann durch Zenrifugation bei 40,000 x g für eine Stunde in der Ultrazentrifuge (BECKMAN, Ti40-Rotor) als Pellet sedimentiert. Die Pellets wurden in Phosphat-Puffer (15mM NaH2PO4, 80mM Na2HPO4 Aprotinin , 10µg/ml und Leupeptin 1µg/ml; pH 7.4) resuspendiert und in Aliquoten bei -700C bis zur Verwendung aufbewahrt. Die Proteinkonzentration wurde mittels BCA-Protein Assay (PIERCE@) entsprechend der Angaben des Herstellers gegen eine Verdünnunskurve von Rinder-Serum-Albumin (BSA-Standard, 2mg/ml Protein) bei 562nm spektrophotometrisch bestimmt.

3.9.2 Liganden-Bindungs-Assays

Duplikate der oben beschriebenen Membranpräparationen enstsprechend 0.1 mg Protein wurden mit steigenden Konzentrationen von 125I-markiertem EGF (0-1000 nM) oder 125I-markiertem IGF1 (0-1000nM) in 0.2 ml Reaktionspuffer (5mM Tris-HCl, pH 7.0, 125mM Sucrose, 75mM NaCl, 0.5mM CaCl2 und 0.5% BSA) für 60 min. bei 250C inkubiert.

Die Reaktion wurde durch Zugabe von 1ml eiskaltem Waschpuffer (5mM Tris-HCl und 0.5% BSA, pH 7.0) gestoppt. Membrangebndenes [125I]-EGF oder [125I]-IGF1durch 4 min. Zentrifugation bei 14,000 rpm (Eppendorf Tischzentrifuge) bei 40C präzipitiert. Die Pellets wurden danach in 1ml Waschpuffer resuspendiert.


32

Die Intensität des gamma- Emissionssignals im gamma-Counter diente zur quantifizierung des membrangebundenen [125I]-Isotops. Die spezifische Bindung wurde durch Subtraktion der unspezifischen Bindung entsprechend der Signalintensität in Gegenwart eines 100fachen Überschusses an unmarkiertem EGF oder IGF1, von der totalen Bindung errechnet. Die Resultate wurden in fmol/ mg Protein ausgedrückt. Ein Scatchard-Plot erlaubte die Bestimmung der Art der Bindungskinetik.

3.10 IMMUNHISTOCHEMIE MIT ANTIK_RPERN GEGEN RARalpha, RARß, RARgamma und EGFR

Zellen: Zellen wurden auf Zellkulturgläser aufgetragen und propagiert. Nachdem 75-80% Konflenz erzielt war, wurden die Zellen mit 2% Paraformaldehyd in PBS (plus 0.1% Triton für intrazelluläre Antigene) für 20 min. bei 40C fixiert. Die fixierten Zellen wurden in PBS gewaschen und mit 1.5% H2O2 für 10 min. bei Raumtemperatur behandelt, um den Effekt unspezifischer Peroxidasen zu eliminieren. Die Zellen wurden dann für 30 min.mit 4% Serum in PBS/Triton (0.01%) geblockt und anschließend mit PBS (2 x 5 min.) gewaschen. Anschließend erfololgte die Inkubation mit dem primären Antikörper (polyklonal, Santa Cruz Biotech; Verdünnungen: 1:200 in 4% Serum/PBS unter Zusatz von 0.01% Triton) über Nacht (12 Stunden) in einer geschlossenen und befeuchteten Kammer. Danach wurden die fixierten Zellen mit PBS gewaschen (2x5min) und mit Biotin-markiertem Anti-Kaninchen-IgG (Sigma, 1:200 in PBS) für 30 min bei Raumtemperatur behandelt. Nach erneutem Waschen mit PBS (2x5 min) wurde Vectastain-Lösung A+B zugesetzr. Die immunhistochemische Erkennungsreaktion war eine Streptavidin-Biotin-Reaktion mit einem Meerrettichperoxidase-konjugierten sekundären Antikörper (Vectastain Elite ABC@) entsprechend den Angaben des Herstellers. Die Farbdetektion erfolgte durch Zugabe einer frisch zubereiteten 0.06%igen Diaminobenzidin-tetrahydrochlorid (DAB)-Lösung (Research genetics). Die Beurteilung der Immunfärbung erfolgte im Mikroskop mittels Vergleich mit positiven und negativen Kontrollen. Nach Waschen der Zellen in PBS erfolgte Gegenfärbung mit Hematoxylin und anschließend 0.1% Ammoniumhydrochlorid. Bei allen Versuchen wurden parallel negative Kontrollen durchgeführt, bei denen anstelle des primären Antikörpers Serum verwendet wurde.
Gewebsschnitte: Die Schnitte wurden in Xylen deparaffiniert und in einer alkoholischen Verdünnungsreihe fallender Konzentration (100-0%) hydriert. Danach wurden die Schnitte in 0.01M Natriumzitrat (pH 6.0) für 30 min. im Wasserbad gekocht und anschließend in PBS (2x5min) gewaschen. Die weitere immunhistochemische Aufarbeitung der Gewebsschnitte folgte dann im Wesentlichen dem oben angegebenen Protokoll.


33

3.11 DATENANALYSE UND STATISTISCHE AUSWERTUNG

Das primär verwendete statistische Modell war eine Ein-Weg -Varianzanalyse (ANOVA) um Unterschiede zwischen Gruppen zu unterscheiden. Die Daten wurden hinsichtlich Normalverteilung mittels SHAPIRO-WILK-W-Test untersucht. Die angewandten Kriterien zur

Unterscheidung zwischen signifikanten Unterschieden innerhalb der zu vergleichenden Gruppen wurde im Paarvergleich mittels Students`-T-Test (p<0.01) durchgeführt. Lag keine Normalverteilung vor wurde der WILCOXON-Test als nicht-parametrischer Test durchgeführt, um Unterschiede innerhalb der Vergleichsgruppen nachzuweisen. Die Berechnungen wurden mit Hilfe des JMP-Software Pakets ausgeführt.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiML DTD Version 2.0
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Fri Nov 1 13:35:56 2002