↓17 |
Arabidopsis thaliana (ecotype Columbia) was grown as described in (Emanuel, et al., 2005).
Recombinant plasmids were propagated in E. coli Top10 (Invitrogen); cells were grown in LB medium or on LB agar under standard conditions (Sambrook and Russell, 2001). Culturing of E. coli for recombinant protein expression is described elsewhere (II.5.2).
Genomic DNA was extracted from Arabidopsis leaf tissue using the CTAB method (Murray and Thompson, 1980).
↓18 |
Small-scale plasmid preparations were done following the alkaline lysis plasmid miniprep protocol (Sambrook and Russell, 2001); pPROTet.E derivatives were purified via QIAquick spin columns (QIAGEN) following plasmid isolation. Larger amounts of plasmid DNA were isolated from 100-ml cultures using the QIAGEN Plasmid Midi Kit (QIAGEN).
Total cellular RNA was extracted from leaves and flowers of Arabidopsis plants using TRIZOL (Invitrogen) according to the protocol provided by the manufacturer. The resulting RNA pellet was washed with 70% (v/v) ethanol, resuspended in ultrapure water and column-purified and DNase-treated using the NucleoSpin RNA plant kit (Macherey-Nagel).
Arabidopsis mRNA was enriched from total leaf RNA using the Poly(A)Purist™ Kit (Ambion).
↓19 |
The quality and quantity of nucleic acids were examined optically in ethidium bromide-stained agarose gels (see II.3.3.1 and II.3.3.2). Additionally, UV absorption at 260 nm by nucleic acid samples was measured in a GeneQuant II photometer (Amersham Biosciences), and concentrations were calculated assuming an optical density OD260=1 to correspond to 50 µg/ml double-stranded DNA or 40 µg/ml RNA.
DNA samples of 0.5 to 5 kbp in DNA loading buffer were separated on agarose gels containing 0.8–1.5% (w/v) agarose (Biozym) and 0.2 µg/ml ethidium bromide in 1x TAE buffer. For electrophoreses of 5’-RACE products, gels containing 1% agarose and 2% Nusieve agarose (Biozym) were prepared. Using 1x TAE as running buffer, electrophoreses were carried out at 5-10 V/cm in a horizontal electrophoresis chamber (PerfectBlue Gelsystem Mini S or Mini L, peqlab Biotechnologie GmbH). Lambda DNA (Fermentas GmbH) digested with BstEII or a 1 kb DNA ladder (Invitrogen) were used as molecular weight markers. Following separation, DNA molecules were visualized by UV transillumination employing a Gel Doc XR System (Bio-Rad).
DNA molecules subjected to preparative agarose gel electrophoreses and excised from gels were purified over QIAquick spin columns (QIAGEN).
↓20 |
1x TAE: |
40 mM Tris; 20 mM acetic acid; 1 mM EDTA |
DNA loading buffer: |
50% (v/v) glycerol; 1 mM EDTA; 0.005% (w/v) bromphenol blue; 0.005% (w/v) xylene cyanol |
1% (w/v) agarose gels for RNA analysis were prepared by melting agarose (Biozym) in ultrapure water supplemented with 10x MEN (1/10 of the final gel volume), and adding formaldehyde (1/40 of the final gel volume) after cooling the matrix to 60°C. RNA samples were supplemented with 1.6 volumes RNA loading buffer and incubated at 65°C for 5 min prior to loading. Using 1x MEN as running buffer, electrophoresis was carried out at 8 V/cm in a horizontal electrophoresis chamber (PerfectBlue Gelsystem Mini S, peqlab Biotechnologie GmbH). Separated RNA molecules were visualized by UV transillumination employing a Gel Doc XR System (Bio-Rad).
1x MEN: |
20 mM MOPS; 5 mM sodium acetate; 1 mM EDTA |
RNA loading buffer: |
500 µl formamide; 175 ml formaldehyde; 100 µl 10x MEN; 200 µl glycerol, 2.5 µl 0.5 M EDTA, pH 8.0; 5 µl ethidium bromide (10 mg/ml); 2 mg bromphenol blue; 2 mg xylene cyanol; ultrapure water ad 1 ml |
↓21 |
Denaturing PAGE was made use of to resolve products of in vitro capping analyses and in vitro-synthesized RNAs. Separation in 0.75-mm-thick 5% acrylamide gels was carried out utilizing a Protean II xi electrophoresis unit (Bio-Rad); a Model S2 Sequencing Gel Electrophoresis Apparatus (Biometra GmbH) was employed for high-resolution electrophoresis of in vitro-synthesized RNAs in 0.4-mm-thick 5% acrylamide sequencing gels. A radiolabelled RNA length standard was generated using the RNA Century Marker Template Plus (Ambion) and MAXIscript kit (Ambion) according to the manufacturer’s instructions and separated alongside RNA samples. Using 0.6x TBE as electrophoresis buffer, gels were run at 25 mA per gel (Protean II xi) or at 55 W (sequencing gels). Following a 10-min pre-run of gels, RNA samples dissolved in formamide buffer and denatured at 95°C for 5 min were loaded and electrophoresed for 2 h. Gels were then transferred on Whatman 3MM paper, dried on a Model 583 Gel Dryer (Bio-Rad) and subjected to autoradiography employing a phosphoimager (Molecular Imager FX, Bio-Rad).
1x TBE: |
90 mM Tris; 90 mM boric acid; 1 mM EDTA |
Acrylamide stock solution: |
Gel 40 (Roth) |
Gel composition: |
7 M urea and 5% acrylamide in 1x TBE |
DNA and DNA/protein complexes were resolved by native PAGE in 5% polyacrylamide gels at 4°C employing a Protean II xi electrophoresis unit (Bio-Rad) at 4°C; 0.5x TBE (see II.3.3.3) was used as electrophoresis buffer. Gels were pre-run at 200 V for 1-1.5 h prior to sample loading. DNA and DNA/protein complexes were separated at 15 mA per gel for 4-6 h; a dye marker was alongside samples to monitor migration.Gels were transferred on Whatman 3MM paper, dried on a Model 583 Gel Dryer (Bio-Rad) and subjected to autoradiography employing a phosphoimager (Molecular Imager FX, Bio-Rad).
↓22 |
Acrylamide stock solution: |
Gel 30 (Roth) |
Gel composition: |
5% acrylamide in 0.5x TBE |
Dye marker: |
0.6 M Tris/HCl, pH 6.8; 50% (v/v) glycerol; 0.4% (w/v) bromphenol blue |
cDNA was made from 1 µg mRNA-enriched Arabidopsis RNA employing the Omniscript RT kit (QIAGEN, Germany) according to the manufacturer’s instructions; 250 nmol of a random hexamer primer mixture (Fermentas) were used to prime first strand cDNA synthesis. Reactions were allowed to proceed at 42°C for 2 h.
Protein-coding sequences were amplified from Arabidopsis cDNA using Pfu DNA polymerase (Promega). PCR reactions were carried out in a volume of 50 µl in the appropriate buffer (Promega) with 2.5 U DNA polymerase, 10 pmol each of the forward and reverse primer, 10 µmol of each dNTP, and 0.5 µl of the cDNA synthesis reaction. Cycling conditions were as follows: 94°C/1 min; 35 cycles of 95°C/20 s, 58-62°C/20 s, 72°C/2 min per 1 kbp of amplicon length; 72°C/10 min. PCR was carried out in a Peltier Thermal Cycler PTC-200 (Biozym). PCR Products were analysed by agarose gel electrophoresis (II.3.3.1).
↓23 |
DNA fragments were amplified from genomic Arabidopsis DNA using Taq DNA polymerase (QIAGEN). Reactions contained 1 U DNA polymerase, 10 pmol each of the forward and reverse primer, 10 µmol of each dNTP, and 50 ng genomic DNA in 50 µl of the appropriate buffer. Cycling conditions were as follows: 94°C/1 min; 35 cycles of 95°C/20 s, 58-62°C/20 s, 72°C/1 min per 1 kbp of amplicon length; 72°C/6 min.
For colony PCR analysis of cloned DNA fragments, reactions were set up with 0.5 U Taq DNA polymerase (QIAGEN), 5 pmol each of the forward and reverse primer, 5 µmol of each dNTP and cells from a bacterial colony in 25 µl of the appropriate buffer; cycling was done as described above.
PCR Products were analyses by agarose gel electrophoresis (II.3.3.1).
↓24 |
Standard procedures for DNA manipulation such as restriction digests and ligations of DNA molecules were carried out according to (Sambrook and Russell, 2001). Restriction endonucleases, Shrimp Alkaline phosphatase and T4 DNA Ligase were obtained from Fermentas. The QIAGEN PCR Cloning Kit was used to directly ligate PCR products into the pDrive vector (QIAGEN).
Plasmid DNA was introduced into E. coli by electroporation (Dower, et al., 1988) using a Gene Pulser electroporation device (Bio-Rad). Transformants were selected on solid LB medium containing the appropriate antibiotics. If applicable, LB plates were supplemented with X-Gal for blue/white selection transformed TOP10 cells (Sambrook and Russell, 2001).
Sequencing reactions were set up using the ABI PRISM™ Big Dye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems) according to the manufacturer’s instructions. Reactions contained 300-400 ng plasmid DNA or 15-40 ng PCR fragment and 5-10 pmol primer (see Table 1 for oligonucleotides used as sequencing primers). Cycle sequencing, product purification and product analysis on an ABI 377 automatic DNA Sequencer (Applied Biosystems) were carried out by M. Meixner (DLMBC, Rüdersdorf).
↓25 |
Table 1: Oligonucleotides used for sequencing.
Primer |
Sequence (5’ → 3’) |
Target |
metA-seq1m |
CAACCACGAGATCAAAGTG |
MetA |
metA-seq2p |
AGCTAGATAAGCGTATGGTGG |
|
metA-seq3p |
CTTGGTTCCATGTTTAGGC |
|
metB-seq1m |
TCCTGACAACGGAAGAATC |
MetB |
metB-seq2p |
TCTACTGCCGTCTCTCTGTC |
|
RpoT1-522R |
AACCAGCCTAGAAACAAAGAC |
RpoTm |
Y2 |
GTCGCATTGGTGGTCTGG |
|
Y6 |
AGGTCGGATGTCAGGTGG |
|
Y11 |
CAGAAGCCTTGAGAAGCCCC |
|
Y15 |
AATTGCTTTTTTGGATTCCC |
|
RpoT1-2400F |
AAGCTGCAAGAGCTATCAAG |
|
T2-621R |
GCAGATTAGGCGCAAGC |
RpoTmp |
T2-850R |
GGACATCAGGCAGATCATT |
|
3cF1 |
CAACAGATGTTGAGGAAGAGCC |
|
3cF2 |
AAAAGGGGATGACAATGAGG |
|
3cR1 |
CATTCACCAAACCAACGC |
|
3cR2 |
CAGCCACCATCTGCTTCC |
|
RpoT2-2560F |
TTTGGTGAATGTGCGAAG |
|
M13-seq-F |
ACGACGTTGTAAAACGACGG |
pDrive, pKL23 |
M13-seq-R |
TTCACACAGGAAACAGCTATGAC |
|
pPROTet-seqF |
TCATTAAAGAGGAGAAAGGTACCC |
pPROTet.E |
pPROTet-seqR |
CCATGGGTACCTTTCTCCTCT |
|
pBAD-rev |
GATTTAATCTGTATCAGG |
pBAD/Thio-TOPO |
gfp-seq3 |
GCCAAGGAACAGGTAGTT |
pOL−GFP S65C |
Mitochondrial transcript 5’ termini were determined employing a 5’-RACE technique described by (Bensing, et al., 1996) with the following modifications. 5’ triphosphates were converted to monophosphates by treating 5 µg RNA with 10 U of tobacco acid pyrophosphatase (Epicentre)
at 37°C for 1 h in the presence of 40 U of RNase inhibitor (Fermentas) in the appropriate
buffer. Control reactions were set up without pyrophosphatase. The RNA was subsequently
extracted with phenol/chloroform/isoamyl alcohol (25:24:1), precipitated from the aqueous
phase by adding 3 volumes of ethanol/3 M sodium acetate, pH 5.2 (30:1) and dissolved in
ultrapure water. The RNA was then supplemented with 10 pmol 5’ RNA adapter A3
[5’-GAUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA-3’, (Argaman, et al., 2001)], and the ligation of transcripts to the adapter was performed at 37°C for 1 h with 50 U of T4 RNA ligase (Epicentre Technologies) in the presence of 1 mM ATP and 80 U of RNase inhibitor (Fermentas) in the appropriate buffer. Control reactions were set up without adding the adapter. Following the ligation, the RNA was extracted with phenol/chloroform/isoamyl alcohol (25:24:1), precipitated by adding 3 volumes of ethanol/3 M sodium acetate, pH 5.2 (30:1), dissolved in ultrapure water and then reverse-transcribed using gene-specific primers and Omniscript RT kit (QIAGEN) according to the protocol provided by the manufacturer; reactions were allowed to proceed
for 2 h at 42°C. The products of reverse transcription were amplified in a first PCR step
by using 1 to 3 µl of the RT reaction, 5 pmol of each adapter-specific forward primer P1a
(5’-CGAATTCCTGTAGAACGAACACTAGAAG-3’) and gene-specific reverse primer, 200 µM of each dNTP and 0.5 U of Taq DNA polymerase (QIAGEN) in 25 µl of the appropriate buffer. Cycling conditions: 94°C/1 min; 35 cycles of 95°C/20 s, 58-62°C/20 s, 72°C/2 min; 72°C/10 min. 0.1 to 1 µl of the first PCR reaction were used as template for subsequent nested PCRs set up essentially as the first PCR in a volume of 50 µl with 10 pmol of each gene-specific and adapter-specific primer. Gene-specific primers were repeatedly placed upstream of identified transcriptional starts, until no 5’-RACE products reaching further upstream could be detected. PCR reactions were analysed by agarose gel electrophoresis. Products of interest were excised and ligated into pDrive (QIAGEN); ligation products were transformed into E. coli TOP10 (Invitrogen). Bacterial clones containing the plasmid insert were identified by colony PCR using primers M13-seq-F and M13-seq-R. Colony PCR reactions were set up and performed essentially as the first PCR of the 5’-RACE protocol, and PCR products were purified over QIAquick spin columns (QIAGEN) and sequenced.
Oligonucleotides listed in Table 2 were used as reverse primers in 5’-RACE experiments for reverse transcription (application “A”), the first RACE PCR (“B”) or subsequent nested PCRs (“C”).
↓26 |
Table 2: mtDNA-specific primers used for 5’-RACE.
Primer |
Gene/ RNA |
Sequence (5’ → 3’) |
Application |
Detected start site |
P2rrn18 |
rrn18 |
CGAGAACAACGTTCGAC |
A | |
P3rrn18-b |
GCCCTGCAGTGGTAGAACCTC |
B | ||
P4rrn18-b |
TCGTGAACCGGGCGTACTAC |
C |
Prrn18-69 |
|
Prrn18-156 |
||||
P5rrn18 |
TTCTATCAATCGATAAGCAAGGGTAGG |
C |
Prrn18-353 |
|
Prrn18-424 |
||||
P7rrn18 |
TTATATACCGAGGATTTGATGAAATACCA |
C |
- |
|
P2rrn26 |
rrn26 |
AGTGCGCTTGACTACTCCT |
A | |
P3rrn26 |
TGATTGTTCGCATCGGATCTC |
B | ||
P4rrn26-b |
TCACGGTACTTGTACGCTATCGG |
C |
- |
|
P5rrn26 |
CCGCTCACAGAAGGATTTACAGTC |
C |
Prrn26-893 |
|
P6rrn26 |
GAGGGATGCAATAACTCGACTGTG |
C |
- |
|
P7rrn26 |
TATCCGAAACATTTTTGAACTGCC |
C |
- |
|
P2met |
tRNA-fMet |
CCGCTTCTTCTCTTCTACAAG |
A | |
P3met |
TTCTAGAGACAAACGACCGATTGAA |
B | ||
P4met |
AGACAAACGACCGATTGAACTACAA |
C |
PtrnM-98 |
|
P5met |
TCAAAAGAAAGAAGTAGAGTCGTTGGAC |
C |
PtrnM-547 |
|
P7met |
GTGGAAACAACTCCCTTAGCCTTAG |
C |
- |
|
P2rps3 |
rps3 |
GCCCTCACTGAACCGACT |
A | |
P3rps3 |
GAACCGACTTGAATCTGAACTACGA |
B | ||
P4rps3 |
TTTTTGACTTTATGGATTTCTGTCCCT |
C |
- |
|
P7rps3 |
AGATAGAAATGATAGAGGGCCAACC |
C |
Prps3-1053 |
|
Prps3-1133 |
||||
P8rps3 |
AGCTAACGTAAGAACTGGAAGAGTCTTG |
C |
- |
|
P2atp1 |
atp1 |
TATATGGATTCGGGCTGC |
A | |
P3atp1 |
GAAGTAGCGCGAGAAGGTACGA |
B | ||
P4atp1 |
CGATACCAGTTGGGCGAACA |
C |
- |
|
P5atp1 |
AGTAGACGGAACGACACCTGTGA |
C |
Patp1-1898 |
|
P6atp1 |
GGCTACTTTCTTTCTTCTCTTATGAAATTG |
C |
Patp1-1947 |
|
P7atp1 |
ATACCACCAGATGTGCCCCTT |
C |
- |
|
P8atp1 |
TCCTTTTCTTTTTGAGCAGATGTTG |
C |
- |
|
P2atp6-1 |
atp6-1 |
GGGATCTTGCGTTAATGC |
A | |
P3atp6-1 |
GATCTTGCGTTAATGCCTCACAC |
B | ||
P4atp6-1b |
CAAACAAAAAGATTCGTCGCATATTG |
C |
Patp6-1-156 |
|
Patp6-1-200 |
||||
P6atp6-1 |
GATTTGGAAGGGCAAGATAGACC |
C |
- |
|
P7atp6-1 |
CGGTTCATCGCCTTACTTATCCA |
C |
Patp6-1-916/913 |
|
P8atp6-1 |
CCTAATCAAGCAGAACGCCACT |
C |
- |
|
P9atp6-1 |
GCCCTCAGCAGCTCGAATAC |
C |
- |
|
P2atp6-2 |
atp6-2 |
AAGTGATTCAACCGGGTTA |
A | |
P3atp6-2 |
GAATAGGCACTCCTGGCAGAAC |
B | ||
P4atp6-2 |
AGATTTGGCTTTTGAGGCATGA |
C |
Patp6-2-148 |
|
Patp6-2-436 |
||||
Patp6-2-507 |
||||
P6atp6-2 |
GAGTAGCAAAGATGACAGCACGC |
C |
- |
|
P6atp6-2b |
CGCACAAACATATCCGACTCGTA |
C |
- |
|
P2atp8 |
orfB |
AAACTGTTGGGGTCCTTG |
A | |
P3atp8 |
TGTGAAAGCAGTTGGTTCCGTAG |
B | ||
P2atp8 |
AAACTGTTGGGGTCCTTG |
A | ||
P3atp8 |
TGTGAAAGCAGTTGGTTCCGTAG |
B | ||
P4atp8 |
AGAAAGTAAAGAAGAAAAGGCATAACCAG |
C |
Patp8-157 |
|
Patp8-228 |
||||
P6atp8 |
TCGTTAGAAGAAGATGAGCTGCCT |
C |
- |
|
P7atp8 |
CAGCCCGGATCACCAGCTA |
C |
Patp8-710 |
|
P8atp8 |
ACCAGCAGAATTAGATGAACGAGC |
C |
Patp8-999 |
|
P9atp8 |
GGGTCTTTAGAGGACTATGCCAAGT |
C |
- |
|
P2atp9-c |
atp9 |
TGCAATAGCTTCGGTTAGAG |
A | |
P3atp9-b |
TTTAGCCAATGATGGATTTCGC |
B | ||
P4atp9-a |
GACTGAAGACCAACTGAATCTCGAC |
C |
Patp9-239 |
|
Patp9-295 |
||||
P5atp9 |
TTATATACGAGAGCACCAGATACACCA |
C |
Patp9-487 |
|
Patp9-652 |
||||
P7atp9 |
GAAGATCAAGTTACTCGGCTAGACCA |
C |
- |
|
P2cox1 |
cox1 |
TGTGCCCATCACTCCAG |
A | |
P3cox1 |
ACCGAAAATGAAATAGAGAGTCCCT |
B | ||
P4cox1 |
TGTGGTTTGTGGAGAACAGCC |
C |
- |
|
P5cox1-b |
ATCGTCCTACAAAAGATAATGCTCTCAC |
C |
Pcox1-355 |
|
P6cox1 |
GCCACATTTCATACACTTTAGGCA |
C |
- |
|
P7cox1 |
CCAGCAGCTACAACCAAGTCAG |
C |
- |
|
P2cox2-c |
cox2 |
CCGAAGAATCTCGATAGTAG |
A | |
P3cox2 |
GTAGCTGCGTCTTGAGATCCTAATTG |
B | ||
P3cox2-d |
TTCTTCTTCTTCTTACAATATTTTGAGTTAGATG |
C |
Pcox2-210 |
|
P5cox2-d |
CGAAACCAACATCCTTATAATACTACTAGGC |
C |
Pcox2-481 |
|
P7cox2 |
CATTAGATAGCTAATTATCCTTTGCCTAGC |
C |
Pcox2-683 |
|
P8cox2 |
GGTAGGGCTCTGTTTCAGGTCTTG |
C |
- |
|
P9cox2 |
ATGGCTGGTTGAGGTTAGAATTTC |
C |
- |
|
P2cox2-c |
orf291 |
CCGAAGAATCTCGATAGTAG |
A | |
P3cox2 |
GTAGCTGCGTCTTGAGATCCTAATTG |
B | ||
P4cox2 |
CAAGGAGAAATTGTGAGGAATAACCA |
C |
Porf291-307 |
|
P2nad1-int-a |
nad1-AS |
AGTTGCGATGCGAACAG |
A |
- |
P3nad1-int-a |
GAGTAGACTTGCCTGAGTTGTCTGC |
B |
- |
|
P4nad1-int-a |
TTCATTTTCTTTTAGTTGCGGTAGC |
C |
P1nad1-AS |
|
P2nad1-int-b |
GCATCGCGATAAGTCCTC |
A |
- |
|
P3nad1-int-b |
GCAATATTCACCCTAGCCCACAA |
B |
- |
|
P4nad1-int-b |
GCCGAATATAATCCTCAAGTACTCCA |
C |
P2nad1-AS |
|
P2nad4-int |
nad4-AS |
TTGTAGGTGCTTGCGATG |
A |
- |
P3nad4-int |
AGTTGGTTTGGGTGGCATAGC |
B |
- |
|
P4nad4-int |
TAGCCCGTTGCATAAGTCCC |
C |
P1nad4-AS |
|
P2nad4-AS |
||||
P2nad5-int |
nad5-AS |
CCCGACTCTACGAACCC |
A |
- |
P3nad5-int |
CCCGAGGAAAGGCTGCAC |
B |
- |
|
P4nad5-int |
CAGTAGTAAGGGCGTTAAGACCGA |
C |
Pnad5-AS |
|
P2nad2-int |
nad2-AS |
TTTGTATTATAAGTGATCCGAACC |
A |
- |
P3nad2-int |
CCAAGTTGGTGAGCCGTATGAT |
B |
- |
|
P4nad2-int |
CGGTTTGGAGAGGACTCAGC |
C |
Pnad2-AS |
|
P2nad7-int |
nad7-AS |
CTTTGCCGAGAGATAGGAG |
A |
- |
P3nad7-int |
CTTTGAGAACTGTGTGAACGGAGAG |
B |
- |
|
P4nad7-int |
GAATGGGTCGAGATAGATGACAGC |
C |
Pnad7-AS |
|
P2mot3-38K |
NC |
CGAGGGTTCAATTCAGTG |
A |
- |
P3mot3-38K |
AATAGCTAGATACTCTGCGGGACCTC |
B |
- |
|
P4mot3-38K |
TCTTTCTAATTAATCGTTTTACCGGGAATAC |
C |
P38K-nc |
|
P2-203K |
NC |
GGTGCTTTCAGGAACTGG |
A |
- |
P3-203K |
GGAGACGGGCTATGTAGGCTG |
B |
- |
|
P4mot2-203K |
AAAGAAGGAAAGGATAGTATTCGGTGG |
C |
P203K-nc |
Sequences of upstream regions of the mitochondrial genes atp1, atp6-1, atp6-2, atp9, cox2, rrn18 and rrn26 were amplified from total Arabidopsis DNA with primer pairs listed in Table 3, and ligated into pDrive (QIAGEN) in the appropriate orientation to yield templates for complementary RNA (cRNA) synthesis (Table 3). Riboprobes were generated through in vitro transcription of antisense strands of the cloned gene fragments by T7 RNA polymerase and a subsequent DNase digest using the MAXIscript kit (Ambion). Transcripts were then extracted with phenol/chloroform/isoamyl alcohol (25:24:1), precipitated from the aqueous phase by adding 3 volumes of ethanol/3 M sodium acetate, pH 5.2 (30:1), and dissolved in ultrapure water. See Figure 6 for target sequences of riboprobes.
↓27 |
Table 3: Primers used for cRNA synthesis template construction.
Primer pair |
Primer sequences (5’ → 3’) |
cRNA synthesis template |
Cap-atp1-F |
GCTAGGCTGGCACTTAGGA TGATAGGTTTATTTCGCACTTTAG |
pCRNA-atp1 |
Cap-atp1-R |
||
Cap-atp6-1-F |
CACCGCACGAGTCAGACCT TCCAGACAGCTTCACTCCGTC |
pCRNA-atp6-1 |
Cap-atp6-1-R |
||
Cap-atp6-2-Fb |
CGTGTTCCGTCGATCAC CTTACGTCAAGCCTCTAGGAGT |
pCRNA-atp6-2b |
Cap-atp6-2-Rb |
||
Cap-atp9-Fb |
TTGGGATAAGTGAAATCGTAT CGACAAAGAGAAGTACAAGC |
pCRNA-atp9-b |
Cap-atp9-Rb |
||
Cap-cox2-F |
TGCCTTGCCTTACCACACC |
pCRNA-cox2 |
P3cox-d |
see Table 2 |
|
Cap-rrn18-F |
GAGACCGATCCAGGAACCCTAC |
pCRNA-rrn18 |
P4rrn18-b |
see Table 2 |
|
Cap-rrn26-F |
AAAGGCGTTATTGCTGTGCT TTTTCAACTCGTAAAGGCAAAGA |
pCRNA-rrn26 |
Cap-rrn26-R |
In vitro capping reactions were set up in a volume of 20 µl with 20 µg of total RNA isolated from flowers and 5 U guanylyltransferase (Ambion) in the appropriate buffer in the presence of 130 µM S-adenosyl methionine, 2.5 U RNase inhibitor (Fermentas), 100 µCi [α-32P]-GTP (3000 Ci/mmol), and were incubated at 37°C for 75 min. After 30 min, another 7.5 U of guanylyltransferase were added. The RNA was purified with 2 volumes of ultrapure water, 4 volumes of TRIzol (Invitrogen) and 0.8 volumes of chloroform, precipitated from the aqueous phase by adding 0.8 volumes of isopropanol and washed twice with 70% ethanol. Transcripts were then dissolved in 30 µl hybridization buffer (Roche) together with 0.5 µg of complementary riboprobe and subjected to ribonuclease protection using the RNase Protection Kit (Roche) according to the protocol provided by the manufacturer, except that hybridizations were carried out overnight at 45°C (rrn18, rrn26) or 65°C (all other genes). Protected transcripts were dissolved in formamide loading buffer provided with the kit and separated in 5% polyacrylamide gels (II.3.3.3).
Protein concentrations of bacterial lysates and lysate fractions were compared to a BSA standard as described by (Bradford, 1976) using the Bio-Rad Protein Assay. Concentrations of distinct proteins were approximated by comparison to defined BSA amounts in Coomassie-stained polyacrylamide gels.
↓28 |
For total protein analysis, cells pelleted from 200 µl aliquots of E. coli cultures were lysed in 40 µl 1x sample buffer at 95°C for 5min. Following centrifugation, an appropriate aliquot of the supernatant was subjected to SDS PAGE. Bacterial lysates and lysate fractions in 1x sample buffer were similarly prepared.
Protein separation by SDS PAGE was carried out according to (Laemmli, 1970) in a Hoefer Mighty Small Vertical Electrophoresis Unit. Electrophoresis was allowed to proceed at 200 V for 1-1.5 h; a protein molecular weight marker (#0661 or #SM671, Fermentas) was run alongside samples. Following electrophoresis, gels were Coomassie-stained or subjected to Western blotting.
4x sample buffer: |
0.32 M Tris/HCl pH 6.8, 0.1 M EDTA, 0.4 M DTT, 8% (w/v) SDS, 4% (v/v) glycerol, 0.2 % (w/v) bromphenol blue |
Acrylamide stock solution: |
Gel 30 (Roth) |
Separating gel: |
8% or 10% acrylamide, 375 mM Tris/HCl pH 8.8, 0.1% (w/v) SDS |
Stacking gel: |
4% acrylamide, 125 mM Tris/HCl pH 6.8, 0.1% (w/v) SDS |
Electrophoresis buffer: |
25 mM Tris, 192 mM glycin, 0.1% (w/v) SDS |
Coomassie staining solution |
0.1% (w/v) Coomassie Brilliant Blue R250 in destaining solution |
Destaining solution: |
0.25 % (v/v) isopropanol, 0.1 % (v/v) acetic acid |
↓29 |
Protein patterns resolved by SDS-PAGE were transferred onto nitrocellulose membranes (Hybond-C extra, Amersham Biosciences) by electrotransfer in a Semi Dry Blot chamber (Bio-Rad). Following PAGE, gels were incubated in transfer buffer for 10 min. Whatman 3MM paper and the membrane were preincubated in transfer buffer. The anode plate was overlaid with 4 layers of 3MM paper, followed by the membrane, the gel, and 4 layers of 3MM paper. Electrotransfer was allowed to proceed at 20 V for 1 h.
Membranes were subsequently blocked for 2 h in TBS containing 3% (w/v) BSA, washed 4x
10 min in TBST, incubated with the primary antibody diluted in TBST (Table 4) for 1.5 h, washed 4x 10 min in TBST, incubated with the secondary antibody diluted in TBST (Table 4) for 1 h, washed 4x 10 min in TBST and then 10 min in TBS, and rinsed 3x 1 min in AP buffer. Immunodetection using alkaline phosphatase was initiated by exposure of membranes to AP sustrate solution; appropriately developed membranes were washed in water to stop the enzymatic reaction.
Transfer buffer: |
48 mM Tris, 39 mM glycin, 20% (v/v) methanol, 0.0375% (w/v) SDS |
TBS: |
10 mM Tris/HCl pH 7.5, 0.2% (w/v) SDS |
TBST-BSA: |
1% (w/v) BSA in TBST |
TBST: |
0.05 % (v/v) Tween 20 in TBS |
AP buffer: |
100 mM Tris/HCl pH 9.5, 100 mM NaCl, 5 mM MgCl2 |
AP substrate solution |
0.033% (w/v) NBT, 0.0165% (w/v) BCIP in AP buffer |
↓30 |
Antibody |
Properties |
Dilution |
Reference |
anti-Thio |
Mouse IgG, raised against thioredoxin |
1:5000 |
Invitrogen |
anti-His |
Mouse IgG, raised against a polyhistidine-tagged protein |
1:5000 |
Sigma |
anti-RpoT |
Rabbit IgG, raised against the C-terminal portion (amino acids 663-976) of RpoTm from Arabidopsis |
1:3000 |
A. Weihe, HU Berlin |
Secondary antibody |
Anti-rabbit IgG-alkaline phosphatase conjugate |
1:5000 |
Sigma |
Secondary antibody |
Anti-mouse IgG-alkaline phosphatase conjugate |
1:5000 |
Sigma |
Sequences encoding amino acids 43-976 of RpoTm (locus tag At1g68990) and amino acids 105-1011 of RpoTmp (locus tag At5g15700) were amplified from reverse-transcribed mRNA-enriched Arabidopsis RNA using primer pairs His-RpoTm-42P/pBAD-Yrev and His-RpoTmp-104P/pBAD-3rev, respectively. PCR products were ligated into pBAD/Thio-TOPO (Invitrogen) to yield plasmids pBAD/Thio-HisRpoTm and pBAD/Thio-HisRpoTmp encoding thioredoxin (Trx)-hexahistidine-tagged RpoTm and RpoTmp.
Additional constructs were generated for the expression of untagged RpoTm and RpoTmp. Equimolar amounts of oligonucleotides duet-Linker1-Fw and duet-Linker1-Rev in Taq buffer (QIAGEN) were allowed to anneal at room temperature following incubation at 95°C for 5 min. The double-stranded fragment having Acc651/Pst1 overhangs was used to replace an Acc651/Pst fragment excised from pPROTet.E121 (Clontech). The excised fragment precedes the multicloning site in pPROTet.E121 and encodes a hexahistidine tag. The resulting vector designated pPROL1 directs the expression of essentially untagged recombinant proteins. To generate pPROL1-RpoTm and pPROL1-RpoTmp, the previously cloned RpoTm and RpoTmp coding sequences were amplified from pBAD/Thio-HisRpoTm and pBAD/Thio-HisRpoTmp using primer pairs Duet-T1-F/Duet-T1-R and
Duet-T2-104-F/Duet-T2-R, respectively. Following ligation into pDrive and control of PCR products by sequencing, RpoTm and RpoTmp sequences were excised and ligated into pPROL1 via the PstI/PvuI and BamHI/PvuI sites, respectively.
↓31 |
Sequences encoding amino acids 26-380 of MetA (locus tag At5g66360) and amino acids 18-353 of MetB (locus tag At2g47420) were amplified from reverse-transcribed mRNA-enriched Arabidopsis RNA using primer pairs MetA-PROP/MetA-PROM and MetB-PROP/MetB-PROM, respectively. PCR products were NotI/SalI-digested and ligated into the NotI/SalI-cleaved vector pPROTet.E121 to generate plasmids pPRO-MetA and pPRO-MetB.
Plasmids constructed for recombinant protein expression and oligonucleotides employed for plasmid construction are listed in Table 5.
Table 5: Oligonucleotides used to construct plasmids driving recombinant protein expression.
Sequence (5’ → 3’) |
Plasmid |
|
His-RpoTm-42P |
catcatcatcatcatcatGGCGTTAGAAATGGTTTATCTATAA TGCAGCTCAGTTGAAGAAGTATG |
pBAD/Thio-HisRpoTm |
pBAD-Yrev |
||
His-RpoTmp-104P |
catcatcatcatcatcacGAGTTTTCCAAGAGCGAGAG TCAGTTGAAGAAATAAGGTGAATC |
pBAD/Thio-HisRpoTmp |
pBAD-3rev |
||
duet -Linker1-Fw |
GTACCCATGGGTGTGGCAGGCGGGGGCGGATCCCTGCA GGGATCCGCCCCCGCCTGCCACACCCATGG |
pPROL1 |
duet -Linker1-Rev |
||
Duet-T1-F |
gctgcagGGCGTTAGAAATGGTTTATCTATAA gcgatcgGCAGCTCAGTTGAAGAAGTATGT |
pPROL1-RpoTm |
Duet-T1-R |
||
Duet-T2-104-F |
gggatccGAGTTTTCCAAGAGCGAGAG gcgatcgTCAGTTGAAGAAATAAGGTGAATC |
pPROL1-RpoTmp |
Duet-T2-R |
||
MetA-PROP |
cagcgtcgacCGAGATTCTCACTCGCAGGC cagcgcggccgcTTATTCGTGTAGATCCATTTGTAATGATG |
pPRO-MetA |
MetA-PROM |
||
MetB-PROP |
cagcgtcgacTCGAACCATTACCAAGGAGGAATAT cagcgcggccgcACACCACAAAACGATTATGTGAAGTG |
pPRO-MetB |
MetB-PROM |
↓32 |
RpoTm and RpoTmp were overexpressed from pBAD/Thio-HisRpoTm and pBAD/Thio-HisRpoTmp in E. coli strain BL21 Codon Plus RIL (Stratagene). 2.5 ml of an overnight culture grown under standard conditions in LB medium supplemented with 100 µg/ml Ampicillin and 30 µg/ml Chloramphenicol were used to inoculate 250 ml fresh LB medium containing 100 µg/ml Ampicillin. Cultures were grown under standard conditions; recombinant protein expression was induced at OD600~0.8 by adding 0.02% (w/v) arabinose, and cells were cultured at 18°C for 20 h until harvest by centrifugation (10 min, 6000xg, 4°C) in a Megafuge 1.0 R (Heraeus).
Strain E. coli BL21PRO (Clontech) was employed to overexpress MetA and MetB from pPRO-MetA and pPRO-MetB. 2.5 ml of an overnight culture grown under standard conditions in LB medium containing 34 µg/ml Chloramphenicol and 50 µg/ml Spectinomycin were used to inoculate 250 ml fresh LB medium supplemented with the same antibiotics. Cultures were grown under standard conditions; recombinant protein expression was induced at OD600~0.8 by adding 80 ng/ml anhydrotetracycline, and cells were cultured at 18°C for 6 h (MetA expression) or 20 h (MetB) until harvest by centrifugation (10 min, 6000xg, 4°C) in a Megafuge 1.0 R (Heraeus).
Expression of RpoTm and RpoTmp in E. coli BL21PRO harbouring pPROL1-RpoTm and pPROL1-RpoTmp, respectively, was monitored in 3-ml cultures over 20 h following induction; the above described protocol was downscaled accordingly.
↓33 |
200-µl aliquots of cultures were pelleted and subjected to SDS-PAGE analysis (II.4.2) of recombinant protein expression.
Recombinant RpoTm was prepared from 300 ml of cell culture; RpoTmp was prepared from a culture volume of 150 ml. Unless indicated otherwise, centrifugations were done in a in a Megafuge 1.0 R (Heraeus) or in a Biofuge fresco (Heraeus). Harvested cells were resuspended 300 ml (RpoTm) or 150 ml (RpoTmp) buffer A1, recentrifuged and resuspended in 7.5 ml buffer A2 and distributed over 10 2-ml microcentrifuge tubes containing ~1 g glass beads (∅ 0.17-0.18 mm) each. Cells were broken by shaking in a bead mill (Retsch) at maximum frequency (10 min, 4°C). The bacterial lysate was cleared by centrifugation (10 min, 6000xg, 4°C) and transferred into a fresh 15-ml polypropylene tube. Beads were twice washed in ~300 µl buffer A2 per tube by additional grinding (5 min) and centrifugation. Soluble fractions obtained from all extraction steps were pooled to obtain 12-15 ml of bacterial lysate and recentrifuged (10 min, 6000xg, 4°C). The lysate and 0.5 ml (bed volume) Ni2+-NTA-agarose (QIAGEN) equilibrated with buffer A1 were distributed over 3 15-ml polypropylene tubes and incubated horizontally while slowly rocking (15 h, 70 rpm, 4°C) to allow proteins to bind to the matrix. Subsequently, unbound proteins were removed by centrifugation (2 min, 1000xg, 4°C) and removal of the supernatant. The matrix was then washed by agitation in 6 ml buffer A3, recentrifuged, resuspended in 3 ml buffer A3, and the slurry was transferred into a 1-ml polypropylene column (QIAGEN). The settled matrix was washed with 3x 2 ml buffer A4. Proteins were then eluted with 3x 1 ml buffer AE. The volume of the eluate was brought to 1 ml by centrifugation (9000xg, 4°C) in 10000-MWCO centrifugal filter devices (Millipore) in a Sorvall RC-5B centrifuge/rotor SS-34 (DuPont) and dialyzed for 15 h at 4°C against buffer AD. Aliquots of dialyzed protein were stored at
-20°C for use within 6 weeks. Protein preparations were analysed by SDS-PAGE; a molecular weight of 117 kDa was assumed for recombinant RpoTm and RpoTmp to approximate the molar concentration of proteins in protein preparations.
Buffer A1: |
100 mM Tris/HCl, pH 7.8; 300 mM NaCl; 5 mM imidazole |
Buffer A2: |
Buffer A1 supplemented with 1 mM PMSF, 1 mM benzamidine, |
Buffer A3: |
20 mM Tris/HCl, pH 7.0; 300 mM NaCl; 5 mM imidazole |
Buffer A4: |
20 mM Tris/HCl pH 7.0; 300 mM NaCl; 10 mM imidazole |
Buffer AE: |
20 mM Tris/HCl pH 7.0; 300 mM NaCl; 10 mM imidazole |
Buffer AD: |
20 mM Tris/HCl, pH 7.8, 100 mM NaCl, 0.5 mM EDTA, |
↓34 |
Enterokinase digest reactions were allowed to proceed for 15 h at 4°C in a volume of 600 µl containing 1.5 U Enterokinase (Invitrogen) and 120 µg of Ni2+-NTA agarose-purified protein in EKMax buffer (Invitrogen). To remove enterokinase from the digest, EK-Away (Invitrogen) was used as recommended by the manufacturer.
All centrifugations were done in a in a Megafuge 1.0 R (Heraeus) or in a Biofuge fresco (Heraeus). Cells harvested from 150 ml culture volume were resuspended in 150 ml buffer B1, recentrifuged and resuspended in 5 ml buffer B2. Cells were broken as described in II.5.3.1 to obtain 6-8 ml of bacterial lysate, which was cleared by centrifugation (10 min, 6000xg, 4°C). The lysate and 0.15 ml (bed volume) Ni2+-NTA-agarose (QIAGEN) equilibrated with buffer B1 were distributed over 2 15-ml polypropylene tubes and incubated horizontally while slowly rocking (15 h, 70 rpm, 4°C) to allow proteins to bind to the matrix. Subsequently, unbound proteins were removed by centrifugation (2 min, 1000xg, 4°C) and removal of the supernatant. The matrix was then washed by agitation in 4 ml buffer B3, recentrifuged, resuspended in 2 ml buffer B3, and the slurry was transferred into a 1-ml polypropylene column (QIAGEN). The settled matrix was washed with 3x 1 ml buffer B4 and 3x 0.3 ml buffer B5. Proteins were then eluted with 3x 0.3 ml buffer BE. The eluate was concentrated as described to obtain 0.4 ml and dialyzed for 15 h at 4°C against buffer BD. Aliquots of dialyzed protein were stored at -20°C for use within 6 weeks. Protein preparations were analysed by SDS-PAGE; a molecular weight of 43 and 41 kDa was assumed for recombinant MetA and MetB, respectively, to approximate the molar concentration of proteins in protein preparations.
Buffer B1: |
100 mM Tris/HCl, pH 7.8; 500 mM NaCl; 10 mM imidazole |
Buffer B2: |
Buffer B1 supplemented with 1 mM PMSF, 1 mM benzamidine, |
Buffer B3: |
20 mM Tris/HCl, pH 7.0; 500 mM NaCl; 10 mM imidazole |
Buffer B4: |
20 mM Tris/HCl, pH 7.0; 500 mM NaCl; 20 mM imidazole |
Buffer B5: |
20 mM Tris/HCl, pH 7.0; 500 mM NaCl; 40 mM imidazole |
Buffer BE: |
20 mM Tris/HCl, pH 7.0; 500 mM NaCl; 200 mM imidazole |
Buffer BD: |
20 mM Tris/HCl, pH 7.8, 50 mM NaCl; 0.5 mM EDTA; |
↓35 |
Arabidopsis mtDNA fragments containing promoters Patp9-239 and Patp9-295 (see Figure 19) were PCR-amplified from genomic DNA, purified via QIAquick spin columns (QIAGEN), and 5’ end-labelled using T4 polynukleotidkinase (PNK, Fermentas). Labelling reactions containing 400 ng PCR product, 10 U T4 PNK, 50 µCi [γ-32P]-ATP (3000 Ci/mmol) (Amersham Biosciences) and 4,8% (w/v) polyethylene glycol 6000 in PNK reaction puffer B (Fermentas GmbH) were incubated for 30 min at 37°C. Reactions were passed over MicroSpin G-50 Columns (Amersham Biosciences) in order to remove unincorporated nucleotides. DNA labelling was monitored using a Bioscan QC 2000 counter.
Binding reactions were set up in a total volume of 30 µl containing 10 mM Tris/HCl (pH 8.0), 10 mM KCl, 10 mM MgCl2, 1 mM DTT, 0.1 µg/ml BSA /ml, and the indicated amounts of recombinant MetA or MetB protein (50 or 100 ng). Reactions were pre-incubated for 10 min at room temperature, and then supplemented with ~5 ng (~ 104 cpm) of the labelled probe and incubated for another 30 min. In competition experiments, 5-10 ng of poly(dI-dC) were added after 5 min of pre-incubation. Reaction mixtures were resolved by native PAGE (see II.3.3.4).
mtDNA fragments were PCR-amplified from total Arabidopis DNA with primer pairs listed in Table 6. PCR products were SalI/PstI-digested and ligated into SalI/PstI-cleaved pKL23 (Liere and Maliga, 1999) upstream of terminator sequences to produce plasmid templates for in vitro transcription assays (see Figure 23, Figure 25 and Figure 27). Cloned templates were purified from E. coli using the QIAGEN Plasmid Midi Kit. Linearized templates were generated by a XhoI or EcoRI digest and purified via QIAquick spin columns (QIAGEN). In vitro transcription templates with their encoded promoters and oligonucleotides employed for plasmid construction are listed in Table 6.
↓36 |
Table 6: Construction of in vitro transcription templates.
Primer pair |
Primer sequences (5’ → 3’) |
In vitro transcription template |
|
Name |
Promoters |
||
pKL23-atp6-1-A-F pKL23-atp6-1-A-R |
cagcgagctcCACCGCACGAGTCAGACCT cagcctgcagTCCAGACAGCTTCACTCCGTC |
pKL23-atp6-1-A |
Patp6-1-156 Patp6-1-200 |
pKL23-atp6-1-B-F pKL23-atp6-1-B-R |
cagcgagctcGTTCTGCTTGATTAGGCGAATGC cagcctgcagCGGTTCATCGCCTTACTTATCCA |
pKL23-atp6-1-B |
Patp6-1-916/913 |
pKL23-atp6-1-C-F pKL23-atp6-1-B-R |
cagcgagctcCGGGATCAAACTATCAATCTCATA see above |
pKL23-atp6-1-C |
Patp6-1-156 |
pKL23-atp6-2-F pKL23-atp6-2-R |
cagcgagctcGGTTCTCCTCTCAGTTCCGTCTA cagcctgcagGTAGCATCCCGCCGATCT |
pKL23-atp6-2 |
Patp6-2-436 Patp6-2-507 |
pKL23-atp8-F pKL23-atp8-R |
cagcgagctcCCTGTACATACAAAGATCTAGGCAGCcagcctgcagAACAAAAGCATGGGAGAAAACC |
pKL23-atp8 |
Patp8-157 Patp8-228/226 |
pKL23-atp9-B-F pKL23-atp9-B-R |
cagcgagctcTGCGGAAGGAGATTGGAA cagcctgcagGTAGATCATTCGACGTCAGAGGG |
pKL23-atp9-B |
Patp9-239 Patp9-295 |
pKL23-atp9-F pKL23-atp9-R |
cagcgagctcCTTTGGATAATGGTCTAGCCGAGT cagcctgcagTGACAACCTCTAGGGCCAAG |
pKL23-atp9 |
Patp9-487 Patp9-652 |
pKL23-atp9-C-F pKL23-atp9-R |
cagcgagctcAGAGAAGGGCAGCATTTATGAGT see above |
pKL23-atp9-C |
Patp9-239 |
pKL23-cox2-F pKL23-cox2-R |
cagcgagctcGTTGCCTTGCCTTACCACACC cagcctgcagAGATCACTCTCCTAAAAGCAGCAGTC |
pKL23-cox2 |
Pcox2-210 Pcox2-481 |
pKL23-rps3-F pKL23-rps3-R |
cagcgagctcCAGTCCACCAATAGCGGAAGA cagcctgcagAGATAGAAATGATAGAGGGCCAACC |
pKL23-rps3 |
Prps3-1053 Prps3-1133 |
pKL23-rrn18-F pKL23-rrn18-R |
cagcgagctcAGTTGCTTATCCAGGCTTGGTGTT cagcctgcagGCGTACTACTTCCCAACCTTCTGTG |
pKL23-rrn18 |
Prrn18-69 Prrn18-156 |
pKL23-rrn18-C-F pKL23-rrn18-R |
cagcgagctcAGAAGGCTGCTTAGAGGAGTGATCT see above |
pKL23-rrn18-C |
Prrn18-69 |
pKL23-rrn26-F pKL23-rrn26-R |
cagcgagctcAAAGGCGTTATTGCTGTGCTTCC cagcctgcagCCGCCTCGAATCAAAACGTTC |
pKL23-rrn26 |
Prrn26-893 |
pKL23-trnM-F pKL23-trnM-R |
cagcgagctcGATTGATTCAATGAAAGTCCC cagcctgcagCCGCTTCTTCTCTTCTACAAG |
pKL23-trnM |
PtrnM-98 |
pKL23-trnM-B-F pKL23-trnM-B-R |
CCACGGGATTGAGTGAACGAG cagcctgcagGAAGTGAAGCAAGCGAGCCTCT |
pKL23-trnM-B |
PtrnM-574/573 |
Standard in vitro transcription assays were carried out for 45 min at 30°C and essentially followed the protocol of (Falkenberg, et al., 2002). Reactions contained 6.7 mM Tris/HCl (pH 7.9), 6.7 mM KCl, 6.7 mM MgCl2, 0.67 mM DTT, 0.067% (w/v) BSA, 267 µM each ATP, CTP and GTP, 13 µM unlabelled UTP and 10 µCi of [α-32P]-UTP (3000 Ci/mmol), 24 U RNase inhibitor and 200 ng of template DNA in a final volume of 15 µl. Reactions were started by adding 400 fmol of recombinant RpoTm or RpoTmp, and 400 fmol of MetA or MetB where indicated. Reactions were stopped by adding 115 µl RNA extraction buffer (6 M urea, 360 mM NaCl, 20 mM EDTA, 10 mM TRis/HCl pH 8.0, 1% (w/v) SDS) and 20 µl 2.25 M sodium acetate (pH 5.2). Nucleic acids were extracted with phenol/chloroform/isoamyl alcohol (25:24:1), precipitated from the aqueous phase by adding 375 µl ethanol, and washed with 70% (v/v) ethanol. Transcripts were then dissolved in formamide buffer (95% (v/v) formamide; 0,02% (w/v) bromphenol blue; 0,02% (w/v) xylene cyanol) and resolved by denaturing PAGE (II.3.3.3).
To map 5’ ends of in vitro-synthesized transcripts, transcription assays were carried out as described in II.7.2, omitting radiolabelled UTP. Following purification, samples were dissolved in ultrapure water and subjected to TAP-treatment and 5’-RACE as indicated in II.3.7; TAP and ligation reactions were downscaled to 1/10 compared the previously described protocol. 5’-RACE performed on non-ligated transcripts served as a control. Reverse primers P2hisa and P3hisa (Table 7) annealing to the hisa attenuator sequence in pKL23 derivatives (see Figure 23) were used for cDNA synthesis and PCR (40 cycles), respectively; P1a (see II.3.7) served as forward primer in PCR reactions.
↓37 |
Table 7: Primers used for 5’-end mapping of in vitro-synthesized RNAs
Primer |
Primer sequence (5’ → 3’) |
P2hisa |
CACATCGCCTGAAAGACT |
P3hisa |
GGATGATGGTGATGATGGTGG |
To generate the pMetA-GFP and pMetB-GFP constructs driving the expression of fusion proteins MetA-GFP and MetB-GFP, sequences encoding the 64 N-terminal amino acids of MetA and the 57 N-terminal amino acids of MetB were amplified from reverse-transcribed mRNA-enriched Arabidopsis RNA using primer pairs gfp-metA-P/gfp-metA-M and gfp-metB-P/gfp-metB-2M, respectively (Table 8). PCR products wereXbaI/SalI-digested and inserted into the SpeI/SalI-cleaved vector pOL−GFP S65C (Peeters, et al., 2000). Control constructs encoding mitochondrial CoxIV-GFP and plastidial RecA-GFP (Peeters, et al., 2000) were kindly provided by I. Small (INRA CNRS, Evry, France).
Table 8: Oligonucleotides used for amplification of MetA and MetB N-termini.
Primer pair |
Primer sequences (5’ → 3’) |
Plasmid |
gfp-metA-P |
cagctctagaATGATTCTTCGATTGAAAGACCA cagcgtcgacTGCACAGAAACAATCCATCG |
pMetA-GFP |
gfp-metA-M |
||
gfp-metB-P |
cagctctagaATGGCGGGAGGCAAGATC cagcgtcgacTCACATCGGTACTCTTGATACCAGC |
pMetB-GFP |
gfp-metB-2M |
↓38 |
Protoplasts were prepared from leaves of Nicotiana tabacum (var. SNN) and transformed with 60 ng of GFP fusion constructs following the protocol of (Morgan and Ow, 1995). Transformed protoplasts were incubated at 20°C in the dark for 16 h prior to microscopy. Epifluorescence microscopy was done using an Axioscope (Zeiss) with GFP- (Zeiss filter set 488013; excitation 470/20, emission 505−530) and FITC- (Zeiss filter set 488009; excitation 450−490, emission LP 520) filter sets.
Genomic sequences, EST sequences and amino acid sequences were retrieved from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/BLAST/) employing the blastp and tblastn algorithms, and from the Populus trichocarpa genome assembly 1.0 (http://genome.jgi-psf.org/Poptr1/Poptr1.home.html). Amino acid sequences were derived from genomic and cDNA sequences using the FEX tool at www.softberry.com and the Translate tool at www.expasy.ch. Amino acid sequences were aligned using the Multalin algorithm (Corpet, 1988).
To reconstruct the phylogeny of mitochondrial transcription factors and rRNA dimethylases from an amino acid sequence alignment of these proteins, three different methods were used. For a reconstruction based on Bayesianstatistics, the MrBayes program version 3.1 (Ronquist and Huelsenbeck, 2003) was used. The Bayesian inference method employed the JTT aminoacid replacement model (Jones, et al., 1992) anda gamma distribution to represent among-site rate heterogeneity(JTT +γ). A discrete gamma distribution with four categorieswas assumed to approximate the continuous function. The Metropolis-coupledMarkov chain Monte Carlo analysis (MCMC) was performed with2 million generations and four independent chains. The Markovchain was sampled every 100 generations. Convergence was judged by plotsof maximum likelihood (ML) scores and by using the run statistics.The MCMC analysis was assumed to have reached the convergencestate if all acceptance rates for the moves in the "cold" chainwere in the range 10%–70% and if the acceptance ratesfor the swaps between chains were also in the range 10%–70%.The first 10000 trees were discarded; the remaining trees were used to construct aconsensus tree and to calculate the posterior branch support values.In addition, maximum likelihood and and maximumparsimony analysis were conducted.
↓39 |
Ultrapure water was obtained from a USF Purelab Plus system. Chemicals and biochemicals were generally purchased from Roth, ICN Biomedical, Serva, Sigma or Becton-Dickinson; radiochemicals were provided by Amersham Buchler. Deoxyribonucleoside triphosphates and ribonucleoside triphosphates were obtained from Fermentas. Oligonucleotides listed in Tables 1-3 and 5-8 were purchased from Sigma or Eurogentec (annealing temperatures were determined using the oligo calculator at http://www.genscript.com/cgi-bin/tools/primer_calculation). All other materials have been specified in the previous sections.
Applied Biosystems |
Applied Biosystems, Weiterstadt, Germany |
Ambion |
Ambion, Inc., Austin, USA |
Amersham |
Amersham Buchler GMBH & Co. KG, Braunschweig, Germany |
Amersham Biosciences |
Amersham Biosciences Europe GmbH, Freiburg, Germany |
Biometra |
Biometra GmbH, Göttingen, Germany |
Bio-Rad |
Bio-Rad Laboratories, Richmond, VA, USA |
Biozym |
Biozym Diagnostik GmbH, Hameln, Germany |
Clontech |
Clontech Laboratories, Heidelberg, Germany |
DuPont |
DuPont de Nemours GmbH, Bad Homburg, Germany |
Epicentre |
Epicentre Biotechnologies, Madison, WI, USA |
Eurogentech |
Eurogentech, Seraing, Belgium |
Fermentas |
Fermentas GmbH, St. Leon-Rot, Germany |
Heraeus |
Heraeus, Hanau, Germany |
Invitrogen |
Invitrogen GmbH, Karlsruhe, Germany |
Macherey-Nagel |
Macherey-Nagel, Düren, Germany |
Millipore |
Millipore Corp., Bedford, USA |
Promega |
Promega Corp., Madison, USA |
QIAGEN |
QIAGEN, Hilden, Germany |
Retsch |
Retsch GmbH, Haan, Germany |
Roche |
Roche Molecular Biochemicals, Mannheim, Germany |
Roth |
C. Roth GMBH & Co, Karlsruhe, Germany |
Serva |
Serva Feinbiochemika, Heidelberg, Germany |
Sigma |
Sigma Chemical Company, St. Luis, USA |
Stratagene |
Stratagene, La Jolla, CA, USA |
USF |
USF, Seral Reinstwassersysteme GmbH, Germany |
Whatman |
Whatman Paper, Maidstone, UK |
© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme. | ||
DiML DTD Version 4.0 | Zertifizierter Dokumentenserver der Humboldt-Universität zu Berlin | HTML generated: 06.09.2006 |